ID: 925186360

View in Genome Browser
Species Human (GRCh38)
Location 2:1849449-1849471
Sequence GACATTGATGTGGCTTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925186360_925186367 12 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186367 2:1849484-1849506 CTGCCCTGGGTCTGTGGCAGTGG 0: 1
1: 1
2: 5
3: 53
4: 541
925186360_925186371 23 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186371 2:1849495-1849517 CTGTGGCAGTGGTCCCCCCAGGG 0: 1
1: 0
2: 1
3: 18
4: 160
925186360_925186366 6 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186366 2:1849478-1849500 CCTCTGCTGCCCTGGGTCTGTGG 0: 1
1: 0
2: 7
3: 73
4: 661
925186360_925186370 22 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186370 2:1849494-1849516 TCTGTGGCAGTGGTCCCCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 157
925186360_925186372 24 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186372 2:1849496-1849518 TGTGGCAGTGGTCCCCCCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 161
925186360_925186363 -1 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186363 2:1849471-1849493 CATAAGCCCTCTGCTGCCCTGGG 0: 1
1: 0
2: 2
3: 16
4: 220
925186360_925186362 -2 Left 925186360 2:1849449-1849471 CCTGGTGAAGCCACATCAATGTC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 925186362 2:1849470-1849492 TCATAAGCCCTCTGCTGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925186360 Original CRISPR GACATTGATGTGGCTTCACC AGG (reversed) Intronic
901733698 1:11298752-11298774 GACATTGAGATGGCTTTACCAGG - Intergenic
903292560 1:22324040-22324062 GAGATTGATGTGGCCTCCCCGGG + Intergenic
904556073 1:31365390-31365412 GTCAGTGATGGGGCTTCCCCAGG - Intergenic
906535023 1:46546640-46546662 GACTTTGAAGTGGCTTCCCAGGG + Intronic
908469465 1:64429380-64429402 ACCAGTCATGTGGCTTCACCTGG - Intergenic
910197473 1:84658553-84658575 GATTTTGATGTGGCTTCCTCTGG - Intronic
910508596 1:87978189-87978211 GTCTTTGAGGTGGCTTCACATGG + Intergenic
918624662 1:186643628-186643650 GACAATGAACTAGCTTCACCTGG - Intergenic
921541844 1:216425553-216425575 GACATTTCTGTGGATTCACCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1063007597 10:1988374-1988396 TTCAATGATGTGGCTGCACCAGG - Intergenic
1063328971 10:5136543-5136565 GATATTGGTGTGGATTCATCAGG - Intergenic
1064245383 10:13663816-13663838 GACAATGATGTGGTTTAATCAGG - Intronic
1068022377 10:51601485-51601507 GACATTGTTTTGGTTCCACCCGG + Intronic
1068578198 10:58708372-58708394 GACAATGATGCCGCTTCACTTGG - Intronic
1069556000 10:69399024-69399046 GACAGAGAAGTGGCTTCACTTGG + Intronic
1071039286 10:81286944-81286966 TACTTTTATGTGGATTCACCTGG + Intergenic
1071809845 10:89167517-89167539 GACAATGAACTGGATTCACCAGG + Intergenic
1072546156 10:96441134-96441156 GACATGGCTGTGCCTTCAGCTGG - Intronic
1080081369 11:28222231-28222253 GCCATTGCTGAGGCTTCAGCAGG - Intronic
1080176324 11:29367163-29367185 GACATAGGTGTGTCTTCACCTGG + Intergenic
1080907324 11:36560151-36560173 GACAGTGATGTGGCTTTGCTGGG + Intronic
1083765091 11:64837908-64837930 GACCTGGGTGTGGCTTCACCAGG + Intronic
1084920148 11:72462645-72462667 GATATTGATCTGCCTTCTCCTGG - Intergenic
1085919387 11:80933854-80933876 GACAATGATGAGGCTTAACCTGG + Intergenic
1089176461 11:116552261-116552283 GGCATTCATGTGAGTTCACCAGG + Intergenic
1089363423 11:117906076-117906098 GACATGGAAGAGGCTCCACCAGG - Intronic
1091278003 11:134365223-134365245 GTGTTTGATGTGGCTTCTCCTGG + Intronic
1091773724 12:3170625-3170647 GTCATGCATGTGGCTTCTCCTGG + Intronic
1092054636 12:5498881-5498903 GAGATTTGTCTGGCTTCACCAGG + Intronic
1094805210 12:34083689-34083711 GCCATTGCTGAGGCTTCAGCAGG + Intergenic
1105657972 13:22460970-22460992 GACATTGTGGTTGCTACACCAGG - Intergenic
1108348769 13:49571413-49571435 GACATTCATGAGGTTTAACCAGG - Intronic
1117528939 14:56639946-56639968 GCCATTGCTGAGGCTTCAGCAGG + Intronic
1117755704 14:58972099-58972121 GACAATGACGTCGCTTCAACAGG - Intergenic
1119945139 14:78685466-78685488 GAGATTGGTGTGGCTGCATCAGG - Intronic
1122443987 14:101755790-101755812 GACAATGAGTTGGCTACACCAGG + Intergenic
1123000898 14:105293570-105293592 GACACTGATGTGGGCTCACAGGG + Intronic
1124693787 15:31846621-31846643 GATATTGATGGGGGCTCACCGGG - Intronic
1127239044 15:57090615-57090637 GACATTAATGTGGCTGAAACAGG - Intronic
1129152536 15:73697980-73698002 GGCATAGATGTGGCTTGATCAGG + Intronic
1132793101 16:1704639-1704661 GTCACTGATGTGGTTTCATCAGG + Intergenic
1133017123 16:2949195-2949217 GAGATTGGTGTGGGTTGACCTGG - Exonic
1134625513 16:15720026-15720048 GCCATTGGTGTGGGTTCAGCTGG - Intronic
1135301756 16:21334719-21334741 GCCATTGCTGAGGCTTGACCAGG - Intergenic
1140929630 16:79615217-79615239 GACCTGTATGAGGCTTCACCTGG + Intergenic
1144386720 17:14755006-14755028 GACATTGGTGTGGCTTCTTCAGG - Intergenic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1150188668 17:63214602-63214624 GCCTTTGCTGTGGCTTCACATGG + Intronic
1150357940 17:64504649-64504671 TAAATTCATGTGGCTTCATCAGG - Intronic
1150616143 17:66773732-66773754 GACAGTGCTGTGGCATCTCCAGG + Intronic
1150855350 17:68747017-68747039 GACATGGATGTGGCATCTCATGG + Intergenic
1153486818 18:5607158-5607180 GACATTCCAGTGGCTTCACATGG - Intronic
1153615330 18:6928855-6928877 GACAGTGATGCTGCTTCAGCTGG + Intergenic
1156047677 18:32895792-32895814 GACATTGATTTTGGTTCCCCTGG + Intergenic
1157817057 18:50737052-50737074 GGCTTAGATGTGGCTTCTCCTGG - Intergenic
1160022181 18:75189664-75189686 GACATTTATTTGGTGTCACCTGG + Intergenic
1160126529 18:76177996-76178018 GGCCTCGATTTGGCTTCACCAGG - Intergenic
1160536432 18:79596975-79596997 GACATTGATGGGAGGTCACCTGG + Intergenic
1160741301 19:687276-687298 GCCATTGATTTTGCTTCACAAGG - Intronic
1162015741 19:7845685-7845707 GGCATTGATCTGCCTCCACCAGG + Intronic
1164478296 19:28592011-28592033 GACATTGATGAGCCATCACTGGG - Intergenic
1168122879 19:54263807-54263829 AACATCGATGGGGCATCACCAGG + Intronic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
926349019 2:11978428-11978450 TACATTCATGTGTCTTCCCCAGG + Intergenic
929235223 2:39598001-39598023 GACATTGATGGGGCCTCTCTCGG - Intergenic
929586024 2:43114981-43115003 GCCATTGAGCTGGCTTAACCTGG - Intergenic
936244749 2:110816933-110816955 GGCATGGATGTGGCTTCCCTGGG + Intronic
937151892 2:119691850-119691872 GACATTGCTGTGGCAGCAGCTGG + Intergenic
945656681 2:212632643-212632665 GAGATTGATGTTGCTTGTCCAGG - Intergenic
946432870 2:219634878-219634900 GTCTTTGCTGTGGCTTCTCCTGG + Intronic
946715327 2:222548681-222548703 GACATTGATGTGCTTTCAATAGG + Intronic
948297962 2:236876939-236876961 CACAATGATGTGGATTCACTGGG + Intergenic
1170807712 20:19647445-19647467 GGCATTGATGTGCCAGCACCCGG - Intronic
1172213610 20:33218086-33218108 GACATCTATGTTGCTTCAGCTGG + Intronic
1173482944 20:43417204-43417226 GGCAGTGGTGTGGCTTTACCGGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178876592 21:36419003-36419025 GACACTGAAGTGACTTCACTTGG - Exonic
1183694423 22:39413605-39413627 GACAGAGATGGGGTTTCACCAGG + Intronic
952628827 3:35440256-35440278 GACAATGAGGCTGCTTCACCAGG + Intergenic
953350414 3:42211096-42211118 GACATTCCTGAGGATTCACCAGG + Intronic
955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG + Intronic
956576715 3:70760262-70760284 GACAATGATGAGGCTTCACTGGG + Intergenic
962951901 3:140227417-140227439 TACATTACTGTGGCTTCACAGGG + Intronic
963175023 3:142289207-142289229 GACAGTGATGCTGCTTCACCAGG + Intergenic
964209865 3:154214708-154214730 GACATTTTTGTGACTTCTCCTGG - Intronic
967309580 3:188093466-188093488 GACATTGAGGTGAATTCTCCAGG - Intergenic
969424591 4:7116716-7116738 GCCACTGATGTGGCTTCTCGGGG + Intergenic
972632743 4:40856611-40856633 GACAGAAATGTGGCCTCACCAGG + Intronic
974740567 4:66001311-66001333 GAAAGAGATGTGGCTTCAACAGG + Intergenic
976854788 4:89590861-89590883 GACATAGATGTGGCCACATCTGG + Intergenic
981113117 4:140958438-140958460 GCCATTGAGGTGGCTTCGTCTGG + Intronic
984108114 4:175575400-175575422 GACATTGATGTGGTTTTACTTGG + Intergenic
985720390 5:1485771-1485793 GACATGGATGTGGCTCTCCCCGG - Intronic
985720400 5:1485817-1485839 GACATGGATGTGGCTGTCCCTGG - Intronic
986569636 5:9151874-9151896 GACACTGGTGTGTCTTCACTGGG - Intronic
986776784 5:11022738-11022760 GACAGAGATATGGCGTCACCAGG + Intronic
995633805 5:114162680-114162702 GCCATTGCTGAGGCTTCAGCAGG - Intergenic
997153139 5:131521126-131521148 GATATTAATATGGATTCACCTGG + Intronic
998055350 5:139071449-139071471 GACTTGGGTGTGACTTCACCTGG + Intronic
999261708 5:150242567-150242589 GCCTGTGATGTGGCTCCACCAGG + Intronic
999964964 5:156799424-156799446 GGGATTGATGTGGCTCTACCAGG - Intergenic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1004785585 6:18964084-18964106 GACAAAGATGTGGGTTCACTTGG - Intergenic
1008315107 6:50030325-50030347 GACAGAGATGGGGCTTCAGCAGG + Intergenic
1023029924 7:36082705-36082727 GACTTTGATGAGGGTTCAACAGG + Intronic
1024234044 7:47384477-47384499 GGCATTTCTGTGGCTTCTCCTGG + Intronic
1026603106 7:71792980-71793002 GACATTGGTGTGAATTCTCCAGG - Intronic
1033048005 7:137979906-137979928 GAAACTGATGTGGCCTCCCCTGG - Intronic
1034945146 7:155257313-155257335 TTCTTTGATGTGGCTTAACCTGG - Intergenic
1036077417 8:5516909-5516931 GACGTTGATCTGCCTTCCCCTGG + Intergenic
1038382721 8:27112138-27112160 GACAATGATGTGAGTTCAACAGG + Intergenic
1043146040 8:76655956-76655978 TACATTGATTTTCCTTCACCAGG - Intergenic
1043573823 8:81633715-81633737 GACCTTCTTGTGGCTTCACAGGG - Intergenic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1044595629 8:93955739-93955761 GACTTTGTTGTGGCTGCTCCAGG + Intergenic
1044621751 8:94197211-94197233 GACAATGATGCCACTTCACCTGG + Intronic
1048649434 8:136458437-136458459 GACATTGATTTGGCTTTCTCTGG - Intergenic
1049180617 8:141220253-141220275 GACACTGATGAGGCTTCGCGAGG + Intronic
1049337607 8:142094711-142094733 GAAATTTAAGTGGCTTCACTGGG - Intergenic
1054812244 9:69444186-69444208 CACATTCATGTGGCATCTCCTGG + Intronic
1055018801 9:71647261-71647283 GACATTCAGGTGGCTTCAACTGG - Intergenic
1056724857 9:89106017-89106039 GAAAGTGCTGTGGCTGCACCTGG - Intronic
1061068561 9:128294568-128294590 GACATGGATGTCTCTTCCCCTGG - Intergenic
1186252009 X:7678366-7678388 GACATCTATGTGGCTTCACCCGG + Intergenic
1191922318 X:66270265-66270287 CACAGTGGAGTGGCTTCACCAGG - Intergenic