ID: 925185102

View in Genome Browser
Species Human (GRCh38)
Location 2:1841855-1841877
Sequence GTGCCTGCAGACGGGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925185098_925185102 -9 Left 925185098 2:1841841-1841863 CCAGGCTTCGGGTTGTGCCTGCA 0: 1
1: 0
2: 1
3: 8
4: 153
Right 925185102 2:1841855-1841877 GTGCCTGCAGACGGGAGAGTGGG 0: 1
1: 0
2: 2
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925185102 Original CRISPR GTGCCTGCAGACGGGAGAGT GGG Intronic
900228510 1:1544061-1544083 GGGCCTGCAGCCGGCAGAGCTGG - Intronic
900666591 1:3819713-3819735 GAGCCTGCAGGCAGGAGAGAAGG + Intronic
900937506 1:5775829-5775851 GTGACTGCAGGAGGGACAGTGGG - Intergenic
901206803 1:7502190-7502212 GGACCTCCAGAGGGGAGAGTGGG - Intronic
901213712 1:7541272-7541294 CTGCCTGGAGAAGGGAGAATGGG + Intronic
902360614 1:15940910-15940932 CTGCCTCCAGACAGGAGAATGGG + Intergenic
902932232 1:19739820-19739842 GTACCTGCTGCCGGGAGAGCAGG + Exonic
903591035 1:24456119-24456141 GAGCCTGCAGATGGGAGACAAGG - Exonic
904629940 1:31833519-31833541 TTCCCTGCAGAAGGGAAAGTGGG - Intergenic
905292802 1:36934299-36934321 GAGTCTGCACACAGGAGAGTAGG - Intronic
906609908 1:47194112-47194134 GTGACTTCAGATGGGAGAGAAGG - Intergenic
907440535 1:54475614-54475636 GCGCCTGCAGACCGGAGCGCAGG - Intergenic
908053270 1:60255979-60256001 TTGTCCGCAGACTGGAGAGTAGG - Intergenic
911035120 1:93534817-93534839 GTGCATCCAAACAGGAGAGTGGG + Exonic
915080195 1:153346644-153346666 GGGCCTTCAGACAGGAGAATGGG - Intronic
915213494 1:154326077-154326099 GTGCCTGGAGAAGGGAGTTTGGG + Intronic
917139442 1:171820355-171820377 ATGCCTGCAGCCTGGAGACTAGG - Intergenic
918479198 1:184959338-184959360 TTGCCTGAAGACTGGAGACTAGG + Intronic
919751351 1:201040079-201040101 GAGCCTGCAGGGAGGAGAGTAGG + Exonic
923141932 1:231167753-231167775 GAGCCTTAAGACGTGAGAGTTGG - Intronic
923330261 1:232917336-232917358 GGCCCTGCAGATGGGAGAGGGGG + Intergenic
923671117 1:236042200-236042222 GTGCCTGCAGACGTGATCCTCGG - Exonic
1063262232 10:4403128-4403150 GTGCCTGCAGGCACCAGAGTAGG + Intergenic
1063711369 10:8482448-8482470 GTGCCTGCAGAACGTACAGTGGG - Intergenic
1064229196 10:13514609-13514631 GTGCCGGCACACGGTAGAGCAGG - Intronic
1070960329 10:80494924-80494946 GTGCCTGCAGACAGGACGCTGGG - Intronic
1072564514 10:96606468-96606490 ATGCCAGCAGAAGGGACAGTGGG - Intronic
1073297690 10:102450937-102450959 GAGCCTGCATGCGGGCGAGTGGG - Exonic
1074254057 10:111782812-111782834 GTAACTGCAGATGGGAGAATAGG - Intergenic
1076417232 10:130300681-130300703 GCGCCTGCAGGCAGGAGAGCGGG - Intergenic
1076417293 10:130300900-130300922 GGGCCTGCAGGCAGGAGAGCGGG - Intergenic
1076417380 10:130301220-130301242 GGGCCTGCAGGCAGGAGAGCGGG - Intergenic
1076485643 10:130814947-130814969 GTGCTTGCGGATGGGTGAGTGGG + Intergenic
1076641760 10:131921503-131921525 GAGCCTGCAAAGGGGAGAGAGGG + Intronic
1076883281 10:133249824-133249846 GTGCCTGCAGGAGTGAGTGTGGG - Intergenic
1077308032 11:1876568-1876590 CTGCCTGCAGGGGGCAGAGTCGG + Intronic
1077506168 11:2930876-2930898 GTGCCGGCAGAGGGCAGGGTTGG + Intergenic
1077584495 11:3440377-3440399 GTGTCTGCAGACCCCAGAGTTGG + Intergenic
1077675599 11:4191135-4191157 GTGCCCACAGAGGGGAGAGGGGG - Intergenic
1077694605 11:4383182-4383204 GTGCCTGCCCAGGGGAGTGTGGG - Intergenic
1078509626 11:11975759-11975781 GAGCCTGTAGAGGGGAGTGTGGG - Intronic
1080575646 11:33596842-33596864 GTGCCGCCAGTTGGGAGAGTAGG + Intronic
1083265823 11:61546479-61546501 GAGCCTGCAGAGGAGAGAGGGGG + Intronic
1083840140 11:65299565-65299587 GTGGCTGCAGAAGGCAGAGCTGG - Intronic
1083857608 11:65400880-65400902 GTGCCTGCACACGGGTGGGGAGG + Intronic
1084147692 11:67273770-67273792 GTGGCTGCTGAGGGGAGAGATGG + Intronic
1084831048 11:71769611-71769633 GTGTCTGCAGACCCCAGAGTTGG - Intergenic
1085301898 11:75463494-75463516 GTGCCTGCAGACGCCTGAGCTGG - Intronic
1086032962 11:82382998-82383020 GTTCCTGCAGAAGGGACAATTGG - Intergenic
1087654627 11:100907503-100907525 CTGCTTGCAGATGGGGGAGTTGG + Intronic
1088722333 11:112605142-112605164 GTGCTTGCATATGGGAAAGTAGG + Intergenic
1088898404 11:114095030-114095052 CTGCCTGCAAACGTGAGAGGGGG + Intronic
1089067795 11:115675070-115675092 TGGCCTGCAGAGGGGAGGGTGGG + Intergenic
1089397870 11:118147629-118147651 CTGGCTGCAGACTGGAGAGTGGG - Intronic
1089520587 11:119060128-119060150 GTGCCTCCACAAGAGAGAGTGGG - Intergenic
1089642925 11:119859515-119859537 GAGCCTTCAGATGGGAGAGGAGG + Intergenic
1102997893 12:117363489-117363511 GTGCCTGCAGAAGGCAGAGTTGG + Intronic
1103909502 12:124344588-124344610 GCGCCTGCAGGAGGGTGAGTGGG - Exonic
1104286070 12:127426147-127426169 GTGCCAGCAGACAGAAGAGGAGG + Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1108314676 13:49225454-49225476 CTGCCTGCAGAAGGGAGAGGGGG - Intergenic
1108727971 13:53201894-53201916 TTGCCTGCAGACGGGTCAGCAGG - Intergenic
1109495002 13:63158107-63158129 GAGCCTGCAGAAGAAAGAGTCGG - Intergenic
1110225796 13:73117974-73117996 TTGACTGCAGAGGGGAGAGTTGG + Intergenic
1110774654 13:79394136-79394158 GTGCCAGCAGAGGGGAAGGTTGG - Intronic
1112271436 13:97973939-97973961 GTGCCTGCAGACCAGCTAGTTGG + Intronic
1114458984 14:22875097-22875119 GTGGCTGGAGAGGGGAGCGTAGG - Exonic
1117194320 14:53324395-53324417 GTGCAGGAAGACAGGAGAGTGGG - Intergenic
1118643487 14:67815876-67815898 ATGCCTGCGGAGGGGAGAATGGG - Exonic
1119182627 14:72614914-72614936 GTGCCTGGGGAAGGGAGGGTGGG - Intergenic
1121087241 14:91155937-91155959 GTGCCCTCAGAGGGGAAAGTGGG - Intronic
1121563749 14:94893600-94893622 GTATCTGCAGGCTGGAGAGTGGG + Intergenic
1121571087 14:94946994-94947016 TTGCCAGCTGCCGGGAGAGTTGG - Intergenic
1122206073 14:100148625-100148647 GAGCCTGCAGACGGGAAGGATGG + Intronic
1122745961 14:103897382-103897404 GTGGCTGCAGAGGGGGGAGGTGG - Intergenic
1122805030 14:104252249-104252271 GAGCCTGCAGATGGGTGTGTGGG + Intergenic
1123666777 15:22614485-22614507 GTGTCTGGAGAGGAGAGAGTCGG + Intergenic
1124320617 15:28709058-28709080 GTGTCTGGAGAGGAGAGAGTCGG + Intronic
1124349401 15:28944073-28944095 TTGGCTGCAGAGTGGAGAGTGGG - Intronic
1124481876 15:30086291-30086313 GTGTCTGGAGAGGAGAGAGTCGG - Intronic
1124488332 15:30138389-30138411 GTGTCTGGAGAGGAGAGAGTCGG - Intronic
1124521716 15:30410910-30410932 GTGTCTGGAGAGGAGAGAGTCGG + Intronic
1124536948 15:30555309-30555331 GTGTCTGGAGAGGAGAGAGTCGG - Intronic
1124543422 15:30607363-30607385 GTGTCTGGAGAGGAGAGAGTCGG - Intronic
1124563379 15:30794814-30794836 GTGTCTGGAGAGGAGAGAGTCGG - Intergenic
1124755195 15:32399931-32399953 GTGTCTGGAGAGGAGAGAGTCGG + Intronic
1124761703 15:32452282-32452304 GTGTCTGGAGAGGAGAGAGTCGG + Intronic
1124776925 15:32596786-32596808 GTGTCTGGAGAGGAGAGAGTCGG - Intronic
1124959903 15:34386416-34386438 GTGCCTGGAGAGGAGAGAGTCGG + Intronic
1124976530 15:34532637-34532659 GTGCCTGGAGAGGAGAGAGTCGG + Intronic
1125760470 15:42092913-42092935 GTGCCAGCAGACGACAGGGTGGG - Intronic
1129037379 15:72658830-72658852 GTGTCTGGAGAAGAGAGAGTCGG - Intronic
1129212508 15:74078395-74078417 GTGTCTGGAGAAGAGAGAGTCGG + Intronic
1129397891 15:75262684-75262706 GTGTCTGGAGAAGAGAGAGTCGG - Intronic
1129401502 15:75286965-75286987 GTGTCTGGAGAAGAGAGAGTCGG - Intronic
1129729644 15:77922714-77922736 GTGTCTGGAGAAGAGAGAGTTGG + Intergenic
1129917200 15:79283957-79283979 GTGACTGCAGAAGGAAGAGGCGG + Intergenic
1132433497 15:101778888-101778910 GTGTCTGGAGAGGAGAGAGTCGG + Intergenic
1132578829 16:676008-676030 CTGGCTGGAGAAGGGAGAGTCGG + Intronic
1132981909 16:2742623-2742645 GTCCCTGCAAAGGGCAGAGTGGG - Intergenic
1133008733 16:2898483-2898505 GTCCCTGCAGAGGGCAGAGGGGG + Intronic
1133162404 16:3920712-3920734 CTGCCTGCAGAAGGAAGAGGGGG - Intergenic
1133838066 16:9384026-9384048 GTGCCTGCAGAGTAGACAGTGGG - Intergenic
1138174071 16:54880308-54880330 CTGGATGCAGAAGGGAGAGTAGG - Intergenic
1138190278 16:55008959-55008981 GTGGCTGCAAGCGGGGGAGTGGG + Intergenic
1138472651 16:57250392-57250414 GTGCCTGCAAACGGAACAGATGG - Exonic
1139696123 16:68676255-68676277 GTGGCTGCAGAAGGGAGACTTGG - Intronic
1139901626 16:70332949-70332971 ATGCCTGCAGGAAGGAGAGTTGG - Exonic
1139906716 16:70371353-70371375 ATGCCTGCAGGAAGGAGAGTTGG - Exonic
1141238220 16:82240503-82240525 GAGCCTGCAGACTGGAGTGCTGG - Intergenic
1142234959 16:88917818-88917840 GTGCGTGAAGACGAGAGTGTGGG + Intronic
1143074377 17:4327945-4327967 GTTCCTGCAGAAGGAAGAGAAGG - Intronic
1143269450 17:5665069-5665091 GGCCCTGCAGACGTGGGAGTGGG + Intergenic
1144728732 17:17514764-17514786 CTGCCTGCAGATGGTGGAGTGGG + Intronic
1147369439 17:39981331-39981353 GGGCCTGGAGTCGGGAGTGTCGG - Intronic
1151215638 17:72574925-72574947 GGGCCTGGAGAAGGGAGGGTGGG - Intergenic
1151401686 17:73859844-73859866 GTTCTGGCAGAGGGGAGAGTGGG - Intergenic
1151883596 17:76910240-76910262 GTGGGTGCAGGCGGGCGAGTGGG - Intronic
1152430531 17:80246233-80246255 GTGCCCGCAGCCCTGAGAGTGGG + Intronic
1152672412 17:81616971-81616993 CTGCCTGCAGGAGGGAGATTTGG - Intronic
1152893463 17:82896094-82896116 GTGCCTGAAGAAGGGGGTGTGGG - Intronic
1152934309 17:83127324-83127346 GTGCCTGGGGACGACAGAGTCGG + Intergenic
1154027010 18:10717391-10717413 GTGCCAGCAGAGGGGAGGCTTGG + Intronic
1156420871 18:36951515-36951537 GTGGCTGAAGACATGAGAGTGGG - Intronic
1156584622 18:38418075-38418097 TTGCCTGGAGGAGGGAGAGTTGG - Intergenic
1160143790 18:76348126-76348148 GTGTCTCCAGGCTGGAGAGTGGG - Intergenic
1161481705 19:4513964-4513986 CTGCCTGCAGCCGGGAAAGGGGG - Intronic
1163087634 19:14993796-14993818 GTGCTTGCAGACAGGATGGTTGG + Intronic
1163154811 19:15433850-15433872 GAGCCTGCAAAGGGGAGGGTGGG - Intronic
1163740643 19:19009792-19009814 GACCCTGGAGATGGGAGAGTAGG + Intronic
1166311823 19:41967337-41967359 GGGCCTGCAGAGGGGAGAGCAGG + Exonic
1166561392 19:43734473-43734495 GTTCCTGCAGACAGCAGAGATGG - Exonic
1167402098 19:49279744-49279766 GTGCCTGCAGGCAGGACAGTCGG - Intergenic
1167665210 19:50819564-50819586 GTGCCTGCAGACAGGTTAGGGGG + Intronic
1167696678 19:51019272-51019294 GGGCTGGCAGACGGGAGATTCGG + Intronic
1167937931 19:52922860-52922882 GTGACTGCGGAGGGGAGACTTGG + Intergenic
925119136 2:1403833-1403855 CTGCGTGCAGAGGGGAGATTTGG - Intronic
925185102 2:1841855-1841877 GTGCCTGCAGACGGGAGAGTGGG + Intronic
925613979 2:5727764-5727786 GGGCCTGCAGAAAGGAGAATTGG - Intergenic
925718850 2:6809179-6809201 GTGGCTGGAGAGGGGAGAGGTGG - Intergenic
926121813 2:10245348-10245370 GTGGCTGCAGAGGGAAGAGAAGG + Intergenic
926130201 2:10298217-10298239 GTGCCTGGAAAGGGGAGAGTTGG - Intergenic
928091062 2:28375397-28375419 GTGGCTGCAGAGGGGAGACTTGG + Intergenic
928366947 2:30710151-30710173 GTGCCTGCTCAAGGGAGAGCCGG - Intergenic
935428754 2:102950216-102950238 GTGCCACCAGACAGGAGACTGGG - Intergenic
937234313 2:120421323-120421345 GTGGGTGGAGCCGGGAGAGTGGG + Intergenic
937473304 2:122191757-122191779 GGGCCTGCAGCTGGGAGAGGAGG + Intergenic
937512375 2:122610861-122610883 GTACCTGCAGAAGGGACAATTGG - Intergenic
946370887 2:219280546-219280568 GTGGGTGCAGAGGAGAGAGTCGG - Intronic
948832857 2:240606749-240606771 GTGCCTGCAGTGCGGGGAGTGGG + Intronic
949026919 2:241770631-241770653 GTGCCTGCAGAGGGGGGAGGAGG + Intergenic
1168996780 20:2139118-2139140 GTGCCTGCAGGCTGAGGAGTAGG + Intronic
1170138791 20:13104420-13104442 GTGATGGCAGACGAGAGAGTGGG - Intronic
1170437435 20:16345078-16345100 GTGAGTGCAGACGAGAGAGGAGG - Intronic
1174054660 20:47789531-47789553 ATGGCTGCAGACGGGAGGCTTGG + Intergenic
1174079040 20:47957945-47957967 CTGCCTCCAGATGGGAGAGGAGG + Intergenic
1174693346 20:52531771-52531793 GTGGCTGCAGAAGAGAGAGTGGG + Intergenic
1175273819 20:57753931-57753953 GTGCCTTGAGAGGTGAGAGTGGG + Intergenic
1175388740 20:58613444-58613466 GTTTCTGCAGAAGGGAGAGAGGG + Intergenic
1178582020 21:33845665-33845687 GTGCTTGCAGAGGGGAAACTGGG + Intronic
1179323660 21:40318479-40318501 CTGCCAGCAGAGGGGAGAGTTGG - Intronic
1180040794 21:45278502-45278524 GTGCCTGAGGAGGGGAGGGTGGG + Intronic
1180599625 22:17007678-17007700 GGGCCTGCAGGTCGGAGAGTGGG - Intronic
1180713961 22:17858982-17859004 GTGCCTGCAGAAGGGAGAGAAGG - Intronic
1180948358 22:19708981-19709003 GGTCCTGAAGACGGGACAGTAGG + Intergenic
1181560213 22:23695635-23695657 GTGTCTGCAAAGGGCAGAGTGGG - Intronic
1182569996 22:31229761-31229783 GTGGCTGCAGACAGAAGAATGGG - Intronic
1183718208 22:39546758-39546780 GGGGCTGGAGAGGGGAGAGTGGG - Intergenic
1183792468 22:40083921-40083943 CTTCTTGCAGAGGGGAGAGTAGG + Intronic
1184564855 22:45285722-45285744 GTGTCTGCAGCAGGGAGAGAAGG + Intronic
949575106 3:5331339-5331361 GTGCCTGCGGCCGGGAGCGGTGG - Intergenic
951663482 3:25096321-25096343 GTGCCTCAAGAGGGGAGAGAAGG + Intergenic
952042679 3:29279555-29279577 CTGCCTTCAGCCAGGAGAGTTGG + Intergenic
957056867 3:75449936-75449958 GTGTCTGCAGACCCCAGAGTTGG + Intergenic
957068715 3:75548490-75548512 ATGCATGCAGACAGGAGAATTGG + Intergenic
961296604 3:125889780-125889802 GTGTCTGCAGACCCCAGAGTTGG - Intergenic
961705829 3:128784476-128784498 CTGCCTGCAGTGGGGAGGGTAGG - Intronic
963382874 3:144553885-144553907 TTGCCTGTAGTGGGGAGAGTTGG + Intergenic
968999687 4:3970222-3970244 GTGTCTGCAGACCCCAGAGTTGG + Intergenic
969198264 4:5580626-5580648 GAGCCTGCAGAGGGAAGAGCAGG - Intronic
969754323 4:9138413-9138435 GTGTCTGCAGACCCCAGAGTTGG - Intergenic
976478357 4:85510650-85510672 GAGCCTGGAGAGGGGAGAGGAGG - Intronic
976563605 4:86529341-86529363 ATGCCTGCAGACTTGAGAGTTGG - Intronic
986809949 5:11346417-11346439 GTGCCTTCAGGCGGGAGAGCAGG + Exonic
994368653 5:98945313-98945335 GTGACTGCACACTGGAAAGTGGG - Intergenic
995755850 5:115503173-115503195 GTGCCTGCAGAAGGTAGGTTTGG + Intergenic
997224387 5:132198049-132198071 TTGGCTGCAGTAGGGAGAGTTGG - Intronic
1003041720 6:2694232-2694254 GTCCCTGCAGAGGGAAAAGTAGG - Intronic
1005917905 6:30370229-30370251 GTGGCTGCAGGCAGAAGAGTAGG + Intergenic
1007358923 6:41341723-41341745 GTGCCTGCCGGCAGGAGAGCTGG - Intronic
1008246395 6:49179052-49179074 GAGCCTGAAGACGTGAGATTTGG - Intergenic
1011762943 6:90587456-90587478 CTGCCTGCAGCCGGGCGAGGTGG + Intergenic
1014116508 6:117673759-117673781 GTGCCTGCACACCTGAGAGCAGG + Intergenic
1016786900 6:148020881-148020903 GTGTCTGGAGATGGGACAGTGGG + Intergenic
1018767336 6:166944781-166944803 GTGCCTGCAGCTGGGAAAGGCGG - Intronic
1019504756 7:1385326-1385348 GTGCTTGCAGATGGGAGGTTGGG + Intergenic
1019616404 7:1964885-1964907 GGGCCTGGAGAGGGGACAGTAGG + Intronic
1022451773 7:30522935-30522957 GTGTCTGGAGAAGAGAGAGTCGG + Intronic
1025099584 7:56123642-56123664 CTGCCTGCCTACGGGACAGTGGG - Intergenic
1025979987 7:66397488-66397510 GTCCCTGCAGATGGGTGGGTAGG - Intronic
1026202237 7:68224280-68224302 CTGCCTGAAGAGGGGGGAGTGGG + Intergenic
1026833493 7:73623804-73623826 GTGGCTCCAGAGTGGAGAGTGGG + Intronic
1026975598 7:74495800-74495822 GGGCCTGCAGACTGGAGTGTGGG + Intronic
1027429407 7:78094922-78094944 GCGGCTGCAGAGGGGAGAGAGGG - Intronic
1027983978 7:85261655-85261677 GTGGCTACAGATGGAAGAGTTGG - Intergenic
1033497762 7:141916740-141916762 GAGCCTGAAGACTGGACAGTGGG + Intronic
1037903915 8:22704145-22704167 GGGCCTCCAGAAGGGAGAGTTGG - Intergenic
1045415229 8:101959858-101959880 GTGTCTGCAGTAGGGAGGGTGGG - Intronic
1049998670 9:1053159-1053181 GTGACTGCAGAGGCGAGGGTGGG + Intronic
1050292128 9:4165940-4165962 GTGCTTGCAGACAGGGGAGTAGG + Intronic
1056552922 9:87665837-87665859 GTGGCTGCAGAAGGGTGAGTTGG - Intronic
1059669749 9:116480813-116480835 GTGCCTGCAGAGTGGTGGGTAGG + Intronic
1061563681 9:131423129-131423151 TTGCCTACAGAAGGGAGAGAAGG + Intronic
1061875103 9:133539671-133539693 GTGGCTGCAGCCGGGACAGCCGG - Intronic
1062028955 9:134353340-134353362 GGGCCAGCATACTGGAGAGTGGG + Intronic
1062196116 9:135275172-135275194 GTGCAGGCAGACGTGAGGGTAGG - Intergenic
1190024878 X:46913250-46913272 GTGCCTGGAGAGGGGAGAACGGG + Intronic
1190169185 X:48098258-48098280 TTGCATGGAGATGGGAGAGTGGG + Intergenic
1190474632 X:50814139-50814161 GCGTCTCCAGCCGGGAGAGTAGG - Intronic
1192033781 X:67543587-67543609 GAGCGCGCAGATGGGAGAGTGGG - Intergenic
1196455642 X:115889577-115889599 GTCTCTGCACACGGGAGAGGAGG - Intergenic