ID: 925194462

View in Genome Browser
Species Human (GRCh38)
Location 2:1912034-1912056
Sequence GCGGGCATGTCAACAGCAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925194462_925194475 25 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194475 2:1912082-1912104 CTTGAGGACACTTTCATGCATGG 0: 1
1: 0
2: 3
3: 10
4: 184
925194462_925194466 -2 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194466 2:1912055-1912077 GCGCCCCGTGCAGCCCGGAGTGG 0: 1
1: 1
2: 0
3: 10
4: 133
925194462_925194463 -7 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194463 2:1912050-1912072 TGCCCGCGCCCCGTGCAGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 176
925194462_925194472 9 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194472 2:1912066-1912088 AGCCCGGAGTGGGGCACTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 152
925194462_925194468 0 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194468 2:1912057-1912079 GCCCCGTGCAGCCCGGAGTGGGG 0: 1
1: 0
2: 3
3: 14
4: 147
925194462_925194476 30 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194476 2:1912087-1912109 GGACACTTTCATGCATGGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 119
925194462_925194467 -1 Left 925194462 2:1912034-1912056 CCTGTTGCTGTTGACATGCCCGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 925194467 2:1912056-1912078 CGCCCCGTGCAGCCCGGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925194462 Original CRISPR GCGGGCATGTCAACAGCAAC AGG (reversed) Exonic
904133262 1:28290982-28291004 GAGGCCATGTCCACAGCAGCAGG - Intergenic
904624426 1:31794050-31794072 GCGTGCAGTTCAGCAGCAACAGG - Intronic
905627592 1:39498838-39498860 GGAGGCAGGTCCACAGCAACGGG + Intronic
905668832 1:39778270-39778292 GGAGGCAGGTCCACAGCAACGGG - Intronic
915444393 1:155966632-155966654 GGGGACATGTCTGCAGCAACAGG + Intronic
915808556 1:158880817-158880839 GCCGGCATGTCCACAGCCATGGG + Intergenic
915820339 1:159016620-159016642 GCCGGCATGTCCACAGCCATGGG + Exonic
917982529 1:180279800-180279822 GCTGGAATGGAAACAGCAACAGG + Intronic
918008429 1:180563717-180563739 GGGGGCATGTCACCAGTAAAGGG - Intergenic
1076011610 10:126993710-126993732 CTGGGCCTGTCAACAGCATCAGG - Intronic
1076661595 10:132059234-132059256 GCGGACATGGCACCAGCAGCAGG - Intergenic
1081914663 11:46723213-46723235 GAGGGCATGTGAACATCACCCGG + Exonic
1082814566 11:57499602-57499624 GCGTGCGTGGCAACAGCAGCTGG + Intronic
1092698684 12:11202426-11202448 GTGGGAATGTAAACAGCAAATGG + Intergenic
1098007614 12:66015217-66015239 GCCAGCATGTCAAGAGTAACAGG + Intergenic
1102802248 12:115746176-115746198 GCCTGAATGACAACAGCAACAGG + Intergenic
1104336450 12:127900190-127900212 GCGGGCATGTCGTGAGTAACAGG + Intergenic
1113511010 13:110854931-110854953 GTGGGCATCTCAGCAGCACCTGG - Intergenic
1116056814 14:39874149-39874171 GGGGGCATAACAACACCAACTGG + Intergenic
1122269816 14:100563826-100563848 GCCACCATGACAACAGCAACTGG + Intronic
1122444433 14:101759071-101759093 GGAGGCATCTCCACAGCAACGGG - Intergenic
1142826527 17:2515490-2515512 GCCAGCCTGTCAACAGCCACAGG + Intergenic
1151686942 17:75653015-75653037 GTGTGCCTGTCACCAGCAACCGG - Intronic
1155104181 18:22644624-22644646 GAGCTCATCTCAACAGCAACAGG - Intergenic
1164130197 19:22354882-22354904 GCAGGAATGGCAGCAGCAACTGG - Intergenic
1164702094 19:30292872-30292894 GCAGGCATGTCAACACGCACAGG + Intronic
1168302074 19:55410846-55410868 GAGATGATGTCAACAGCAACTGG + Intergenic
925194462 2:1912034-1912056 GCGGGCATGTCAACAGCAACAGG - Exonic
925327291 2:3033269-3033291 GCGGCCATGGCAGCAGCACCCGG + Intergenic
926824818 2:16894375-16894397 GCAGACTTCTCAACAGCAACAGG + Intergenic
931503219 2:62894512-62894534 AAGGGCATTTCAACAGGAACAGG + Intronic
932305360 2:70698105-70698127 GAGGGCATGTCAAAAGCACAGGG + Intronic
936146625 2:109984762-109984784 CCGGGCTTGTCAACACCAGCAGG - Intergenic
948151630 2:235749264-235749286 GCTGGAATGTGAACAGCCACAGG - Intronic
1172794684 20:37528424-37528446 GTGGGCATTTCAACAGAAGCCGG - Intergenic
1174482757 20:50842801-50842823 GGGGGCAAGTCACCAGAAACAGG - Intronic
1178494463 21:33075336-33075358 CCTGGCCTGTCAACAGCAGCAGG - Intergenic
1182237753 22:28889851-28889873 TCAGGCATTTCAACAGCGACAGG - Intronic
949273319 3:2246976-2246998 GCGTGGATGTGAACAGCAACTGG + Intronic
951162437 3:19441092-19441114 GCGGGCACCTCAGCAGCAGCAGG + Intronic
955257295 3:57345591-57345613 AAGCTCATGTCAACAGCAACAGG + Intronic
955570661 3:60301582-60301604 GGGGGTATGTCAAAAGGAACTGG - Intronic
959727768 3:109563294-109563316 GCTGTCATGACAACAGCAACAGG - Intergenic
964410578 3:156393409-156393431 GGTGGCATTTCAGCAGCAACTGG - Intronic
965560742 3:170060107-170060129 GCGGGCATGTGCTCAGCAACTGG + Intronic
967454269 3:189664206-189664228 TTGGACATGTGAACAGCAACAGG + Intronic
967961689 3:194930566-194930588 GCCTGCATTTCAACAGCCACTGG + Intergenic
968445740 4:651259-651281 GCGGCGATGTCAACAGCAGTGGG + Intronic
975128767 4:70811536-70811558 GCAGACATGCCAGCAGCAACGGG + Intergenic
980913790 4:139016084-139016106 GCGGGCCTGGGAACAGCAGCCGG - Exonic
988489910 5:31697548-31697570 GAGGACATGTCAACAGTAAGTGG - Intronic
993446341 5:88016500-88016522 GTAGACATATCAACAGCAACAGG - Intergenic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
1005850544 6:29817515-29817537 TCAGGAATGTCAACAGCACCCGG - Intergenic
1005857391 6:29872927-29872949 TCAGGAATGTCAACAGCACCCGG - Intergenic
1010059585 6:71607094-71607116 GTGGGCATGTGAGCAGGAACTGG - Intergenic
1017819290 6:158038135-158038157 GAGGCAATGTCAACAGCATCGGG - Intronic
1019657571 7:2204308-2204330 GCTGGCCTGTCAACAGCAGACGG - Intronic
1022112320 7:27239397-27239419 GCGGGCCTTTCAACGGCGACAGG - Intergenic
1024983954 7:55180069-55180091 CCGGGCAGGTCAGGAGCAACAGG - Intronic
1026814260 7:73497317-73497339 GAGGTCACTTCAACAGCAACAGG + Intronic
1027264433 7:76486305-76486327 AAGTGCATGTCAACAGCATCAGG + Intronic
1027315803 7:76984419-76984441 AAGTGCATGTCAACAGCATCAGG + Intergenic
1032264841 7:130363471-130363493 GCGTGGATCTCAACAGGAACTGG + Exonic
1033763860 7:144466003-144466025 GCGGGAATTTCACCAGCAAGAGG - Intronic
1034699596 7:153084439-153084461 TCGGGCATGTCAGCAGCAGCGGG + Intergenic
1038183173 8:25247897-25247919 GCGGGCAGGACTACAGCATCCGG - Intronic
1039672127 8:39613056-39613078 GCATGCATGGCAGCAGCAACAGG - Intronic
1043454574 8:80400754-80400776 GCAGGGATGCAAACAGCAACTGG - Intergenic
1044014507 8:87034423-87034445 GAGCTCATCTCAACAGCAACAGG + Intronic
1056870865 9:90276886-90276908 AAGGGCACTTCAACAGCAACTGG + Intergenic
1057787772 9:98100180-98100202 GCAGACATGTCATCTGCAACTGG - Intronic
1061727688 9:132590373-132590395 CCGCGCATGTCCACAGCACCGGG - Intergenic
1189651401 X:43193514-43193536 GTGGGCATGTCAGTGGCAACAGG + Intergenic
1190406568 X:50093864-50093886 GGAGGCATGGCAGCAGCAACTGG - Exonic
1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG + Intergenic
1192176008 X:68885975-68885997 GGGAGCATGGCCACAGCAACTGG - Intergenic
1201324811 Y:12744779-12744801 CAGGGCATGTCAACAGCCTCAGG - Intronic