ID: 925191111

View in Genome Browser
Species Human (GRCh38)
Location 2:1884433-1884455
Sequence GGTCAGCAAGATCTGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925191111_925191114 4 Left 925191111 2:1884433-1884455 CCACTCAACAGATCTTGCTGACC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 925191114 2:1884460-1884482 TCCAACAAGTAACAGATAAAAGG 0: 1
1: 0
2: 3
3: 29
4: 262
925191111_925191118 21 Left 925191111 2:1884433-1884455 CCACTCAACAGATCTTGCTGACC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 925191118 2:1884477-1884499 AAAAGGGGTCACCAATTACAAGG 0: 1
1: 0
2: 0
3: 4
4: 106
925191111_925191116 5 Left 925191111 2:1884433-1884455 CCACTCAACAGATCTTGCTGACC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 925191116 2:1884461-1884483 CCAACAAGTAACAGATAAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 319
925191111_925191117 6 Left 925191111 2:1884433-1884455 CCACTCAACAGATCTTGCTGACC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 925191117 2:1884462-1884484 CAACAAGTAACAGATAAAAGGGG 0: 1
1: 0
2: 3
3: 37
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925191111 Original CRISPR GGTCAGCAAGATCTGTTGAG TGG (reversed) Intronic
908788272 1:67756364-67756386 AGTCAGCAAGGCCAGTTGAGGGG + Intronic
909078877 1:71085521-71085543 GGTCAGCAGGACCTGTTGGGTGG + Intergenic
912702744 1:111890306-111890328 AGCCAGCAAGATGTCTTGAGAGG + Intronic
914394971 1:147257167-147257189 GGTAAGAAAGATATGTTGACAGG + Intronic
920861027 1:209706865-209706887 GGTCACCAAGAGCTTTTGGGAGG + Intronic
1062795594 10:342591-342613 GGCCAGCAAGACCTGCTGGGTGG + Intronic
1067423006 10:46174276-46174298 GGGCAGCAACATCTTTGGAGTGG + Intergenic
1069266012 10:66458589-66458611 GGTCACCAGGATCTGGGGAGGGG - Intronic
1069860057 10:71465168-71465190 GGGCAGCCACATGTGTTGAGTGG + Intronic
1071151875 10:82645441-82645463 GGACACCAGGAACTGTTGAGAGG - Intronic
1074200771 10:111233283-111233305 GGTCAGCATGATCTTTCTAGAGG + Intergenic
1083142067 11:60730122-60730144 GGCCAGCTAGATTTGCTGAGTGG + Intronic
1089643711 11:119864364-119864386 GGTCAGTAAGAGCTGGTGGGTGG - Intergenic
1090755870 11:129791189-129791211 TGACAGCAGGATCTGGTGAGAGG - Intergenic
1091209291 11:133842894-133842916 GGTCATCAAGAGCTGATGATAGG - Intronic
1091900669 12:4141540-4141562 GGACAGCAAGAACTCTTGCGTGG - Intergenic
1095093614 12:38130928-38130950 TCTGAGCAAGATCTGTGGAGAGG + Intergenic
1095296036 12:40528671-40528693 TGTCAACAAGCTCTGTTCAGAGG - Intronic
1096452957 12:51760060-51760082 GGGCAGCAAGGTCTGATAAGAGG - Intronic
1097399365 12:59110195-59110217 GGTCAGAAAGGACTGTTGAGTGG + Intergenic
1103865555 12:124049266-124049288 GGACAGCAGGGTGTGTTGAGGGG - Intronic
1104408864 12:128541715-128541737 AGTCAGCAAGTGCAGTTGAGGGG - Intronic
1106599712 13:31177124-31177146 AGTCAGCATCATATGTTGAGAGG - Intergenic
1107151651 13:37118446-37118468 AGTCAGCTATATCTGTTTAGGGG + Intergenic
1111624606 13:90768687-90768709 GGACAGCGAGATCTGTGGAGTGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1117245466 14:53880427-53880449 TCTCAGCAAAATCTGTTGAAGGG - Intergenic
1117962228 14:61174804-61174826 AGTCAGCACCATCTGATGAGGGG + Intergenic
1118438967 14:65795842-65795864 GGGCAGCTAGAGCTGGTGAGAGG + Intergenic
1121210150 14:92202431-92202453 AGGCAGCAAGACCTGTTGGGAGG + Intergenic
1121728599 14:96170964-96170986 AGCCAGCATGATCTGTTGAAAGG + Intergenic
1122747888 14:103910447-103910469 GGCCAGGAGGATCTGTTGAAAGG - Intergenic
1130827852 15:87567715-87567737 CATCAGCAAGAACTGTTGAGTGG + Intergenic
1134537044 16:15034568-15034590 GGTCAGCAAGACCTGGGAAGAGG - Intronic
1135665007 16:24328357-24328379 GGTGAGAAAGATCTGGAGAGGGG + Intronic
1136170467 16:28486379-28486401 GGACAGCAGGGTCTGCTGAGGGG + Exonic
1139802607 16:69535759-69535781 GGTCTGCTAGAGCTGTGGAGTGG - Intergenic
1143184781 17:5003611-5003633 GGTCAGTAAGATCAGTTTGGTGG + Exonic
1144039090 17:11392592-11392614 GGGCAGCTATATCTGCTGAGGGG - Intronic
1144164712 17:12598834-12598856 TGTAAGCAAAATCTGTTGAAAGG - Intergenic
1146741296 17:35286002-35286024 GGGCAGGCAGCTCTGTTGAGGGG - Intergenic
1153520611 18:5949914-5949936 GGTTAGCAATATGTGCTGAGAGG + Intergenic
1156204973 18:34875446-34875468 GGTCACCAAGGTCTATTGAGTGG + Intronic
1160249157 18:77186002-77186024 GGTCAGAAAGGTCTGTGCAGGGG + Intergenic
1160532243 18:79572224-79572246 GGTCACCAAGATTTGATGACAGG + Intergenic
1161747331 19:6068990-6069012 AGTCAGCCAGATCTGCTGACGGG + Intronic
1165755872 19:38292713-38292735 GGACATCAAGATCAGTTCAGAGG - Intronic
925191111 2:1884433-1884455 GGTCAGCAAGATCTGTTGAGTGG - Intronic
928483490 2:31706953-31706975 GGGCAGGAAGACCTGGTGAGAGG - Intergenic
930026390 2:47031736-47031758 AGTCAGCAAGAGATGCTGAGGGG - Intronic
933177799 2:79195499-79195521 GGTCAGGATGATCTGGTGGGAGG - Intronic
935470919 2:103459687-103459709 GGTAAGAAAAATCTTTTGAGGGG - Intergenic
943685680 2:190815497-190815519 AGTCAGCCAGATCTCATGAGTGG - Intergenic
944142194 2:196468743-196468765 GGTCAGCAAGATCTGTAAGAAGG + Intronic
944986710 2:205185503-205185525 GGTAGTCAAGATCTGTGGAGTGG + Intronic
946580166 2:221119600-221119622 GAACAGCAAAATCTGTTGTGTGG - Intergenic
948735471 2:240001569-240001591 GGTCAGAAGGATCCCTTGAGAGG - Intronic
1174149962 20:48478850-48478872 TGGCACCAAGATCTGATGAGGGG + Intergenic
1178093817 21:29192953-29192975 GGAAAGTAAGATCTGTTTAGGGG - Intergenic
1180611675 22:17102223-17102245 GGTCAGCAGGATCTGGTAATGGG - Exonic
1182517579 22:30867808-30867830 TGTAAGCAAGAGCTGGTGAGAGG - Intronic
1182848007 22:33447368-33447390 GGTCAGCAACATCTTCTGAGGGG + Intronic
1184747504 22:46464802-46464824 GGACAGGAAGAACTGTTGGGAGG - Intronic
1184839344 22:47043441-47043463 GGTCAGGAAAAGCTGTTGTGGGG + Intronic
954041787 3:47893480-47893502 GGGCAGTAAGCTCTGGTGAGTGG - Intronic
954360848 3:50122037-50122059 GGTCAGAAAGAATTGCTGAGAGG - Intergenic
954840884 3:53510348-53510370 GGTCTGTAAGGTCTATTGAGTGG - Intronic
955223190 3:57039952-57039974 GGTCAGAAACATCTTTTGGGAGG + Intronic
961043058 3:123690873-123690895 GGTCATCAAGATTAGTGGAGAGG + Intronic
962404803 3:135091818-135091840 GGTCAGCCAGGTCTGCTGAGTGG - Intronic
963296716 3:143554699-143554721 GGTCAGCAAGTTGTGGGGAGTGG - Intronic
967336261 3:188348048-188348070 GGTCAGCAGGATTAGTTGTGTGG + Intronic
968575164 4:1362630-1362652 GGTCTGCAAGCCCTGCTGAGGGG - Intronic
968597639 4:1493541-1493563 GGCCAGGAAGAGCTGTGGAGGGG - Intergenic
971172036 4:24243181-24243203 GGTCATGATGATATGTTGAGTGG - Intergenic
976089537 4:81441890-81441912 GGTCAGCTAAATTTGTTGAAAGG + Intronic
978017704 4:103767508-103767530 GGTCAACAAGAGCTGAAGAGTGG - Intergenic
978802418 4:112768057-112768079 GATATGCAAGATTTGTTGAGTGG + Intergenic
988348509 5:30070360-30070382 GGTCACCACGCTCTGATGAGTGG - Intergenic
988659326 5:33247383-33247405 GGTCAGTAATTTCTGTTGACTGG - Intergenic
992241930 5:74780394-74780416 AGGCAGGAAGATCTGTTGATTGG + Exonic
998013855 5:138716773-138716795 GGTCAGCAAGAGCCCCTGAGAGG + Intronic
998270026 5:140698042-140698064 GGTCATCAAGATCCGTTCAGTGG + Exonic
1005423063 6:25672775-25672797 AATCAGGAAGATCTGCTGAGAGG + Intronic
1007194511 6:40049078-40049100 GGTCAACAAGACCTCTGGAGAGG - Intergenic
1011219805 6:85042302-85042324 AGTCAGCAGGATTTGTTGATGGG - Intergenic
1011501854 6:87999534-87999556 GGTCAACAAGATCCTTTCAGGGG - Intergenic
1013228887 6:108143391-108143413 GGCCAGAAAGATCAGTTTAGGGG - Intronic
1016964444 6:149705882-149705904 GCTCAGGAATATCTTTTGAGAGG - Intronic
1022233126 7:28434010-28434032 GGTCAGTAGCATCAGTTGAGAGG + Intronic
1026449476 7:70514781-70514803 GTTCAGCAAGATATGGTGAAAGG - Intronic
1029517743 7:101037251-101037273 TGTCAGCAAGAGTTGTTGAAAGG - Exonic
1036029393 8:4950800-4950822 GGTCACCAAGAGTGGTTGAGTGG - Intronic
1036201798 8:6776368-6776390 GGGCAGGAAGATCTGTGGATTGG - Intergenic
1039063144 8:33588167-33588189 GGCCAGCAAGATCTATTTACTGG - Intergenic
1045172922 8:99690210-99690232 TGTCAGCAACATTTGTTGAAAGG - Intronic
1048923035 8:139247750-139247772 GGTCAGGAAAGTCTGTGGAGGGG + Intergenic
1049431417 8:142567033-142567055 GGCCAGCAGGATCTGTGGGGTGG + Intergenic
1049623007 8:143606989-143607011 GGACACCAAGATGTGTTCAGTGG + Exonic
1050554336 9:6776254-6776276 GGAAAGAAAGATGTGTTGAGCGG - Intronic
1057388417 9:94623979-94624001 GGTCAGGAAGATCTCTAGGGGGG + Intronic
1061096104 9:128457349-128457371 GGTCAGCAGGCTCTGCTCAGGGG - Exonic
1203783617 EBV:115102-115124 CCTCAGCAAGATCTGTTGCTGGG + Intergenic
1190024324 X:46909611-46909633 GGTCTGCAAAATCTCTTAAGAGG + Intergenic
1191971558 X:66822643-66822665 GGTCAGAAAAGTCTTTTGAGTGG - Intergenic
1200182488 X:154159261-154159283 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200188142 X:154196375-154196397 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200193792 X:154233515-154233537 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200199547 X:154271319-154271341 GGCAAGCAAGAGCTGTGGAGGGG + Exonic
1201767589 Y:17586979-17587001 TCTGAGCAAGATCTGTGGAGAGG - Intergenic
1201833964 Y:18319006-18319028 TCTGAGCAAGATCTGTGGAGAGG + Intergenic