ID: 925195091

View in Genome Browser
Species Human (GRCh38)
Location 2:1916467-1916489
Sequence CAGCTAGAATTGATGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925195091_925195096 16 Left 925195091 2:1916467-1916489 CCCTGAACCATCAATTCTAGCTG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 925195096 2:1916506-1916528 GGCATACTTTATGTGCTGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 143
925195091_925195095 -5 Left 925195091 2:1916467-1916489 CCCTGAACCATCAATTCTAGCTG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 925195095 2:1916485-1916507 AGCTGCGGTATTTAATTTATTGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925195091 Original CRISPR CAGCTAGAATTGATGGTTCA GGG (reversed) Intronic
905502413 1:38450245-38450267 CAGCTGCCCTTGATGGTTCAGGG - Intergenic
907803395 1:57794061-57794083 CAGTTAGGATTTATGGTTCAAGG - Intronic
908426687 1:64014387-64014409 AAGCTACTATTGATGGGTCAAGG + Intronic
912089613 1:106055062-106055084 AAGGTAGAATTGCTGGGTCATGG - Intergenic
913510868 1:119560697-119560719 CAGCTAGAAGTGATAGTGCTAGG - Intergenic
914144294 1:144980205-144980227 CAGGTAGAAATGATGCCTCATGG - Intronic
917460809 1:175227523-175227545 CAGCCAGGATAGATGGCTCAAGG + Intergenic
917702692 1:177597189-177597211 GAACCAGTATTGATGGTTCATGG + Intergenic
919085302 1:192913865-192913887 CAGCTAGAATCAACAGTTCAAGG - Intergenic
919976224 1:202614813-202614835 CAGCTGGAGTGGATGGATCACGG + Intronic
920480584 1:206318244-206318266 CAGGTAGAAATGATGCCTCATGG + Intronic
921986510 1:221318358-221318380 TAGCTAGAATTCATGGGTCTAGG + Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
923516713 1:234703809-234703831 CAGCTGGACTTGAGGGATCAGGG + Intergenic
1067114509 10:43424418-43424440 CAGCCAGACTTGATTGTACAAGG + Intergenic
1068917908 10:62452562-62452584 CAGATAGAATTGTTGCTCCAGGG - Intronic
1069672673 10:70222555-70222577 CTGGTAGCATTGGTGGTTCAGGG + Intronic
1070808271 10:79283685-79283707 CATCTGGAACTGATGGTGCAGGG - Intronic
1071979922 10:90994419-90994441 CAGCAAAAATTGGTGTTTCATGG - Intergenic
1075723754 10:124601458-124601480 CAGCCAGGATTGGGGGTTCAAGG + Intronic
1079583758 11:22098937-22098959 CAGCCAGAATTGAGAGTTTAGGG - Intergenic
1079643784 11:22837976-22837998 CAGCTAGAAAAAATGTTTCAAGG + Intergenic
1080074477 11:28133218-28133240 GGGCTAGAAATGGTGGTTCAAGG + Intronic
1080312986 11:30915601-30915623 CAGCTAGTCTTGGGGGTTCAAGG - Intronic
1082754271 11:57057547-57057569 CTGCTAGACTTGATGTTACAAGG - Intergenic
1086859627 11:91909607-91909629 CAGGAAGAATTGATAGTACAGGG - Intergenic
1089059420 11:115614236-115614258 CAGATGGAATTGATGTATCAAGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089834714 11:121359873-121359895 CCTCTAGAAATGTTGGTTCAAGG + Intergenic
1090526283 11:127541187-127541209 CAGATGAAATTGGTGGTTCAAGG + Intergenic
1091073729 11:132593820-132593842 CTCCTAGAATTGATTTTTCATGG - Intronic
1092385285 12:8032386-8032408 CAGCTGGAATTGACGGTATACGG + Intergenic
1092531237 12:9347329-9347351 GAGCTAGATTTGTTGGGTCAGGG + Intergenic
1092533847 12:9367762-9367784 GAGCTAGATTTGTTGGGTCAGGG + Intergenic
1093267369 12:17019405-17019427 CATCTATCATTTATGGTTCATGG - Intergenic
1094426762 12:30324191-30324213 CATATACAATTGATGGTTCTGGG - Intergenic
1096223000 12:49843829-49843851 CAGTTAGAAATGATGGTACTAGG + Intergenic
1096966788 12:55634712-55634734 AAGCTAGAATAAATGGTTTAAGG + Intergenic
1098001243 12:65945663-65945685 CTGCTGGCCTTGATGGTTCATGG + Intronic
1098483742 12:70996787-70996809 AACCTAGAATTGATACTTCACGG - Intergenic
1099132707 12:78856509-78856531 GAGCTAGAATTGAAAGTTGATGG + Intergenic
1101622963 12:106407922-106407944 AAGTCAGAATAGATGGTTCAGGG + Intronic
1103356430 12:120324896-120324918 CAACTAGAATTCATAGGTCAAGG + Intronic
1114363243 14:21999169-21999191 CAGCTAATATTAATGGGTCAAGG - Intergenic
1120653556 14:87162577-87162599 ATGCTAGAATGGATGGTTGAGGG - Intergenic
1125252359 15:37720065-37720087 CAGCTAGACTGGATTTTTCAAGG + Intergenic
1125764028 15:42121034-42121056 TAGGTAGAATGGATGGTCCAGGG - Intergenic
1134158974 16:11868976-11868998 CAGCTAGCATTATTGTTTCAAGG + Exonic
1137964237 16:52915008-52915030 CACCTAGAATTGAGGTTTGAGGG - Intergenic
1147983857 17:44292875-44292897 TAGCTAGAATACATGGTTCCAGG - Intergenic
1149628378 17:58097149-58097171 TAGCTAGGATTCATGGTTCCAGG - Intergenic
1151421521 17:74001155-74001177 CAGACAGAAGTGATGGTGCAGGG - Intergenic
1155834917 18:30569049-30569071 CAGGAAGAATTCATGGGTCATGG + Intergenic
1156456045 18:37294974-37294996 TAGATAGAATTGATGGGTCTCGG + Intronic
1157011194 18:43651124-43651146 CATTTAGAATTGATGTTTCCTGG - Intergenic
1157096643 18:44691573-44691595 CAGCTGGAACTGTTGGTTAATGG + Intronic
1159180461 18:64895286-64895308 TAGATAGAAATGATGTTTCAGGG - Intergenic
1162171282 19:8791102-8791124 CAGCTAGACTTGGTGCTTCCTGG - Intergenic
925195091 2:1916467-1916489 CAGCTAGAATTGATGGTTCAGGG - Intronic
925437550 2:3853517-3853539 CAGCTAGAGGTGAGGGTTTAGGG + Intergenic
928238276 2:29564235-29564257 AAGTTAGAATTGTTTGTTCATGG - Intronic
930609463 2:53524956-53524978 TAGCTCCAATTAATGGTTCATGG - Intergenic
931909496 2:66882201-66882223 AAGCTAGAGTTGAGGGTACAAGG - Intergenic
932936713 2:76112030-76112052 CAGCTATAATTAATGACTCAAGG + Intergenic
933133993 2:78708467-78708489 AAGCTAGAATTGAGGGAGCAGGG - Intergenic
935464738 2:103382868-103382890 AAGATAGAATTGGTAGTTCATGG + Intergenic
935978632 2:108604871-108604893 CAGGAAGGATTGATGGGTCAGGG + Intronic
936100299 2:109571781-109571803 CAGGTTGAACTGCTGGTTCAAGG + Intronic
936858503 2:116988247-116988269 CAGCTAGAATGAATGTTTAAAGG - Intergenic
942624481 2:177884837-177884859 GGGCTAGAAATGATGTTTCAAGG + Intronic
948450655 2:238068866-238068888 GAACTAGAATTGCTGGGTCACGG + Intronic
1169292899 20:4367919-4367941 CAGCTTGAAATTATGTTTCAGGG - Intergenic
1169902588 20:10568738-10568760 CAGTTGGAATTCATGTTTCAGGG - Intronic
1171136474 20:22699376-22699398 CAGCTTCACTTGATGGTTAATGG + Intergenic
1177968395 21:27758615-27758637 AAGCTAAAATTGCTGGTTCAAGG + Intergenic
1177991707 21:28042797-28042819 CAGCCAGCATTCATGGTTCTAGG - Intergenic
1179122274 21:38559117-38559139 CAGCTAGGATTCATGGAGCAAGG - Intronic
1180172761 21:46068261-46068283 CAGGAAGAATTGATGGGTCCAGG - Intergenic
1180987532 22:19913725-19913747 CAGCTGGAGGTGAGGGTTCAGGG - Intronic
1182395852 22:30035430-30035452 CAGCCAGAATAGATGGTCTAGGG + Intergenic
1183271693 22:36866284-36866306 AAGCCAGAATTGATGGGTCATGG - Intronic
949417389 3:3829466-3829488 TAGCTAGAATTCATGGGTCCAGG - Intronic
951615985 3:24544736-24544758 TATCTATAAATGATGGTTCAGGG + Intergenic
953028137 3:39156844-39156866 TACCTAAAATTGGTGGTTCATGG - Intergenic
953739697 3:45527086-45527108 CTGATAGAATTGCAGGTTCATGG - Intronic
954455431 3:50595978-50596000 CATCTAGAATTTATGGTGGAAGG + Intergenic
966250066 3:177855858-177855880 CAGCTGGAATTTGTGGATCAGGG + Intergenic
967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG + Intronic
970557197 4:17246141-17246163 CACTTAGACTTGCTGGTTCAAGG + Intergenic
972978069 4:44661906-44661928 CAGATAGAGTTCTTGGTTCAAGG + Intronic
974293443 4:59963900-59963922 CTGGTAAAATTGGTGGTTCAGGG + Intergenic
977096305 4:92749147-92749169 CAGCTAGGCCTGATGGTGCATGG - Intronic
978553860 4:109957771-109957793 CAGCTAGAGCTGATGTATCATGG - Intronic
981245127 4:142526478-142526500 CAGCTGGAATTGATGCATTATGG - Intronic
986431404 5:7684642-7684664 CAGCTGGATTTGCAGGTTCAAGG - Intronic
987472730 5:18352474-18352496 TAGCTAGAATTCATGGGTCAAGG + Intergenic
987720198 5:21623596-21623618 CAGCAAGAATTGATTGGCCATGG - Intergenic
991728512 5:69560476-69560498 CTTTTAGAAATGATGGTTCAGGG + Intronic
991804943 5:70415623-70415645 CTTTTAGAAATGATGGTTCAGGG + Intergenic
991866441 5:71067399-71067421 CTTTTAGAAATGATGGTTCAGGG - Intronic
994170286 5:96652349-96652371 AATGTAGAATTGATGGGTCATGG + Intronic
994955576 5:106526957-106526979 AAGCTAGATTTGATGGTTCTAGG + Intergenic
995057669 5:107778304-107778326 CAGCTAGCATTGAGTTTTCATGG - Intergenic
995736412 5:115305007-115305029 CAGCTACACTTGAAGATTCACGG - Intergenic
998467704 5:142358721-142358743 CACCTAGAAATGATGGAGCAGGG + Intergenic
999665598 5:153909952-153909974 CTGGAAGAATTGATGGCTCATGG + Intergenic
1000422691 5:161056446-161056468 CAGCCAGAATTCATGGGTCCAGG - Intergenic
1002305108 5:178278597-178278619 GAGCTAGAATTGCAGGCTCACGG - Intronic
1003779901 6:9412964-9412986 CTGCTGGAATTCATGGTTCATGG + Intergenic
1006219836 6:32479390-32479412 CATCTAGAATCTATTGTTCAAGG - Intergenic
1007732799 6:43959288-43959310 CAGCAAGAATTTATTGTTTAGGG - Intergenic
1009288621 6:61855564-61855586 CAGCTGAAATTGATGATTCTAGG + Intronic
1009592168 6:65686871-65686893 AAGCTAGAATTGATGGGGCTTGG + Intronic
1013748476 6:113373562-113373584 CTGCTAGAATGGAAGATTCATGG - Intergenic
1015929856 6:138348271-138348293 CAGCTACAATTTTTGGATCAGGG - Intergenic
1018785493 6:167104774-167104796 TGGCTAGAATTCATGGTTCCAGG - Intergenic
1019831803 7:3337766-3337788 CATATAGAATTGGTGGTTAATGG - Intronic
1021277164 7:18666193-18666215 CAGCTAGAAGAGAGTGTTCAGGG - Exonic
1021764101 7:23929507-23929529 GGGCTGGAATTGATGGTTGAGGG + Intergenic
1024083497 7:45874876-45874898 CAAGTGGAATTGCTGGTTCAAGG - Intergenic
1026016275 7:66673228-66673250 CAGATAAAATAGGTGGTTCAGGG + Intronic
1029461961 7:100699967-100699989 CAGCTATAAGGGATGGATCAAGG - Intergenic
1030824021 7:114132832-114132854 GAGATAGAATTGAGGATTCAGGG + Intronic
1039366958 8:36938629-36938651 CAACTAGAATGTATGCTTCATGG - Intergenic
1050748994 9:8914792-8914814 CATTTAGAATTGATGATTTAAGG + Intronic
1051499837 9:17764834-17764856 CAGTAAGATTTGATGCTTCAAGG + Intronic
1052119494 9:24693513-24693535 CACATAGAATTCCTGGTTCAGGG + Intergenic
1053458026 9:38246155-38246177 CAGCTAGCATTCATGGGTCCAGG - Intergenic
1056482426 9:87019100-87019122 CTGCTAGAATGGAAGCTTCAGGG + Intergenic
1057720177 9:97525995-97526017 TAGCTAGGATTCATGGGTCAGGG - Intronic
1059693883 9:116712600-116712622 CAGCTAGACTTAATGATTCAGGG - Intronic
1186825455 X:13335377-13335399 CAGGTATACTTGATGGTTCTTGG + Intergenic
1192197558 X:69038640-69038662 CAAATGGAATTGCTGGTTCATGG + Intergenic
1192996368 X:76517010-76517032 TAGCTAGAATTCATGGATCCAGG + Intergenic
1193062378 X:77220338-77220360 CAGTGAGGATGGATGGTTCAGGG - Intergenic
1194807757 X:98350667-98350689 CAGGTAGACTTGATTGTCCATGG - Intergenic
1196177913 X:112660589-112660611 CAGATGGCAGTGATGGTTCATGG - Intronic
1201479417 Y:14423249-14423271 CAGCTAGAATTTAAAGGTCAGGG - Intergenic