ID: 925184628

View in Genome Browser
Species Human (GRCh38)
Location 2:1838593-1838615
Sequence GTGCAGTCGGTCCCTCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925184628_925184633 -2 Left 925184628 2:1838593-1838615 CCCCGCAGAGGGACCGACTGCAC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 925184633 2:1838614-1838636 ACAATCTGACTGCACAGAACGGG 0: 1
1: 0
2: 0
3: 8
4: 133
925184628_925184632 -3 Left 925184628 2:1838593-1838615 CCCCGCAGAGGGACCGACTGCAC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 925184632 2:1838613-1838635 CACAATCTGACTGCACAGAACGG 0: 1
1: 0
2: 2
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925184628 Original CRISPR GTGCAGTCGGTCCCTCTGCG GGG (reversed) Intronic