ID: 925198456

View in Genome Browser
Species Human (GRCh38)
Location 2:1947015-1947037
Sequence CTGATGAAGGAGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 727}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925198456_925198459 20 Left 925198456 2:1947015-1947037 CCAGCTTCCTTCTCCTTCATCAG 0: 1
1: 0
2: 3
3: 60
4: 727
Right 925198459 2:1947058-1947080 ACACAGTCTGTTCTGCACTGAGG 0: 1
1: 0
2: 3
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925198456 Original CRISPR CTGATGAAGGAGAAGGAAGC TGG (reversed) Intronic
900098875 1:952536-952558 CTGATGAAGGGGAGGGCACCAGG + Exonic
900281521 1:1872650-1872672 CTGAAGGATGAGAAGGAACCAGG - Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901533983 1:9870980-9871002 CTGAGGAAGGAGATGGGATCAGG + Intronic
902096409 1:13949694-13949716 CTTATGATGGAGAAGTAATCTGG + Intergenic
902407316 1:16191829-16191851 CCGCAGAAGGAGGAGGAAGCTGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
903227885 1:21904156-21904178 GTGCTGAAGGGGAAGGAAGGGGG + Intronic
903877451 1:26485172-26485194 CTGATGTGGGTGAAGAAAGCAGG - Intergenic
903942261 1:26939903-26939925 CTCATGACGGATAAGGAAACAGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904454788 1:30641068-30641090 TTGATAAAGGAGAAGCAACCTGG + Intergenic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905093883 1:35452208-35452230 CTGATGAAAGAAAAGGAAATGGG + Intronic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905159611 1:36020141-36020163 CTCAGGAAGGAGCAGGCAGCCGG + Intronic
905168319 1:36096505-36096527 CTTATTAAGGAAAAGGAAGTGGG + Exonic
905797457 1:40823671-40823693 GTGCTGGAGGGGAAGGAAGCTGG + Intronic
905860089 1:41344571-41344593 GTCAGGAAGGAGAAGTAAGCTGG - Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906181866 1:43827950-43827972 CTGATGAAGAAGAAGAAAGTTGG + Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906541511 1:46590123-46590145 CTGATGCCCGAGAAGGCAGCTGG - Intronic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
906837530 1:49100136-49100158 CTGAAGGAGGAGAAAGAAGTAGG + Intronic
907490789 1:54807583-54807605 CTGATGAAGGAGGTGGACACAGG + Exonic
907649639 1:56282774-56282796 ATGGTGAGGGAGAAGGAAGTTGG + Intergenic
907924433 1:58942548-58942570 TTGATGAAGGAAACTGAAGCTGG + Intergenic
908548293 1:65183809-65183831 CTGCTGAAGGAGTAGGATGTTGG - Intronic
908803225 1:67902260-67902282 CAGATGTAGGAGAATGAAACTGG - Intergenic
908825212 1:68126369-68126391 AGGAGGAAGGAGAAGCAAGCTGG + Intronic
908982702 1:69977992-69978014 CTTATGAAGGAGAAGCAAACGGG - Intronic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
909098894 1:71325151-71325173 CTTGAGTAGGAGAAGGAAGCTGG - Intergenic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910542607 1:88378029-88378051 CTAAGGAAGGAAAAGGAAGGAGG + Intergenic
911214028 1:95172555-95172577 GTGATGAGGAAGAAGGAAGGAGG - Intronic
911397373 1:97328030-97328052 CTGATGAAGGAGATATAAGTGGG + Intronic
911496857 1:98642575-98642597 CTGATGAAGGAAATTGAAGAGGG + Intergenic
912572286 1:110633395-110633417 CTGGTGAGGGAGCAGGAAGGGGG + Intergenic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
914320101 1:146551045-146551067 TTGATGGAGGAGAAGGAAACAGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914946370 1:152070393-152070415 CTACTGAAGGAGGAGGAGGCAGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915266198 1:154719774-154719796 GTGATGAAAGAGAGGGCAGCCGG - Intronic
915826704 1:159085677-159085699 ATCATGAAGGAGAAGGGGGCAGG + Intronic
916189794 1:162167611-162167633 CTGATGAAGGGAAAGGAAAGGGG - Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918350587 1:183651874-183651896 CTGATGAAGGCTAAGCAAGGAGG - Intronic
918368232 1:183832181-183832203 CTGAGGAATGAGAATGAAGTGGG + Intronic
918927635 1:190809036-190809058 GGGCTGAAGGAGGAGGAAGCTGG + Intergenic
920055898 1:203191474-203191496 ATGATAAAGGACAAGGAACCTGG - Intergenic
921116279 1:212094297-212094319 CTCATGTAGGAGAATGAAACTGG - Intronic
921190997 1:212708678-212708700 CTGATGAAGGAGAAGAAATCAGG + Intergenic
921336561 1:214092883-214092905 GAGCTGAAGGAGGAGGAAGCTGG + Intergenic
921800851 1:219400140-219400162 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
922212338 1:223495773-223495795 GTGATGGAGGAGAAAGAAGCAGG - Intergenic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
922672960 1:227527680-227527702 CTCATGTAGGAGAATGAAACTGG - Intergenic
922756743 1:228101193-228101215 CTGCTGTAAGAGGAGGAAGCGGG - Exonic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
923271690 1:232360530-232360552 TTGATGAAGGAGAGCAAAGCTGG - Intergenic
923750295 1:236740884-236740906 CTGGTGAAGGAGGAAGAAACAGG - Intronic
924140012 1:241012524-241012546 CTGATGAAGGGTCAGGAAGGGGG - Intronic
924440768 1:244083398-244083420 CTGTTGAAAGAGAAAGAAGTGGG - Intergenic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
1062813493 10:482543-482565 CTATTGAAGGAAAAGCAAGCTGG + Intronic
1062959738 10:1563410-1563432 CTGATGTGGGAGATGGATGCAGG - Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1064234603 10:13562606-13562628 CTGCTGAGGGAGAAGGGTGCTGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1066162206 10:32746192-32746214 GGGCTGAAGGAGTAGGAAGCTGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1068025540 10:51638713-51638735 ATCATGGAGGAGAAGGAAGCAGG + Intronic
1068114885 10:52725907-52725929 CTCATGTAGGAGAATGAAACTGG + Intergenic
1068134012 10:52932621-52932643 CTGATGAAGGAAGGAGAAGCTGG + Intergenic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1068729607 10:60341970-60341992 CTCATGAATGTGTAGGAAGCTGG - Intronic
1068835158 10:61545009-61545031 CTGATGAAGGAGAGGGTAAAAGG + Intergenic
1068936817 10:62643782-62643804 AGGGTGAAGTAGAAGGAAGCTGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1070132097 10:73663389-73663411 CTTATGCAGGAAAAGGAAGATGG - Intronic
1071403357 10:85301107-85301129 CTAATGTAGGAGAAGGAATTGGG - Intergenic
1071589444 10:86858757-86858779 CTGATGAAGGAAATTGAAGCGGG + Intronic
1071729580 10:88234253-88234275 CTTATAAATGAGAGGGAAGCAGG - Intergenic
1072368003 10:94733990-94734012 CCTATGAATGAGCAGGAAGCAGG - Intronic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1074058597 10:109944196-109944218 CTTATGAGGGAAAAGGAAGGGGG - Intronic
1074572695 10:114638783-114638805 CCGATGAAGGATAAGGTATCTGG - Intronic
1075155798 10:119974930-119974952 CTGATGAGGTAGAAGCAAGATGG + Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1076589491 10:131573594-131573616 CTGATGGAGAAGCAGGAGGCAGG + Intergenic
1077202030 11:1313567-1313589 CAGATGAAGAAGAATGAAACTGG - Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077681620 11:4247053-4247075 CTACAGAAGGAGAAGGATGCTGG - Intergenic
1077705425 11:4480707-4480729 AAGATGAAGGGGAAGCAAGCAGG - Intergenic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078694905 11:13620999-13621021 AGGATGAAGGGGTAGGAAGCTGG - Intergenic
1079401717 11:20111296-20111318 CTAAGGCAGGAGAAGGAACCTGG - Intronic
1081486123 11:43530751-43530773 TTTATGAAGGACAAGGAAACAGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1082816469 11:57513138-57513160 CTGATAAAAGTGATGGAAGCTGG + Intronic
1083914532 11:65732170-65732192 CTGATGAAAGAAATGGAAGGAGG + Intergenic
1084278635 11:68071231-68071253 CTGATGGAGGAGCTGGAAGTGGG - Intronic
1084405137 11:68967709-68967731 CTGATGAAGGAGGCAGAGGCTGG - Intergenic
1084535965 11:69757224-69757246 AGGATGAAGGAGAAGGAAAAGGG + Intergenic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085234803 11:75006148-75006170 CTGAGGCTGGAGGAGGAAGCTGG + Exonic
1085299541 11:75450178-75450200 CTGAGGCAGGAGGAGGCAGCAGG + Intronic
1085860809 11:80233046-80233068 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1086048286 11:82559090-82559112 CTGAAGATGGAAAAGTAAGCAGG + Intergenic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1086511987 11:87568689-87568711 CAGATGTAGAAGAATGAAGCTGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087868978 11:103267227-103267249 CGGTTGAAGGAGGAGAAAGCTGG - Intronic
1088180019 11:107098662-107098684 CACATGAAGGAGAATGAAACTGG + Intergenic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1089318984 11:117612418-117612440 GGGAGGCAGGAGAAGGAAGCAGG - Intronic
1089645932 11:119878967-119878989 CTGTTGAAAGAGTAGGCAGCAGG + Intergenic
1089772788 11:120815431-120815453 CTGATGATGGAGCTGGAGGCTGG - Exonic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1089937694 11:122382436-122382458 CTGATGAAAGAAATGGAAGAGGG + Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090947359 11:131443086-131443108 CTGAAGACGGAGATGGAAACAGG - Intronic
1090962878 11:131572837-131572859 CTGATGAAGGAGAATGTTCCCGG + Intronic
1091036481 11:132238306-132238328 GGGAGGCAGGAGAAGGAAGCAGG + Intronic
1091112192 11:132979841-132979863 CTGATGGAGAAGAAGGCAGGGGG + Intronic
1091282566 11:134390350-134390372 CTGATGAAGGATGGGGAGGCTGG + Exonic
1091485318 12:881056-881078 ATGATAAAGGAGAAAGAAACAGG + Intronic
1091557851 12:1589064-1589086 CTCATCAAGCAGAAGGGAGCTGG + Intronic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092838653 12:12516944-12516966 TTACTGAAGGAGAAGGAAGTGGG - Intronic
1093481914 12:19612689-19612711 GGGCTGAAGGGGAAGGAAGCTGG - Intronic
1093508404 12:19896785-19896807 AGGAAGAAGGAGAAGGAAGGAGG - Intergenic
1093613948 12:21197695-21197717 TGGATTAAGGAGAAGGAAGTCGG + Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1095111970 12:38305574-38305596 CTGATGAAGGAGTAGGTTCCTGG - Intergenic
1095490748 12:42731466-42731488 TGGATGAAGAATAAGGAAGCTGG - Intergenic
1095733112 12:45526836-45526858 CACATGTAGGAGAATGAAGCTGG + Intergenic
1095939130 12:47714563-47714585 CTGATGGAGGAGATGGGAGTAGG + Intronic
1096331964 12:50721292-50721314 CTTATGAAGCTGAAGGCAGCTGG - Exonic
1096650971 12:53061823-53061845 CTGCTGAAGGACAAGGACCCTGG + Exonic
1096904179 12:54917680-54917702 CTGATGAAGGAAATTGAAGAAGG + Intergenic
1097167566 12:57093852-57093874 AGGATGAAGGAGCAGGAAGGAGG + Intronic
1097295920 12:57962717-57962739 CACATGTAGGAGAATGAAGCTGG + Intergenic
1098229805 12:68361991-68362013 CTGATGGATGAGGAGGATGCTGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1099236610 12:80090308-80090330 CATATGAAGGAGAATGAAACTGG + Intergenic
1099343881 12:81473491-81473513 CTGATGAAGCTGTAGGAAGATGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100026667 12:90137416-90137438 CTCATGAAGAAGAATGAAACTGG - Intergenic
1100357206 12:93842701-93842723 CTGAGGGAGGAGGAGGTAGCTGG + Intronic
1100700240 12:97139656-97139678 AAGATGAAGGGGAAGAAAGCAGG - Intergenic
1101046323 12:100810103-100810125 ATGATGAAGCAGAATGCAGCAGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102402390 12:112640855-112640877 ATGCTGAAGGAGAAGGGAGCTGG - Intronic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103539260 12:121654525-121654547 CTGAGGAAGAAGGAAGAAGCTGG - Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1106607762 13:31247030-31247052 CTGATGAAGGAGGAGGACACTGG - Exonic
1108211025 13:48139873-48139895 CTGATGGGGGACAAGGTAGCTGG + Intergenic
1110409476 13:75188546-75188568 TTGATAAAGAAGAATGAAGCAGG + Intergenic
1110832847 13:80051564-80051586 ATGATGGAGGAAAGGGAAGCAGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1111997399 13:95178453-95178475 GCTAAGAAGGAGAAGGAAGCTGG + Intronic
1112044483 13:95582579-95582601 CTGGGGAAGGAGTGGGAAGCAGG - Intronic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112395272 13:99024272-99024294 TGGATGAAGAACAAGGAAGCAGG + Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1113023149 13:105911022-105911044 CTCATGAAGGAAGAGGCAGCAGG + Intergenic
1113681739 13:112249253-112249275 CTGCTGGTGGAGAAGGATGCTGG + Intergenic
1113701538 13:112392435-112392457 CTTATGAAGGAGGAGAAAGGGGG + Intronic
1113984934 13:114306497-114306519 CTGAGGCAGGAGAATGAACCTGG + Intergenic
1114326783 14:21597150-21597172 CAAATGCAGGAGAATGAAGCTGG + Intergenic
1114612331 14:24051272-24051294 GAGATGAGAGAGAAGGAAGCTGG + Intergenic
1114746849 14:25157533-25157555 CTGCTAAAGGGGAAGGAAGGAGG - Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115959079 14:38814507-38814529 CACATGTAGGAGAATGAAGCTGG + Intergenic
1116058307 14:39891247-39891269 CTGAGGAAGGAGAACAAAGGTGG + Intergenic
1116336563 14:43665300-43665322 TAGCTGAAGGGGAAGGAAGCTGG + Intergenic
1116976892 14:51126397-51126419 CACATGTAGGAGAAGGAAACTGG - Intergenic
1117812449 14:59562573-59562595 CTGATGGAGGGGTAGGAAGGTGG + Intronic
1117993635 14:61458718-61458740 AGGGTGAAGGAGAAGCAAGCAGG + Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118495379 14:66303603-66303625 CTCATGGAGGAGAGTGAAGCAGG - Intergenic
1119407042 14:74405472-74405494 ATGGTGAAGGAGCAGGCAGCAGG + Intergenic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119893618 14:78201533-78201555 GTGGTGAAGGAGCAAGAAGCTGG + Intergenic
1120246788 14:82016136-82016158 CTGATGAACGAAAAGGAGCCAGG - Intergenic
1120450246 14:84657478-84657500 CTCATGTAGGAGCAGAAAGCAGG - Intergenic
1120502642 14:85316010-85316032 CTGATGAAGTAAAAGGAGACAGG - Intergenic
1120560150 14:85981672-85981694 ATGCTTAAGCAGAAGGAAGCAGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121099976 14:91243770-91243792 CAACTGAAGGAAAAGGAAGCTGG - Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121928388 14:97949387-97949409 CTCATGGACCAGAAGGAAGCAGG + Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122498454 14:102176825-102176847 CTGAGGCAGGAGAATGAACCCGG - Intronic
1122899184 14:104775125-104775147 CTGGTGAAGGAGAAGGCCACAGG - Exonic
1125294702 15:38190222-38190244 GTGATGCAGGAGAAGGAAAGGGG - Intergenic
1125522569 15:40356300-40356322 CTGAGGAAGTAGAAGAAAACAGG + Exonic
1125723012 15:41854102-41854124 CTGATGAAGGGGGAGGACGGAGG - Exonic
1126526574 15:49662808-49662830 CTCATGGAATAGAAGGAAGCAGG - Intergenic
1127496219 15:59514881-59514903 GGGATGAAGGAGAAGGAAAATGG - Intronic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1127862187 15:63003660-63003682 CCGATGAGTGAGAAGGAAGCAGG + Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128099974 15:64990347-64990369 GTGATGAAGGAACAGGAAGATGG - Intergenic
1128142566 15:65312361-65312383 CTGATGAAGGAAATGAATGCGGG + Intergenic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129406398 15:75321828-75321850 AGGATGAAGGAGGAGGAAGAAGG - Intergenic
1129582806 15:76830880-76830902 GGGCTGAAGGGGAAGGAAGCTGG + Intronic
1130081541 15:80738258-80738280 CTTATGGTTGAGAAGGAAGCAGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1130881778 15:88061641-88061663 CAGATGAAGAAGCAGGAAGTGGG - Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131040164 15:89257204-89257226 GTGATGAAGGAAAAGAAATCTGG - Intronic
1131099539 15:89677383-89677405 CTGAGGGAGGAGGAAGAAGCAGG - Intronic
1131437540 15:92435404-92435426 GTGCTGCAGGAGCAGGAAGCAGG + Intronic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131955385 15:97729782-97729804 TAGATGAGGGAGGAGGAAGCAGG - Intergenic
1131994572 15:98121794-98121816 CTGTAGGAGGAAAAGGAAGCTGG - Intergenic
1132020984 15:98362285-98362307 CTGATGGATGAGAAGAAAGGGGG - Intergenic
1133255636 16:4514187-4514209 GGGCTGAAGGAGAAGGAACCTGG - Intronic
1134111015 16:11515700-11515722 CTGAGGAGGGAGGAGGAAGGAGG + Intronic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134502708 16:14781606-14781628 GAGATGAAGGAGAAGTCAGCTGG - Intronic
1134577855 16:15347289-15347311 GCGATGAAGGAGAAGTCAGCTGG + Intergenic
1134677176 16:16098881-16098903 GTGATGGACGAGGAGGAAGCAGG + Intronic
1134724733 16:16410257-16410279 GCGATGAAGGAGAAGTCAGCTGG - Intergenic
1134826117 16:17285678-17285700 CTGGTGAAGGAGACAGAGGCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134942698 16:18301602-18301624 GCGATGAAGGAGAAGTCAGCTGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135284693 16:21183201-21183223 GTGATGATGGAGAAGGAAAGGGG + Intergenic
1135405810 16:22196951-22196973 CTCCTGAAAGAGAAGGAAGGGGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137382108 16:48009133-48009155 CTGACAAAGAAAAAGGAAGCAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1138096050 16:54212943-54212965 ATAATGAAAGAGAAGGAAGGTGG - Intergenic
1138565335 16:57828674-57828696 ATGATGCTGGAGCAGGAAGCAGG + Intronic
1138976590 16:62214817-62214839 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
1139253049 16:65515207-65515229 CAGATGAAGGCGAAGGGAGATGG + Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139645532 16:68326888-68326910 CTGATGAGTCAGAAGGCAGCAGG + Intronic
1140013424 16:71159032-71159054 TTGATGGAGGAGAAGGAAACAGG - Intronic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141672231 16:85498110-85498132 CTGATGAAGGAGAGTGGAGCTGG + Intergenic
1141855428 16:86677900-86677922 CTGCTGAAGGAGGAGGAAACTGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142274804 16:89112793-89112815 CAGATGAAGCAGGAGCAAGCGGG - Intronic
1142932480 17:3298752-3298774 CTATTGAAGGGAAAGGAAGCGGG + Intergenic
1143100605 17:4502735-4502757 GGCATGAAGGAGAAGGCAGCTGG - Intronic
1143123355 17:4624074-4624096 CTGCTGTAGGAGGAGGAAGGGGG + Intergenic
1143331970 17:6144112-6144134 GGGATGATGGAGCAGGAAGCTGG + Intergenic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143426684 17:6845126-6845148 CTGCTGTAGGAGGAGGAAGGGGG - Intergenic
1143455782 17:7066792-7066814 CTGAAGCAGGAGAAAGAAACTGG + Intergenic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1144166250 17:12613768-12613790 TTGATGGAAGAGAAGGAAGTTGG - Intergenic
1144674481 17:17153136-17153158 CTGATGAAGGAGGACCGAGCTGG + Intronic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1146529556 17:33596684-33596706 AGGATGAAGGAAAAGGAAGGAGG - Intronic
1147138936 17:38450972-38450994 CTGATGCAGGGGGAGGAAGCTGG + Intronic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147302794 17:39543247-39543269 TTGATGAGGCAGAAGGAAGGTGG + Intronic
1147718900 17:42526195-42526217 CTGATGAACTGGGAGGAAGCAGG + Intergenic
1147845957 17:43403982-43404004 CTAATCAAGGAGAGGGAAGAGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150138535 17:62709584-62709606 TAGATGAAGGAGAGGGAAGGAGG + Intronic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150829026 17:68502018-68502040 TTGATGCAGGTGAATGAAGCTGG - Intergenic
1150943345 17:69717482-69717504 CTGCTGAAGGGGCTGGAAGCAGG - Intergenic
1151364753 17:73609988-73610010 CTGCTGAACAAGATGGAAGCAGG + Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152559808 17:81072291-81072313 GAGGTGAAGGAGCAGGAAGCCGG - Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153752310 18:8245302-8245324 CTGATGGAGGAGGATGAAGTGGG - Intronic
1153784875 18:8525849-8525871 CTGAGGCTGGAGAAGAAAGCAGG + Intergenic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1155226692 18:23735519-23735541 CTTATGAAGGAGAAGGGATCAGG - Intronic
1155415012 18:25588711-25588733 CTGATGGTGGAGAAGAAAGGAGG + Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155704893 18:28796959-28796981 TTATTGCAGGAGAAGGAAGCTGG + Intergenic
1156088243 18:33434835-33434857 TAGATGTAGGAGAAGGAAGAGGG + Intronic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156164163 18:34398019-34398041 CTCATGTAGGAGAATGAAACTGG - Intergenic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156496702 18:37530558-37530580 CTGATTTGGGAGATGGAAGCTGG - Intronic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1156969971 18:43142233-43142255 GTGATAAAGAAGAAGGAATCTGG - Intergenic
1157907509 18:51582757-51582779 CTGCTGTTGGAGAAGGAGGCTGG + Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158621686 18:59038123-59038145 CTTATTAAGGAGAAGAAAGAAGG + Intergenic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1158886375 18:61830703-61830725 GGGATGAAGGAGGAGGAAGAAGG + Intronic
1159352010 18:67287077-67287099 GGGATGAAGGGGAAGGAATCTGG - Intergenic
1159576838 18:70189338-70189360 GTGATGGAGGAGAAAGAAGCAGG - Intronic
1159751555 18:72308532-72308554 CTGATAAGGGAGAAGAATGCAGG + Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1160622981 18:80183577-80183599 CTGATGAAGCAGGATGAAGTGGG - Intronic
1160695284 19:481014-481036 ATGATGATGGAGAAGGAATGTGG + Intergenic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162738730 19:12761624-12761646 CTGAGGCAGGAGAATGAACCCGG - Intergenic
1162782439 19:13013275-13013297 CTGTTGGTGGAGGAGGAAGCTGG + Intronic
1163420384 19:17210763-17210785 CTGCTGGAGGAGGAGGCAGCCGG + Exonic
1164131622 19:22368326-22368348 CAAATGAAAGAGAAGGAAGTAGG + Intergenic
1164168304 19:22701531-22701553 CAAATGAAGGAGAAGGAAGTAGG - Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164677391 19:30110805-30110827 CGGAGGACGGAGGAGGAAGCGGG - Intergenic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164879667 19:31721337-31721359 CTTGTGAATCAGAAGGAAGCAGG + Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165333151 19:35152592-35152614 GTGAGGATGGAGAAGAAAGCTGG + Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165852695 19:38859415-38859437 CTGCTGAAGGATATGGAGGCTGG - Intergenic
1166009142 19:39928150-39928172 CTGAGGATGGAGACTGAAGCGGG + Exonic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166975648 19:46603573-46603595 AAGATGAGGGATAAGGAAGCAGG + Intronic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
1168058474 19:53877020-53877042 GGGATGGAGGAGAAGGAGGCTGG - Intergenic
925128877 2:1480702-1480724 CGGATGAAGGAGGAGGGAGGTGG - Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927217677 2:20677622-20677644 CTGCTGAATTAGAAGGAAACAGG + Intergenic
927235592 2:20871590-20871612 CTGATGAAGAAGGAGAAAGAAGG + Intergenic
928003387 2:27541294-27541316 CTGATGCAGGAGAATCAGGCAGG + Intronic
928680704 2:33699709-33699731 GGGCTGAAGGAGGAGGAAGCTGG + Intergenic
928833016 2:35511651-35511673 CTGGTGAAGGTTAAGGAGGCAGG - Intergenic
929522250 2:42664583-42664605 CTGAGGCAGGAGACTGAAGCAGG - Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930879800 2:56258209-56258231 AAGATGAAGAAGAATGAAGCTGG + Intronic
930929473 2:56862726-56862748 GGGCTGAAAGAGAAGGAAGCTGG - Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931489314 2:62726408-62726430 GGGATGAAGGTGGAGGAAGCTGG - Intronic
931932146 2:67150543-67150565 CTGAGGCAGGAGAATGAACCTGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934947420 2:98551830-98551852 CTGAGGAAGCTGAAGAAAGCAGG - Intronic
935104350 2:100025843-100025865 CAGATGTAGGAGAATGAAACTGG + Intronic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936386207 2:112031749-112031771 GTGATGAATGAGAATGAAGCTGG + Intergenic
936714841 2:115174190-115174212 CTGATGAAGTAGAAGAGAGTAGG + Intronic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
936948489 2:117953374-117953396 GTGATAAAGGAGAGAGAAGCAGG + Intronic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
938303186 2:130230419-130230441 CTGATGAAGGGGAGGGCACCAGG - Intergenic
938453484 2:131443818-131443840 CTGATGAAGGGGAGGGCACCAGG + Intergenic
939199800 2:139019003-139019025 AGGTTGAAGGAGAAGGAAGCTGG - Intergenic
939230252 2:139415102-139415124 CACATGTAGGAGAATGAAGCTGG - Intergenic
939358949 2:141143650-141143672 CTGATGAATGAGAAGGCAATGGG - Intronic
939642253 2:144654741-144654763 CTCATGAAAGAGAAAGAAGTAGG - Intergenic
939914293 2:148020847-148020869 CTTAGGAAGGAGGAGGGAGCTGG + Intronic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
941530217 2:166660616-166660638 ATGAAGATGGAGAAGGAAGCAGG + Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
943725903 2:191251088-191251110 CTGGGGAAGGAGAATGACGCAGG - Intronic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
943909689 2:193547300-193547322 CACATGAAGGAGAATGAATCTGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944886942 2:204072661-204072683 CTGATCAGGGAGAAGCAAGCAGG + Intergenic
944934405 2:204552695-204552717 CACATGTAGGAGAATGAAGCTGG - Intronic
945646252 2:212498827-212498849 CTAATGAAGGAGAAGTATACAGG + Intronic
945808437 2:214518610-214518632 CTGTTGAAGGACAAGGAAGGGGG - Intronic
945844231 2:214924737-214924759 CTGATGAAGGAAATTGAAGAGGG - Intergenic
946103851 2:217352101-217352123 GGGCTGAAGGAGAAAGAAGCTGG - Intronic
946284814 2:218694927-218694949 CTGGAGGAGGAGAACGAAGCAGG - Intronic
946496703 2:220202684-220202706 CTCTTCAAGAAGAAGGAAGCTGG - Intergenic
946579904 2:221117152-221117174 CTGAAGTACGAGAAGGAACCAGG - Intergenic
947085695 2:226449760-226449782 ATGATGAAGGAAAAGGGAGGAGG - Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948167510 2:235874385-235874407 CTGGTGATGTAGAAGGAAGTTGG + Intronic
948247518 2:236499054-236499076 CCCCTGAAGGAGAAGCAAGCCGG + Intronic
948642784 2:239386001-239386023 AGGATGAGGGAGAAGGAATCTGG + Intronic
948674603 2:239589492-239589514 AGGAGGAAGGAGAAGGAAGTGGG + Intergenic
948756536 2:240162818-240162840 CAGCTGGAGGAGAAGGCAGCTGG - Intergenic
949066165 2:241991547-241991569 CTGGCGAAGGTGAGGGAAGCAGG - Intergenic
1168889624 20:1286408-1286430 CTGGAGAGGGAGAAGGGAGCTGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169285136 20:4301517-4301539 CTGATTAGGGACAGGGAAGCTGG - Intergenic
1169852938 20:10072604-10072626 CTGATGGAGGAGAAGGTTTCAGG + Intergenic
1169928505 20:10807727-10807749 ATGATGAAGGAGAGAGAAGTTGG - Intergenic
1169928630 20:10808502-10808524 ATGATGAAGGAGAGAGAAGTTGG + Intergenic
1170117522 20:12876332-12876354 ATTATGGAGTAGAAGGAAGCAGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170545517 20:17432829-17432851 CTGTTGCAGGGGATGGAAGCTGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1173854025 20:46238177-46238199 CTGATGCTAGAGAAGGAAGCAGG - Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1175148213 20:56912444-56912466 GTGATGAAGGAGATGCAAGGGGG - Intergenic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1177392349 21:20492553-20492575 CTGAGGAAGAAGAATGAAGTAGG - Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1179075858 21:38121144-38121166 CTGAGGCAGGATCAGGAAGCGGG + Exonic
1179442698 21:41406456-41406478 CTGTTGAAGGAGCAGAAAGCTGG + Intronic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179590984 21:42407636-42407658 TTGATGAGGGTGAGGGAAGCAGG + Intronic
1179777128 21:43672217-43672239 CGGAAGTGGGAGAAGGAAGCAGG + Intronic
1180060483 21:45382526-45382548 CTGAGGAGGAAGAAGGAAACAGG + Intergenic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1182155934 22:28072974-28072996 CTGATGGAGGAGAAGATAGAAGG + Intronic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1184102070 22:42345899-42345921 CTGATGATGGGCAAGGAAGAGGG + Intergenic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
949520046 3:4843153-4843175 CTGCTAAAGGAGAAGGAATTGGG - Intronic
949897171 3:8776529-8776551 TTGATGAAGTAGAAGGAAAGAGG + Intronic
949972104 3:9416987-9417009 GTTTTGAAGGAGAAGGAAACAGG + Intronic
950586341 3:13895201-13895223 CCGAAGAAGGGGAGGGAAGCAGG + Intergenic
950691522 3:14662108-14662130 GTCATCTAGGAGAAGGAAGCCGG + Intronic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951441337 3:22727236-22727258 CTGATGAAGTAGAAAGAATGTGG + Intergenic
952767693 3:36969365-36969387 CTAATGAAAGAAAAGGAGGCTGG + Intergenic
952948628 3:38498815-38498837 ATGATGCTGGAGAAGTAAGCAGG + Intronic
953550513 3:43898834-43898856 ATGAGGTAGGAGAGGGAAGCAGG + Intergenic
953694140 3:45145076-45145098 CTGATGTTGGAGAATGAACCAGG + Intronic
953896584 3:46807845-46807867 CTGATGAGGAAGAAGAAAGAAGG + Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954732787 3:52679032-52679054 GTCAGGAAGGAGAAGGAAACTGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
954994564 3:54869905-54869927 CAGATGAAGGGGAAGGAAAGTGG - Intronic
955349821 3:58185121-58185143 CTGAGGAAGGCCAAGGATGCTGG - Intergenic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
955628305 3:60945039-60945061 CTTGTGAAGGAAAACGAAGCAGG + Intronic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
955750756 3:62183824-62183846 AGGATGAAGGAGAAGGGAACGGG + Intronic
956681294 3:71784679-71784701 GTGATGAGGGAGAAGTAAGCGGG + Intronic
956785297 3:72637355-72637377 CACATGGAGGGGAAGGAAGCTGG - Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
956994752 3:74812398-74812420 CTGAGGGATAAGAAGGAAGCTGG - Intergenic
957878732 3:86183285-86183307 GGGCTGAAGGAGAAGGAAACTGG + Intergenic
959007841 3:101040520-101040542 CTGAGGAATGAGGAGGGAGCTGG - Intergenic
959440080 3:106363091-106363113 GAGCTGAAGGAGGAGGAAGCTGG - Intergenic
959765660 3:110024304-110024326 CACATGTAGGAGAATGAAGCTGG + Intergenic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960285754 3:115826599-115826621 ATGACAAAGGAGAATGAAGCAGG - Intronic
960350670 3:116589047-116589069 GTGATGATGCAGAAAGAAGCAGG - Intronic
960581686 3:119284729-119284751 CTGATGAAGGAAATTGAAGATGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
961207059 3:125092668-125092690 CTGATGAAGGAGAAAGATGGAGG + Intronic
961264247 3:125628169-125628191 CACATGTAGGAGAATGAAGCTGG - Intergenic
961356533 3:126343276-126343298 ATGCTGGAGGAGAAGGAAGTAGG - Exonic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
962365588 3:134777335-134777357 CTGATCAAGGAGAAGAAATAAGG - Intronic
962662613 3:137619038-137619060 CTAAGGATGGAGAAGGAAGGTGG + Intergenic
962747661 3:138409469-138409491 CTGATGAGAGACTAGGAAGCTGG - Intergenic
962940001 3:140117109-140117131 CTGAGGAATGAGAAAGCAGCAGG - Intronic
962976727 3:140452309-140452331 CTTATGGATGAGAAGGAACCAGG - Intronic
963224907 3:142852575-142852597 CTGAGGAAGGAGGAGGAAATGGG - Intronic
963278721 3:143359562-143359584 CTGAGGAAGGACAGGGTAGCTGG + Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963469812 3:145726231-145726253 ATGATGAAAGAGATGGAAGAGGG - Intergenic
963544182 3:146633872-146633894 CTGAAGGAGGAGAAAAAAGCTGG - Intergenic
963819336 3:149870472-149870494 ATGATGATGCAGAAGCAAGCTGG - Intronic
963979806 3:151524882-151524904 ATGATGGAAGAGAAGGAAGAAGG - Intergenic
964310234 3:155384633-155384655 ATGATGGAGGATAAGGAACCTGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966517348 3:180832609-180832631 CTGATGCAGGAGAATGGAGGCGG - Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967349031 3:188491267-188491289 GTGATAAAGGAGGAGGAGGCTGG + Intronic
967513458 3:190339408-190339430 CTAATGAAGCAGAAGCAAGCAGG + Intronic
967517765 3:190390570-190390592 TTGTTGAAAGAGAAGGGAGCCGG - Intronic
967945114 3:194797974-194797996 GCGAGGAAGGAGAGGGAAGCAGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968331965 3:197878524-197878546 CTGGTGACGGAGAAGGAGGGAGG - Intronic
968429228 4:545452-545474 CTCATCAAGCAGAAGGAAGGAGG + Intergenic
969546493 4:7832947-7832969 CTCATGTAGGAGAATGAAACTGG + Intronic
969926738 4:10592645-10592667 CTGATGGGGGAGTAGGAAGAAGG - Intronic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970324079 4:14904941-14904963 AGGAGGAAGTAGAAGGAAGCAGG - Intergenic
970874468 4:20853436-20853458 CTCATGTAGGAGAATGAAACTGG + Intronic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
972028163 4:34413407-34413429 CTGATGAAGGAGAGATGAGCGGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
973933405 4:55816972-55816994 CTAATGAAGGAGGAGGGACCTGG + Intergenic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
974316930 4:60294652-60294674 ATGATGAAAGAGAAAGAAGGAGG + Intergenic
974752234 4:66155921-66155943 ATAATTAAGGGGAAGGAAGCAGG - Intergenic
974888999 4:67855970-67855992 CTGATGAAAGAAATGGAAGAGGG + Intronic
975587618 4:75966080-75966102 GTTTTGAAGGAAAAGGAAGCAGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
977373810 4:96173725-96173747 TTGATGGAGGAGAAGTAAGGGGG + Intergenic
978488539 4:109284688-109284710 CACATGAAGGCAAAGGAAGCTGG + Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979847047 4:125527856-125527878 CTAATGAAGTAGATGGAAGTGGG - Intergenic
980238240 4:130136461-130136483 CAGATGTAGGAGAATGAAACTGG + Intergenic
980810891 4:137877846-137877868 AGGATGAAGAAGAAGGAAGATGG + Intergenic
981359814 4:143833223-143833245 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981370581 4:143954302-143954324 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981380347 4:144064222-144064244 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982560457 4:156923214-156923236 CTGGTGAAGGAGCAGCAAGAAGG - Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983637325 4:169911075-169911097 CTGATGGAGGAAAAGGAGGATGG - Intergenic
984018309 4:174452685-174452707 CTGATAAAAGAGAAGAAAACAGG + Intergenic
984235971 4:177159519-177159541 GGGCTGAAGGAGGAGGAAGCTGG + Intergenic
985063673 4:186102072-186102094 CTCCTGAAGGAGAAGGGTGCTGG + Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
985901490 5:2798771-2798793 GTGCTGAAGGAGAAGGCTGCTGG - Intergenic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
987297781 5:16569198-16569220 CTACTGAAGGAGGATGAAGCTGG + Intronic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
987837397 5:23179064-23179086 CTGATGAGGAAGAATGAATCTGG + Intergenic
989034746 5:37158880-37158902 CTGAGGCAGGAGAATGAACCCGG - Intronic
989262948 5:39438867-39438889 TTGATAAAGGAGAAGGTAGAAGG + Intronic
989564303 5:42886202-42886224 CTGCTGTAGGAAAAGGAAGAAGG - Intronic
989756216 5:44958768-44958790 AGGAGGAAGGAGAAGGAAGGAGG - Intergenic
990134750 5:52631593-52631615 GGGCTGAAGGAGGAGGAAGCTGG - Intergenic
990636879 5:57738108-57738130 CTGATGAAGGTGAATAAATCAGG + Intergenic
991098417 5:62764232-62764254 ATGTTGAAGTAGAAGGAAACAGG + Intergenic
992378561 5:76214683-76214705 CTGATGAAAGAAATGGAAGATGG - Intronic
993840849 5:92876645-92876667 CTTATGAAGGAAAGGTAAGCTGG - Intergenic
993944000 5:94096814-94096836 GGGCTGAAGGAGGAGGAAGCTGG + Intronic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
995115138 5:108470946-108470968 CTATTGAGGGATAAGGAAGCTGG - Intergenic
996823896 5:127660059-127660081 CTGAGGAAGGGCACGGAAGCTGG - Intergenic
996843722 5:127876728-127876750 CAAATGGAGGAGGAGGAAGCAGG + Intergenic
996886001 5:128354288-128354310 CTGACGCAGGAGCAGGAAGTAGG + Intronic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998056542 5:139083060-139083082 CTGATTTAGGAGCAAGAAGCAGG + Intronic
998189079 5:140007210-140007232 CTGCTCTAGGAGAAGGAAACTGG + Intronic
998332709 5:141343795-141343817 CTCAAGAAGGAGAACGCAGCTGG + Intronic
998627615 5:143863479-143863501 CTGCTGGAGGACAAGGAAGATGG - Intergenic
999128082 5:149261395-149261417 CTAACAAAGAAGAAGGAAGCAGG + Intergenic
999216367 5:149938997-149939019 TGGGTGAAGGAGAAGGAAGGTGG - Intronic
999495126 5:152089318-152089340 CTGATGAAGAATTAGGAGGCTGG - Intergenic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
999701821 5:154235192-154235214 GTGATAAAGGAGAGAGAAGCAGG - Intronic
1000134882 5:158337485-158337507 GGGCTGAAGGAGGAGGAAGCTGG - Intergenic
1000734807 5:164885949-164885971 CTGATGGAGCTGAAGGAAGTGGG - Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001642139 5:173252112-173252134 CTGCAGAAGGAGAAACAAGCAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002506126 5:179680270-179680292 CTGCTGAAGGATTAGAAAGCCGG + Intronic
1003269659 6:4596449-4596471 CACATGTAGGAGAAGGAAACTGG - Intergenic
1003527707 6:6911693-6911715 CCAATGAAGGGGGAGGAAGCAGG - Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004157544 6:13183614-13183636 CTGATCAGGGAGGAGGAAGGAGG + Intronic
1004460748 6:15833597-15833619 ATGGTGAATGAGAAGAAAGCAGG - Intergenic
1005127991 6:22470774-22470796 CTGATAAAGCTAAAGGAAGCGGG - Intergenic
1006912955 6:37575948-37575970 GGGATGTAGGAGAAGGAAGGTGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007394322 6:41569053-41569075 GGGATGAAGGAGGTGGAAGCTGG - Intronic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008549333 6:52612586-52612608 CTTATGAAGGAGGAGAGAGCTGG - Intergenic
1008705561 6:54154382-54154404 CTGCTGGAGGGGAAGTAAGCTGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010188943 6:73175056-73175078 CAGGTGAAGGAGATGCAAGCAGG - Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1011885685 6:92092045-92092067 CTGAGGCAGGAGAATGAAGCCGG + Intergenic
1012627466 6:101421371-101421393 CGGAAGAAAGAGGAGGAAGCAGG + Intronic
1013349131 6:109290312-109290334 CTTGGGAAGGTGAAGGAAGCCGG + Intergenic
1013783285 6:113752120-113752142 CTGATGAAAGAAATGGAAGAAGG + Intergenic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1014919741 6:127200078-127200100 ATGATGAAGGAGAAGGAAAGTGG - Intergenic
1015868687 6:137753913-137753935 CAGCTGTAGGATAAGGAAGCTGG + Intergenic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1016926399 6:149353410-149353432 CTGAGGAAGAAGAGGGAATCTGG - Intronic
1018010060 6:159661377-159661399 CACATGAAGGAGAATGAAACTGG + Intergenic
1018038085 6:159898684-159898706 AGGATGAAGGAGGAGGAAGAGGG - Intergenic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1020466956 7:8491079-8491101 CTGATGAGGAAGAAGGCAACTGG - Intronic
1020661050 7:10982972-10982994 ATGATGAAGATGAGGGAAGCGGG + Exonic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021380800 7:19963611-19963633 ATGATGAAGAAGCATGAAGCAGG - Intergenic
1021425502 7:20495498-20495520 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021792214 7:24217186-24217208 CACATGAAGGAAAAGAAAGCTGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022230035 7:28405769-28405791 CTGATGACGGAGAAGAAAAGAGG - Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023693434 7:42818642-42818664 AGGAAGAAGGAGAAGGAAGGAGG + Intergenic
1023748515 7:43346688-43346710 CTCATGTAGGAGAATGAAACTGG - Intronic
1023882850 7:44330218-44330240 CAGATGCAGGAGCAGAAAGCTGG - Intronic
1024451085 7:49543667-49543689 CAGATGAAGGAAAACAAAGCGGG + Intergenic
1025302257 7:57827144-57827166 CTGGTGAAAGAGTAGAAAGCAGG + Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026060250 7:67019292-67019314 CTGAGGCAGGAGATGGGAGCTGG - Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028696216 7:93716271-93716293 CTGACAAGGGAGGAGGAAGCTGG - Intronic
1028872045 7:95780838-95780860 TGGATGATGGAAAAGGAAGCAGG + Intronic
1028996163 7:97102391-97102413 CACATGTAGAAGAAGGAAGCTGG + Intergenic
1030580113 7:111344361-111344383 CTGAAGGAAGAAAAGGAAGCAGG - Intronic
1030693279 7:112556974-112556996 CTAATAAAGGAGAAAGAAACAGG - Intergenic
1030725556 7:112922052-112922074 CTGATGCAGGAGAATCAGGCAGG - Intronic
1031981637 7:128130777-128130799 CTGCTGCAGGACAAGGAGGCAGG + Intergenic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032684561 7:134219939-134219961 GTGATGAAGAAACAGGAAGCTGG - Intronic
1033293917 7:140114264-140114286 CTGAGGCAGGAGAATCAAGCAGG - Intronic
1033556256 7:142490701-142490723 CTCAGGAAGGAGACAGAAGCAGG - Intergenic
1033558622 7:142510154-142510176 CTCAGGAAGGAGACAGAAGCAGG - Intergenic
1034244608 7:149634940-149634962 CTGAAGAAGGAGGAGGAATTAGG + Intergenic
1034413345 7:150952666-150952688 CTGCTGAAGGAGACGGAAGAAGG - Exonic
1035110346 7:156476348-156476370 CTTTTGGAGGAGAAGGAAGGTGG - Intergenic
1035739303 8:1914190-1914212 CTCCTGAAGTAGAAGGCAGCAGG + Intronic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036796051 8:11757568-11757590 GTGGGGAAGGAGGAGGAAGCTGG + Intronic
1037077444 8:14738320-14738342 ATGATGAAGGAGAGGGAACCAGG - Intronic
1037915370 8:22769653-22769675 GTGATAAAGGAGAAAGAGGCTGG - Intronic
1038238384 8:25784449-25784471 GTGATGGAGGAGGAGGAAGGAGG - Intergenic
1038532421 8:28329137-28329159 ATGGTGCAGGAGCAGGAAGCAGG - Exonic
1040065209 8:43139949-43139971 CTGACGAAGTGGAAGGGAGCAGG - Intergenic
1040478511 8:47802574-47802596 CTGAGGCAGGAGAATGAACCTGG - Intronic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1040702559 8:50085065-50085087 ATGATGCAAGAGCAGGAAGCTGG + Intronic
1040711343 8:50192846-50192868 CACATGTAGGAGAAGGAAACTGG - Intronic
1041112350 8:54495746-54495768 CACATGAAGGAGAATGAAACTGG - Intergenic
1042082947 8:65075923-65075945 AAGATGAAGGGGAAGAAAGCAGG + Intergenic
1042689462 8:71481811-71481833 CTGATGGAGAAAAAGGAAGGAGG + Intronic
1044398073 8:91737105-91737127 CTGATAAAGGAGAAAGAAGTGGG + Intergenic
1044633925 8:94303679-94303701 TTGGTGAAGGAGAAGGGTGCAGG - Intergenic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045298987 8:100894594-100894616 CTGATGAAGGTCAGGGAAGTGGG + Intergenic
1045348386 8:101315690-101315712 CTTATGAAGGAGAAAGGAGATGG - Intergenic
1045958895 8:107943582-107943604 CTGATAAAGTAGAAGCAAACTGG + Intronic
1045990081 8:108296699-108296721 CTGATCAAGCAGAAGGAAATGGG - Intronic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046941339 8:119934335-119934357 CTAATGAAGAAGCAAGAAGCTGG + Intronic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1048857859 8:138699282-138699304 GTGATGCAAAAGAAGGAAGCAGG - Intronic
1048898789 8:139018373-139018395 ATGATGAAGGTGATGGGAGCTGG + Intergenic
1048969879 8:139639517-139639539 CTGATGAAGGACAAGGACTGGGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049313258 8:141945064-141945086 CTCATGAAGGAGAGTGAAGCCGG + Intergenic
1050227101 9:3471897-3471919 CTAATGAAGGGGCAAGAAGCTGG - Intronic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1051034655 9:12729135-12729157 TTGAAGAAAGAGAAGGCAGCTGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1052023080 9:23546635-23546657 CTTATGAAGAAAAAGAAAGCTGG + Intergenic
1053051478 9:34964539-34964561 ATAAGGAAGGGGAAGGAAGCTGG - Intronic
1053422127 9:37986364-37986386 CTCATGAGGTAGAAGGAAACAGG + Intronic
1054994432 9:71369251-71369273 CTGATGGAGGAGAAAAAAGAGGG + Intronic
1056957035 9:91090799-91090821 CGCATGAAAGAGAAGGAAGGAGG - Intergenic
1057666447 9:97049202-97049224 CTGATGAAAGAGAAGAAAATTGG + Intergenic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1057931352 9:99196228-99196250 ATGATGGAGGAGGAGGATGCTGG + Intergenic
1058640686 9:107081058-107081080 CTGATTAAGCAGAAGGAAAGAGG + Intergenic
1058814851 9:108673707-108673729 ATGAGGCTGGAGAAGGAAGCTGG + Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059072454 9:111152930-111152952 AGGAGGAAGGAGGAGGAAGCAGG + Intergenic
1059170363 9:112119006-112119028 CTGATGTAGGAGAAAGAATGTGG + Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059621511 9:116010991-116011013 CTGAAGAAGGTGAAGGGACCAGG + Intergenic
1059953802 9:119495307-119495329 ATGATGTAGAGGAAGGAAGCAGG + Intergenic
1060031597 9:120219035-120219057 CTGATGAGAGGGAAGGAAGCAGG + Intergenic
1060103235 9:120857842-120857864 CTGGGGTGGGAGAAGGAAGCAGG - Exonic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060600057 9:124871231-124871253 CAGATGGAGTAGAAGGAACCCGG + Intronic
1061458945 9:130720701-130720723 CTGAAGGAGGACAAGGGAGCAGG + Intronic
1061505053 9:131027081-131027103 CTAATGAACCAGAAGGAAGACGG + Intronic
1062083259 9:134635667-134635689 CTGATGGAGGGCCAGGAAGCAGG - Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062538946 9:137033014-137033036 CTGGTGTAGAAGAAGGAACCTGG - Exonic
1062643216 9:137532819-137532841 CTGGAGAAGGTGAAGCAAGCAGG + Intronic
1185582676 X:1223071-1223093 ATGATGAAGAAAAAGGAAGCGGG - Intergenic
1186920837 X:14278196-14278218 CTGAACAAAGAGAACGAAGCTGG + Intergenic
1186984188 X:14993734-14993756 ATGATGATGTAGAAGCAAGCTGG - Intergenic
1187292875 X:17972260-17972282 CTGGTGTAGGAGGAGGAAGGGGG - Intergenic
1187590255 X:20709895-20709917 CTGATGAAAGAAAAGGCACCTGG - Intergenic
1187607913 X:20906214-20906236 GCGCTGAAGGAGGAGGAAGCTGG - Intergenic
1187773139 X:22724588-22724610 CACATGTAGGAGAATGAAGCTGG + Intergenic
1187986494 X:24818532-24818554 CTGATGTAGAAGAATAAAGCAGG - Intronic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1188349476 X:29110331-29110353 CTAATTGAGGAGAAGGAAACGGG - Intronic
1188707709 X:33356654-33356676 GGGATGAAGGTGAAGGAAGATGG + Intergenic
1188833658 X:34931479-34931501 GGGCTGAAGGAGAAGGAAGCTGG + Intergenic
1188941271 X:36241036-36241058 AGGCTGAAGGAGGAGGAAGCTGG + Intronic
1189389552 X:40564380-40564402 CTCATCAAGCAGAAAGAAGCTGG - Intergenic
1189414782 X:40804190-40804212 CTGAGGATGGAGAAGAGAGCTGG + Intergenic
1189578490 X:42381143-42381165 GAAATGAAGGAGAAGGAAGCAGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191816646 X:65253227-65253249 GGGCTGAAGGAGAAGGAAGCAGG + Intergenic
1193093299 X:77518486-77518508 CTGATGAAAGAAATGGAAGAGGG + Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194610290 X:96035161-96035183 CTGAAGAAAGAAAGGGAAGCAGG - Intergenic
1194956033 X:100181620-100181642 CACATGTAGGAGAATGAAGCTGG + Intergenic
1194965365 X:100282298-100282320 CTGATGAAGGAAATTGAAGAGGG - Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195766227 X:108298816-108298838 TTTATGAAGGAGGAGGAAGAGGG + Intronic
1196171938 X:112598268-112598290 CATATGTAGGAGAAGGAAACTGG + Intergenic
1196230559 X:113216442-113216464 TGGCTGAAGGAGGAGGAAGCTGG - Intergenic
1196554312 X:117069715-117069737 GTGCTGAAGGGGGAGGAAGCTGG + Intergenic
1197784367 X:130185967-130185989 TTGGTAAAGGAGAGGGAAGCGGG + Intergenic
1199007989 X:142724696-142724718 CACATGTAGGAGAATGAAGCTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199065595 X:143413687-143413709 CACATGTAGGAGAAGGAAACTGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199684647 X:150255273-150255295 GTGAGGAAGCACAAGGAAGCTGG - Intergenic
1199827905 X:151517328-151517350 CGGCTGAAAGAGAAGGAAGCTGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1200885507 Y:8264455-8264477 CTGAAAAAGGAGACCGAAGCAGG - Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1202043532 Y:20713028-20713050 CAGATGCATCAGAAGGAAGCTGG - Intergenic