ID: 925203384

View in Genome Browser
Species Human (GRCh38)
Location 2:1987154-1987176
Sequence AAGAATCAGAATTTTAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925203381_925203384 2 Left 925203381 2:1987129-1987151 CCAGCAAGTTCTGGGAGAAAATT 0: 1
1: 0
2: 0
3: 22
4: 217
Right 925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG 0: 1
1: 1
2: 5
3: 62
4: 521
925203378_925203384 18 Left 925203378 2:1987113-1987135 CCATTACTTTATCTTGCCAGCAA 0: 1
1: 0
2: 1
3: 20
4: 204
Right 925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG 0: 1
1: 1
2: 5
3: 62
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925203384 Original CRISPR AAGAATCAGAATTTTAGGGC TGG Intronic
900860514 1:5226036-5226058 AAGAATTAGAATTGAAGGCCAGG - Intergenic
901114523 1:6831112-6831134 AAGAATCAAAACTATCGGGCCGG - Intronic
901320336 1:8336114-8336136 ATGATTCAGAATTTGAGGCCAGG + Intronic
901424922 1:9176206-9176228 AAAAATAATAATTTTAGGCCGGG - Intergenic
901541522 1:9920714-9920736 AAGAGTGAGCATTTTGGGGCAGG - Intergenic
901615598 1:10537058-10537080 AAAACTCAGAATTTCAAGGCTGG - Intronic
902035169 1:13452695-13452717 AAGAATTATAATTTTTGGCCGGG - Intergenic
903670132 1:25030677-25030699 AAGAGTCTGAAATTTAGGGAGGG + Intergenic
903805425 1:26002021-26002043 AAGAAAAAGAATTTTAGGCCGGG + Intergenic
904297037 1:29526549-29526571 AAGAATCAGGAAATAAGGGCGGG - Intergenic
904483875 1:30811389-30811411 AATATTCAGAACTTTAAGGCAGG + Intergenic
904687156 1:32268838-32268860 AAGAAACAGGAGTCTAGGGCTGG + Intronic
905015769 1:34777363-34777385 AGGGAGCAGAAATTTAGGGCAGG + Intronic
905991731 1:42343226-42343248 CATAATTAGAATTTGAGGGCCGG + Intergenic
906134163 1:43483844-43483866 AAGAAAAAGAAGTTTTGGGCTGG - Intergenic
907038112 1:51234707-51234729 AAGACTCATAATTTTGGGCCAGG - Intergenic
907198425 1:52705861-52705883 AATAATAATAATTTTAGGCCGGG - Intergenic
908334858 1:63111422-63111444 AAGAATCAGGAGTTTGTGGCCGG - Intergenic
908653651 1:66364002-66364024 AATTAACAGAATTTCAGGGCAGG + Intronic
909095475 1:71281912-71281934 AAGAATAATAATTTTTGGCCGGG - Intergenic
909220824 1:72959001-72959023 AAGAATAGTAATTTTAGGTCAGG + Intergenic
910081341 1:83345959-83345981 GAAAATCAGAATTTTAGTCCTGG - Intergenic
910534099 1:88276769-88276791 TAGAATCAGAATATTTGGGGTGG + Intergenic
911330766 1:96523307-96523329 AAGAAAAAGAATTTTGTGGCTGG - Intergenic
911726632 1:101248363-101248385 AATCATAAGAAATTTAGGGCCGG + Intergenic
912065386 1:105734039-105734061 AAGAATTATAATTTTTGGCCGGG + Intergenic
912961948 1:114203824-114203846 AAGAAGCAGTATCTGAGGGCAGG - Intergenic
913293065 1:117293262-117293284 AGGAATCTGAAGTTTGGGGCTGG - Intergenic
914264215 1:146024041-146024063 GAGAACCAGAATTTTTGGGGTGG + Intergenic
914727145 1:150337333-150337355 CAGAAATAGAATTTTATGGCCGG - Intronic
916142759 1:161713412-161713434 AAGAATCAGATTTATTGGGGTGG - Exonic
916898906 1:169199797-169199819 AAAATTCAGAATTTTAGAGTTGG + Intronic
917865735 1:179193345-179193367 AAAAAGCAGACATTTAGGGCTGG - Intronic
918016264 1:180635862-180635884 AAAACACAGAATTTTAGAGCTGG - Intronic
918266574 1:182847654-182847676 AAGAATCAGAATTAGAGTTCAGG - Intronic
918694558 1:187528427-187528449 AAGAATGGGAGCTTTAGGGCTGG + Intergenic
919161379 1:193835290-193835312 AAAAATTAGAATTTTTTGGCAGG + Intergenic
919352403 1:196474778-196474800 AAGAATAAGAACTTTAGTGTTGG + Intronic
919567334 1:199205196-199205218 TAGATTCAGAATTTTAGAGCTGG + Intergenic
919700211 1:200623859-200623881 AAGAAAAAGAAAATTAGGGCCGG - Intergenic
919774641 1:201186280-201186302 AAGAATCCGATATCTAGGGCAGG + Intergenic
919843390 1:201625621-201625643 AAGAAGCAGAAATGCAGGGCAGG + Intronic
920237979 1:204522020-204522042 AAGGATAAGAATTAGAGGGCAGG + Intronic
920656659 1:207881361-207881383 AAGAATCAGCATTCGGGGGCTGG + Intergenic
920802237 1:209200123-209200145 CTGAATCAGAATGTCAGGGCAGG + Intergenic
921210240 1:212889802-212889824 CAGAATCGGAATTTGAGGCCAGG - Intronic
922426716 1:225503570-225503592 AACAATGAGATTTTTAAGGCTGG - Intronic
922487230 1:225983697-225983719 AAGAATGCGTATTTTAGGCCAGG - Exonic
923081883 1:230665517-230665539 AGGAATCAGAATTTTAGATTTGG + Intronic
923447627 1:234087365-234087387 AAGATTCAGAATGTTGGAGCCGG + Intronic
923450524 1:234112868-234112890 AAGAATGTGAATTATAGGCCGGG - Intronic
923924723 1:238612071-238612093 AGAAATCAGACTTTGAGGGCAGG - Intergenic
1063024055 10:2160494-2160516 GAGAATTAGAATTATTGGGCTGG + Intergenic
1063657137 10:8002218-8002240 AAGAATTACAATTTTAGGTCAGG - Intronic
1064044896 10:12004212-12004234 AGGTATCAGATTGTTAGGGCAGG - Intronic
1064694548 10:17952371-17952393 AAGAATCAAGATTCTAGAGCAGG - Intronic
1065047936 10:21760878-21760900 AAGAGGCAGTATTTTAGGCCAGG + Intronic
1066038172 10:31515797-31515819 AAGAAACAGAATATTGTGGCAGG - Intronic
1066265617 10:33773555-33773577 AAGAATCACAATTTTCATGCTGG - Intergenic
1066290524 10:34010489-34010511 AATATTAAGAAGTTTAGGGCTGG + Intergenic
1067269487 10:44777119-44777141 AAGAAATAGAAATTTAAGGCCGG - Intergenic
1068386108 10:56329867-56329889 AAAAATCAGAGTTTTAGGTGGGG + Intergenic
1068746190 10:60533251-60533273 AGGACTCAGAACTTTAGAGCTGG + Intronic
1068919101 10:62464708-62464730 AAGAATAATAATTTTAGAGCTGG + Intronic
1069444905 10:68464215-68464237 ATGTATCAAAATTTTAGGCCAGG + Intronic
1070507565 10:77127675-77127697 AAGAATCCCAATTTGAGGTCGGG + Intronic
1071104075 10:82074187-82074209 AAGAATCTGAATTTCTGGGGTGG + Intronic
1072028170 10:91486258-91486280 AAGAATAAGAATTTAAGTTCTGG + Intronic
1072450755 10:95537799-95537821 AAGACTCAGAATTTAATGACTGG + Intronic
1073704669 10:105969728-105969750 AAGAATCAGAAATAGAGGACTGG - Intergenic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1074992834 10:118726026-118726048 GATAATCAGAAATTTAGTGCTGG - Intronic
1075108089 10:119555928-119555950 AAGAATCAGCATTTGGGGCCAGG + Intergenic
1075384564 10:122046176-122046198 AAAAATCATAATAATAGGGCTGG + Intronic
1078335784 11:10462260-10462282 AAGTATTAGAATTTTAATGCAGG + Intronic
1078654025 11:13221575-13221597 AAAAAACAGTATTTTAGGCCAGG - Intergenic
1079041733 11:17065706-17065728 AGGAATCAGTATTTTAGGATGGG + Intergenic
1079041777 11:17066022-17066044 ATAAATCAGTATTTTAGGCCAGG + Intergenic
1079649041 11:22903422-22903444 AAAAATCAGAAGTTCAGGGTTGG - Intergenic
1079718890 11:23785837-23785859 AAAATCCAGAATTTTAGTGCCGG - Intergenic
1080308992 11:30867848-30867870 TAGAATCAGACTTTTAAAGCTGG + Intronic
1081320369 11:41685079-41685101 AAGAATAAGAACTTTAGGCCAGG + Intergenic
1082017828 11:47505336-47505358 AAAAATCAGTATGTTAGGCCAGG + Intronic
1082841296 11:57692315-57692337 AAGAATAAGCAATTAAGGGCTGG - Intronic
1082892379 11:58153873-58153895 AAGAATTAGGATTTGAGGGAAGG + Intronic
1083013553 11:59427251-59427273 AAACATCAGACTTTCAGGGCTGG - Intergenic
1083410849 11:62491363-62491385 AAGACTCAGAATTAAAGGGTTGG - Intronic
1083977877 11:66138592-66138614 AAGAAACACAATATCAGGGCTGG - Intronic
1084551866 11:69848780-69848802 AAGAATCAGGATGTTAGGTTGGG - Intergenic
1085473866 11:76776195-76776217 AAGAAACAGAATTTGTGGGCTGG - Intergenic
1085690603 11:78660838-78660860 AAGACTCAGAATTGTATAGCTGG - Intronic
1087275845 11:96159717-96159739 AAGAATCAGTGGTTTAGGCCGGG - Intronic
1087772212 11:102222946-102222968 AAGAATTATTTTTTTAGGGCCGG + Intronic
1088089067 11:106016355-106016377 AAGAAGCAGCATATTGGGGCTGG - Intronic
1088219168 11:107549144-107549166 AGAAATCAGAATTTTAGGCTGGG - Intronic
1088229508 11:107659554-107659576 AAGAATTGGCATTTAAGGGCAGG + Intronic
1088517774 11:110657243-110657265 CAGAATCAGAAATTTAGAACTGG - Intronic
1088857146 11:113766372-113766394 AAAAATAAGAATTTTTAGGCTGG + Intronic
1089933243 11:122335560-122335582 TAGAAACAGAATTCTAGAGCTGG + Intergenic
1090419989 11:126568067-126568089 AAGAAACAGAAATTAATGGCAGG + Intronic
1090864939 11:130691382-130691404 AAGAAACTGACTTTTGGGGCCGG - Intronic
1091517372 12:1198222-1198244 AAGAGTCCAAATTTCAGGGCTGG - Intronic
1091745231 12:2987767-2987789 TAAAATCACAATTTCAGGGCCGG + Intronic
1091828448 12:3532791-3532813 ATGAATCAGAAATTTTGGGACGG - Intronic
1092456817 12:8651233-8651255 AAGAATCAGATTTCTTAGGCAGG + Intronic
1093185743 12:16017224-16017246 AGAAATCACAATTTTAGGGTTGG - Intronic
1093571989 12:20677078-20677100 AAGAATCAGAATTTGAAGACAGG - Intronic
1093938844 12:25030681-25030703 TAGAATCAGATTTTTTAGGCTGG - Intronic
1094493032 12:30973036-30973058 TGGATTCAGCATTTTAGGGCAGG - Intronic
1095305649 12:40636023-40636045 AAGTATCAAATCTTTAGGGCAGG + Intergenic
1095444534 12:42270885-42270907 AAGAATAAGCATTTCAGGGTTGG - Intronic
1096689330 12:53309767-53309789 AAGAAATAGAATTTTGGGGATGG - Intronic
1097244284 12:57598223-57598245 AAGAATCCAAATTGTAGGCCGGG + Intronic
1098452917 12:70640464-70640486 AAAAATCATAATTATAGGACTGG - Intronic
1098658117 12:73058488-73058510 AAGAAACATAATTTTAGAGTTGG + Intergenic
1100326880 12:93548375-93548397 AAGAATAAGAATTCTAGCCCTGG - Intergenic
1100547084 12:95613496-95613518 GAGGATCAGAATTTTTGGGGGGG + Intergenic
1101330575 12:103754652-103754674 AAGAATTAGAGTTCTAGGCCAGG + Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103320427 12:120089675-120089697 AAGAAACAGAAGTTGAGGCCGGG - Intronic
1103571226 12:121846511-121846533 AAAAATCAGGAAATTAGGGCCGG - Intronic
1104026561 12:125031822-125031844 AAGAATAGGATTTTTAAGGCTGG - Intergenic
1104361638 12:128138629-128138651 AAGAATCAGGATGAAAGGGCAGG - Intergenic
1105468806 13:20673100-20673122 AAGTATTAAAATTCTAGGGCCGG + Intronic
1105715379 13:23057543-23057565 AAGAACCAAAATTTCGGGGCCGG + Intergenic
1106187068 13:27419020-27419042 AAGAATCAGAATGTCAGAGCTGG + Intergenic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1106272697 13:28169751-28169773 AAAAATAATAATTTTAGGCCGGG + Intronic
1106523230 13:30516931-30516953 AAGGTTCAGAATTTTAGGCTAGG + Intronic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1107065054 13:36204245-36204267 TATAATCAGAATTAAAGGGCTGG - Intronic
1108060495 13:46528479-46528501 TAAAATCATAATTTTAGGCCAGG + Intergenic
1108062561 13:46548169-46548191 AAGAAATAGATTTTTAGGGCGGG - Intergenic
1108283416 13:48881889-48881911 GAGAACCAGAATTCTAGAGCTGG - Intergenic
1108486328 13:50930054-50930076 AAGAAACAGAACTTTGGTGCTGG - Intronic
1108622497 13:52197597-52197619 AGAAATCAGAATATTAAGGCTGG + Intergenic
1108792562 13:53989454-53989476 AAAAAACAGAATTTTTGGGTAGG + Intergenic
1109075285 13:57826216-57826238 AATAATCAGATTTTTAGAGATGG + Intergenic
1110314801 13:74093628-74093650 CAGAATCAGACATTTAGAGCTGG - Intronic
1110600263 13:77364756-77364778 TAGAATTAGCCTTTTAGGGCCGG - Intergenic
1110719282 13:78743537-78743559 AAGAATCAGAATTTTCTAGAAGG + Intergenic
1111241408 13:85480604-85480626 AACAAACAAAATTTTAGGCCAGG - Intergenic
1112531879 13:100212433-100212455 AAGGATAAGAATTTTAGAGCAGG - Intronic
1112617722 13:101022237-101022259 AAGAATCATACTTGGAGGGCAGG - Intergenic
1112781877 13:102909547-102909569 AAAAATAAGAATCTTAGGCCAGG - Intergenic
1112852778 13:103727405-103727427 AAGAATTAATATTTTATGGCAGG - Intergenic
1112982649 13:105404916-105404938 AAGCATCTGATTTTTAGGGAGGG - Intergenic
1112997085 13:105587248-105587270 AAGAAAAAGAATTCTAGGGCCGG + Intergenic
1113751774 13:112781463-112781485 GAGAACCAGAATCCTAGGGCTGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114325037 14:21580457-21580479 AAGAAACAGAATTTCAGGGTTGG + Intergenic
1114948661 14:27718203-27718225 GAAAATAAGAATTTTAAGGCTGG - Intergenic
1115179436 14:30605189-30605211 AAGAATCAGAATCTCAGGCCAGG - Intronic
1115341610 14:32298689-32298711 AAGAAGCAGCAGTTTGGGGCTGG + Intergenic
1115998687 14:39219817-39219839 AAAAAAAAGACTTTTAGGGCTGG + Intergenic
1116932965 14:50708276-50708298 AAAAATTAGAATTTTGAGGCCGG - Intergenic
1116975020 14:51106189-51106211 AAAAATAATAATTTTAGGCCGGG - Intergenic
1117032125 14:51683713-51683735 AAGAATCAGATTTAGAGGTCAGG + Intronic
1117309903 14:54510631-54510653 TAAAATCATAATTTTAGAGCTGG + Intronic
1117643209 14:57822738-57822760 AAGCCACAGAATTTTAGGGTAGG - Intronic
1117648596 14:57879118-57879140 CATGATCAGAATTTTAGTGCAGG + Intronic
1118880022 14:69817979-69818001 AAGAATTTGGATTTTAGGCCGGG - Intergenic
1118926015 14:70189972-70189994 AAAAGTCAGAATGTAAGGGCAGG + Intergenic
1119060158 14:71465660-71465682 AAGAAACAGAATGTTAAGGATGG - Intronic
1119819022 14:77597826-77597848 AAAAAAAAGAATTTTAGGCCAGG + Intronic
1120493840 14:85209291-85209313 AAGAATAGGACTTTCAGGGCTGG - Intergenic
1120554124 14:85907876-85907898 AATAATCTGATTTTTATGGCAGG - Intergenic
1121186789 14:91979668-91979690 AAAACTCAGAATTTAAGGGACGG + Intronic
1122464815 14:101924735-101924757 AAGAAGCAGAAATTTCTGGCTGG - Intronic
1123797688 15:23789272-23789294 AAGGATATGAATTTTGGGGCAGG + Intergenic
1124378171 15:29141686-29141708 AAGACTCAGAATTACAGGGAAGG + Intronic
1125259660 15:37808831-37808853 AGGTATAAGAATTTTATGGCCGG + Intergenic
1125556355 15:40588599-40588621 AAAAATCAGAATTCTAGACCAGG + Intergenic
1125658844 15:41380431-41380453 TAGAAACAGAATTTTAGGATGGG - Intronic
1126152693 15:45537491-45537513 AAAAATAATAATTTTAGGCCAGG + Intergenic
1127053460 15:55108592-55108614 AAGAATCAGAATTCCAGCGGGGG + Intergenic
1127080767 15:55377154-55377176 AAGAATCATAATTTTAGAGATGG + Intronic
1127552208 15:60051757-60051779 AAAAATATGAATTTTAGGGCTGG + Intronic
1128272091 15:66319232-66319254 AAAAAACAGAATCTTGGGGCTGG - Intronic
1129086755 15:73102071-73102093 CAGAATCTGAATTTTAGTCCAGG + Intronic
1129494729 15:75967755-75967777 AAGAATCAGATTTTGCGGCCAGG - Intronic
1131242695 15:90760744-90760766 GAGAAACAGAATTTGAGGGAAGG - Exonic
1131331115 15:91500350-91500372 AAGAATTAAAATTTTTGGCCGGG + Intergenic
1132161571 15:99547750-99547772 TACCATAAGAATTTTAGGGCAGG + Intergenic
1132888512 16:2193310-2193332 AAAAATAAGAATTTCAGGCCGGG - Intronic
1133163040 16:3924710-3924732 AAGAAAAAGAATTTTGGGTCAGG + Intergenic
1133977490 16:10609913-10609935 AATATTCAGAAATTTAGGCCAGG + Intergenic
1134815194 16:17199924-17199946 AAGAAACAGCATTTAGGGGCCGG + Intronic
1134846056 16:17441627-17441649 AAGAATTTGAAATTTAAGGCAGG - Intronic
1136131698 16:28226129-28226151 AAGAATTAGAACCTTAGGTCGGG - Intergenic
1137741880 16:50784972-50784994 AAGAATCACCTTTTTAAGGCAGG - Intronic
1138075580 16:54039102-54039124 GAGAATGAGAATTTCAGGGAAGG + Intronic
1138660417 16:58513457-58513479 GAGAAACAGAATGTTTGGGCAGG + Exonic
1139454741 16:67064499-67064521 TAAAAACATAATTTTAGGGCTGG - Intronic
1140130456 16:72156321-72156343 AAGAATCAGTATTGGAGGCCGGG + Intronic
1140191313 16:72819474-72819496 CTGAATCAGAACCTTAGGGCAGG - Intronic
1140221410 16:73047319-73047341 GAGAATCAGAGTTTTGGAGCTGG - Intronic
1140422776 16:74834365-74834387 AAGAATCAGGATGTCAGGGGAGG + Intergenic
1141281080 16:82629964-82629986 AAGAATTAGGAATTTAGGGAGGG + Intronic
1141803117 16:86324250-86324272 CAAAATCAGAATTTTAGGGAGGG + Intergenic
1144176742 17:12714973-12714995 GAGAATCAAACTTTGAGGGCTGG - Intronic
1145856508 17:28163659-28163681 AAAAATCAGAATGTCAGGGCAGG + Intronic
1145975388 17:28981197-28981219 AAGAATCAGGATTTGAGCTCAGG + Intronic
1147294588 17:39471925-39471947 GAGAATTAGAATTTGAGGCCTGG + Intronic
1147536598 17:41326125-41326147 AAGAAGGAGGTTTTTAGGGCAGG + Intergenic
1148098498 17:45071953-45071975 ATGAATAAGAAAATTAGGGCTGG + Intronic
1148252581 17:46097028-46097050 CAGAAACAGAATTTCATGGCTGG - Intronic
1148369263 17:47083276-47083298 CAGAAACAGAATTTCATGGCTGG - Intergenic
1149033121 17:52105535-52105557 AAGAATAAGGATTTGAGGCCAGG - Intronic
1149287461 17:55180637-55180659 CAGAATCAGAATTGAAAGGCTGG + Intergenic
1149800928 17:59566525-59566547 AGGCAATAGAATTTTAGGGCTGG - Intronic
1151018688 17:70587025-70587047 AAGAAGCATGACTTTAGGGCAGG - Intergenic
1151286604 17:73116537-73116559 AATAATGAAAGTTTTAGGGCAGG + Intergenic
1151303221 17:73244264-73244286 AAAAACCAGTATTTTGGGGCCGG + Intronic
1152802594 17:82338381-82338403 AAGAATGGCATTTTTAGGGCTGG + Intergenic
1153199983 18:2638091-2638113 AAGAAACAGAAATTTAGCCCGGG + Intergenic
1153229575 18:2923122-2923144 AAGAAATACAATTTTAAGGCTGG + Intronic
1153668667 18:7389751-7389773 AAGAATGAGAATTTTAAAGGGGG + Intergenic
1154325199 18:13385647-13385669 AAAAATCAAAGCTTTAGGGCAGG + Intronic
1154972368 18:21423381-21423403 TAGAATCAGAGTTTAAGGGAAGG + Intronic
1155281562 18:24245911-24245933 AAGAATAAAAATTTAGGGGCTGG + Intronic
1155720420 18:29004287-29004309 AAGAATCTGAATCTGAGGTCAGG - Intergenic
1156631486 18:38974687-38974709 AAGAATCACAATTTTAGAAGTGG - Intergenic
1156875669 18:42007162-42007184 AAGAATATGATTTTTAAGGCCGG - Intronic
1157197270 18:45629640-45629662 AAGAATCAGAGTGTCAGCGCAGG - Intronic
1157483135 18:48068712-48068734 AAGAATCAGAACCTTTGGGCAGG + Intronic
1157717748 18:49900683-49900705 GAGAAACAGAATTTTAGAGTGGG - Intronic
1159414073 18:68121127-68121149 AAGAAGCATAATTTTAGGAGGGG - Intergenic
1159422650 18:68243221-68243243 AAGAATCAGTCTCTTAGGGTGGG + Intergenic
1161440485 19:4288763-4288785 CAGACTTAGAATTTTAGGGACGG - Intronic
1161929586 19:7328880-7328902 AAGAATCAGAATTTAAACACAGG - Intergenic
1163135624 19:15309038-15309060 AAAAATAAAAACTTTAGGGCCGG + Intronic
1164156232 19:22599200-22599222 AAGAGTGAGAAGTTTAGGTCTGG - Intergenic
1164212758 19:23114645-23114667 AAGAAAAACAACTTTAGGGCCGG - Intronic
1164702988 19:30298964-30298986 AATAATCTGCATTTTAGGCCTGG + Intronic
1164802156 19:31086269-31086291 AAGAGTCAGAAAGTTAGGCCAGG - Intergenic
1165611925 19:37162217-37162239 AAGAATCATACTTTTAGGCCGGG - Intronic
1165719394 19:38068322-38068344 AAGAATCTGATTTTTCGGCCGGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166574864 19:43827867-43827889 AAGGATGAGAATTTTAGATCTGG + Intronic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1167569371 19:50277237-50277259 AGGGATCAGAATTCTAAGGCGGG + Intronic
1202645536 1_KI270706v1_random:136395-136417 AAGAAATAGAATTTAAGGGCCGG - Intergenic
924997558 2:376800-376822 AAATATCAGATTTTTATGGCAGG + Intergenic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
925345266 2:3167671-3167693 AAGAACCAGACATTTAGGCCGGG + Intergenic
925619379 2:5776189-5776211 CTGAATCAGAATTTTGGGGGTGG - Intergenic
925919625 2:8629984-8630006 ATAAATCAGAATTTTATGACAGG - Intergenic
926622004 2:15055175-15055197 AAGCATCAATATTTTAGGGATGG + Intergenic
927051973 2:19338792-19338814 AAGAATCTGGATTTGAAGGCTGG + Intergenic
927301469 2:21520761-21520783 AATAATCAGAACTTTTTGGCTGG - Intergenic
927330343 2:21855269-21855291 AAGAATCTGAATTTCAGTCCAGG - Intergenic
927726032 2:25423953-25423975 TAGAATCCTAATTTTAGGCCAGG - Intronic
928736825 2:34300956-34300978 AAGAATTGGAAATTTAAGGCTGG + Intergenic
928743383 2:34382843-34382865 AAAAATCCTAATTTTATGGCCGG + Intergenic
929170305 2:38926031-38926053 GAGAATCAGAAATTGAGAGCAGG + Intronic
929432069 2:41895643-41895665 AAGAAACTGAAATTCAGGGCAGG + Intergenic
929523329 2:42675429-42675451 AAGAAAAAGAATTTTGAGGCTGG - Intronic
929693875 2:44097974-44097996 CACAAGCAGAATTATAGGGCTGG + Intergenic
929811994 2:45197823-45197845 GAGAATCTGAATTATAGGCCCGG + Intergenic
930729526 2:54714047-54714069 AAGAATCAGGATTCTAGAGCTGG - Intergenic
931528946 2:63190795-63190817 AAGAAGCAGAATTTTGGTGGGGG + Intronic
931663838 2:64595847-64595869 AAAGAATAGAATTTTAGGGCTGG + Intergenic
931805055 2:65796255-65796277 AAGAAACATGATTTTAGGGAGGG + Intergenic
932648977 2:73534655-73534677 AAGAATGAGAATTCTAGAGGAGG - Intronic
933762923 2:85685856-85685878 AAGAATCATAATTTTATGATTGG - Intronic
934507942 2:94909962-94909984 AAGAAATAGAATTTAAGGGCCGG - Intergenic
934687158 2:96329683-96329705 TAGAATCACAATTTTAGAGTTGG - Exonic
934692992 2:96376222-96376244 CAGAACCAGAATTTAAGGGCAGG + Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
936446921 2:112603402-112603424 AAGCCTCCGAATTTTAGGGGAGG - Intergenic
936938927 2:117863065-117863087 AAGAATCACTATTTTTGGCCAGG + Intergenic
937026738 2:118705204-118705226 ATGACTCAGAATTTCTGGGCAGG - Intergenic
937671248 2:124539472-124539494 CAGACTCAGAATTTTAAGGTGGG + Intronic
938659615 2:133472172-133472194 AACAAGCAGAATTTTAGGGCAGG - Intronic
939093507 2:137805759-137805781 AAGCCTCATAATCTTAGGGCTGG - Intergenic
940122910 2:150287586-150287608 AAGAAACAGAAGTTCATGGCTGG - Intergenic
942230555 2:173857691-173857713 AAAAATTAGAATTCTAGGCCAGG + Intergenic
942707091 2:178786473-178786495 GAAAATCAGAATTTTGGAGCTGG + Intronic
943571673 2:189581425-189581447 AAGAACCAGAATCAAAGGGCAGG + Intronic
943651809 2:190465694-190465716 AAAAAACAGAAGTTTATGGCCGG + Intronic
943702306 2:190999958-190999980 AAGAATCAAAATTTAGGCGCTGG - Intronic
943928296 2:193817536-193817558 AAGAAAAAGAATGTTAGTGCTGG - Intergenic
943928299 2:193817602-193817624 AAGAAAAAGAATGTTAGTGCTGG - Intergenic
944007843 2:194932728-194932750 ATGTAGCAGAATTTTATGGCTGG - Intergenic
944029271 2:195214278-195214300 CAGTATCAGCATTTTGGGGCTGG + Intergenic
944317859 2:198302723-198302745 TAAAATCACAAGTTTAGGGCTGG + Intronic
944435238 2:199681732-199681754 AGGAATCAGAATTTTACATCAGG + Intergenic
945414563 2:209555005-209555027 AAGTGTCAGAATTTTAGGGGAGG + Intronic
945960559 2:216129969-216129991 AAGAAACACACTTTTAGGCCAGG - Intronic
946240264 2:218349622-218349644 AAGAATAAGAAATTGAGGCCAGG - Intergenic
946535115 2:220619353-220619375 AAAAATCTGAAATTTAGGGGAGG - Intergenic
947576384 2:231278317-231278339 CAGAAGCACAATTTTAGGTCAGG - Intronic
947678234 2:232004875-232004897 AAAAATGAGAATTTTAGACCAGG - Intronic
947760638 2:232601229-232601251 AAGCACTAGATTTTTAGGGCAGG + Intergenic
1169487882 20:6048488-6048510 CAGAATCAGAATTTGAGCCCAGG - Intronic
1170521385 20:17189485-17189507 AAGAAAACTAATTTTAGGGCTGG + Intergenic
1170775606 20:19372267-19372289 AAGAAGCAGAAGTTGAGGGAAGG + Intronic
1170987995 20:21275647-21275669 AAAAAAAAGAATTTTATGGCCGG + Intergenic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1171895500 20:30755312-30755334 AAGAAATAGAATTTAAGGGCTGG - Intergenic
1171996234 20:31733815-31733837 CTGAAGCAGAATTTCAGGGCTGG - Intergenic
1172013303 20:31858852-31858874 CAGAATCAGACTTTCTGGGCAGG + Intronic
1172178927 20:32988883-32988905 AAGAATCAGTGCTTCAGGGCTGG - Intronic
1172456376 20:35077492-35077514 CTGAATCAGAATTTCAGGGGTGG + Intronic
1172542289 20:35728080-35728102 AAAAATAAGAATTGTAGGCCAGG - Intronic
1172887431 20:38240704-38240726 AAGAATGAGAATTTGAGCCCAGG + Exonic
1173207965 20:41009144-41009166 TAGAAACAGGATTTTACGGCCGG - Intergenic
1173618371 20:44417674-44417696 AAGAATCTGTATTTTCAGGCCGG + Intronic
1173775515 20:45703061-45703083 GAGAATCAGAATTTGAGGAAAGG + Intronic
1174230119 20:49039585-49039607 AAGAAGGAGAATTTAATGGCTGG + Intergenic
1174726138 20:52864117-52864139 AGGAATCTGGATGTTAGGGCAGG + Intergenic
1174820157 20:53719617-53719639 AAGAAACACAATTTTGGAGCTGG + Intergenic
1176606350 21:8836353-8836375 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1176988855 21:15469972-15469994 AAGGAGTAGAATTTTAGGTCAGG + Intergenic
1177213746 21:18103069-18103091 AAGAATATGCATTTTAGAGCAGG + Intronic
1177249671 21:18576624-18576646 AAGAACCAGAATGTTAAGTCTGG - Intergenic
1177880433 21:26688012-26688034 AAGAATCTGAACTTTTGGGCAGG + Intergenic
1178450228 21:32691640-32691662 AAGAATGACATTTTTAGTGCTGG - Intronic
1178696143 21:34793998-34794020 GAGAATAAATATTTTAGGGCTGG - Intronic
1178857180 21:36260009-36260031 AAGAACTAGAATTTTTTGGCCGG + Intronic
1179520697 21:41942565-41942587 AAGAAACAGACTCTTGGGGCAGG + Intronic
1179526055 21:41976531-41976553 AAAAATAATAATTTTACGGCTGG - Intergenic
1179637500 21:42722804-42722826 TAGAATCAGAATTATGGGTCAGG + Intronic
1179647014 21:42782251-42782273 CAGAATCAGAATCTCAGGGCTGG - Intergenic
1180356424 22:11846053-11846075 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1180381837 22:12146273-12146295 AAGAAATAGAATTTAAGGGCCGG - Intergenic
1180941564 22:19662651-19662673 AAAGATAAGAATTTTAGGCCAGG - Intergenic
1181879224 22:25964389-25964411 CAGAGTCAGAATTTGAGTGCGGG + Intronic
1182206588 22:28634213-28634235 AAGAAACAGAAATTTCTGGCCGG + Intronic
1182895439 22:33855585-33855607 AGGAATCAGAATTTCAGAGGTGG + Intronic
1182967026 22:34532021-34532043 AGGAAACAGAAGCTTAGGGCTGG - Intergenic
1183527976 22:38335541-38335563 AATAAAAAGAATTATAGGGCCGG + Intronic
1183770547 22:39921925-39921947 AAGAATAAGAAGTTTTGGGGAGG - Intronic
949740355 3:7226121-7226143 CAGAATATGAATTTTAGAGCAGG + Intronic
949761956 3:7480799-7480821 TAGAATCAGAATGTTAGCGGTGG - Intronic
950381155 3:12616493-12616515 AAAAATGAAAATTTTATGGCTGG - Intronic
950733186 3:14980456-14980478 AAGAGTAAGAATTTTAGGCTGGG - Intronic
950938082 3:16863402-16863424 CAGAAGCAGATTTTAAGGGCTGG + Intronic
951714192 3:25621657-25621679 ACGAATAAGAATTTTAGAGTAGG - Intronic
953233687 3:41087164-41087186 AAGAAGCAGAATATTAGAGGTGG - Intergenic
953671639 3:44967730-44967752 AAAAATCAGAATTTTAGAGCTGG + Intronic
955028651 3:55195264-55195286 AAGGCTTAGAATCTTAGGGCTGG - Intergenic
955873722 3:63467901-63467923 AAGAATCAGAATAATCAGGCTGG + Intronic
956825500 3:72994126-72994148 AAGAATTGGATTTTTAGGCCAGG + Intronic
957245258 3:77708478-77708500 AAGAAAAAGAATCCTAGGGCAGG + Intergenic
957286688 3:78225194-78225216 AAAAAGAAGAATTTTAGGGAAGG - Intergenic
957848657 3:85775929-85775951 AAGAAACATAATTTTAGTACAGG + Intronic
958474176 3:94559421-94559443 AAGACTCAGAATCTTTGGGGAGG + Intergenic
958649058 3:96913030-96913052 AAGAATGTGGATTTTAAGGCAGG + Intronic
958986589 3:100786492-100786514 AAGAATCAGTATTATAGTGAAGG + Intronic
959206952 3:103320701-103320723 TAGAATCAGAATTTTAGAGTTGG - Intergenic
959891945 3:111566847-111566869 AAAGAACAGAATTTTAGGGCAGG + Intronic
960031352 3:113058062-113058084 TAGAATCAGAATGTTGGAGCTGG + Intergenic
962044217 3:131738561-131738583 TAGAATTAGAATTTCAGGGTTGG - Intronic
962248242 3:133816238-133816260 TAGAATCAGAATTTCAGATCTGG - Intronic
962544658 3:136420492-136420514 AACAATGGGAATTTTAGGCCTGG - Intronic
962619003 3:137158164-137158186 AAGCAGCATAATTTTATGGCGGG - Intergenic
963594165 3:147304190-147304212 ATTAAACAGAATTTCAGGGCTGG - Intergenic
964514553 3:157493744-157493766 CAAATTCAGAATTTTAGGACTGG - Intronic
964526482 3:157620315-157620337 AATAATCAGAATTATATGTCTGG - Intronic
964636791 3:158866682-158866704 TAGAATCAGAATCTTCTGGCCGG + Intergenic
964867013 3:161273019-161273041 AAGAAAAAGAATTTATGGGCCGG - Intergenic
965255377 3:166400324-166400346 ATGAAAGAGAATTTTAGGCCTGG + Intergenic
965527810 3:169740131-169740153 AAGAATAAGGATTTTGGGGCTGG + Intergenic
965563924 3:170090663-170090685 TAGAATCATAGTTTTAGAGCTGG + Exonic
965689560 3:171341174-171341196 AAGAATCACATATTTTGGGCCGG + Intronic
966240300 3:177748427-177748449 AAGAATGAAAATTTTAGGCTGGG + Intergenic
966420659 3:179731461-179731483 AGGAATCAGAATTTCAGGGGAGG + Intronic
967248813 3:187516069-187516091 AAGACTCAGAAATTTGAGGCAGG + Intergenic
967268183 3:187710180-187710202 GAGAATCAGGAGTTGAGGGCAGG - Intronic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
968323074 3:197788588-197788610 AAGAATTACAATTTTTGGGCTGG - Intergenic
968419539 4:472354-472376 AGGAAAATGAATTTTAGGGCTGG - Intronic
971776455 4:30972492-30972514 TTGACTCTGAATTTTAGGGCTGG - Intronic
971836486 4:31770506-31770528 AAATAACAGAATTTAAGGGCAGG - Intergenic
972321379 4:37976547-37976569 GAGAAGCAGAATTCTTGGGCTGG + Intronic
973371759 4:49254812-49254834 AAGAAATAGAATTTAAGGGCCGG - Intergenic
973389246 4:49540504-49540526 AAGAAATAGAATTTAAGGGATGG + Intergenic
973752035 4:54030826-54030848 AAGAATTAGCATTTTAGGCCAGG - Intronic
974165687 4:58198647-58198669 AAGAAATAGAGTTTTAAGGCCGG - Intergenic
974858437 4:67489674-67489696 AATCATTAGAATTTTAGTGCTGG - Intronic
976099748 4:81548827-81548849 AAGAATCAGAAATTTAGGACTGG - Intronic
976597331 4:86906430-86906452 AAGAATCAGCTTTTTAGGCCAGG + Intronic
976704226 4:88005171-88005193 AAGATTCAGAATTTCAGGACTGG + Intergenic
976781732 4:88766810-88766832 AAGAGTCAGAATTTAAGAGTAGG + Intronic
977957354 4:103045543-103045565 CTGAATCAGATTTTTAGGGGTGG - Intronic
979649105 4:123108197-123108219 AATAAGTAGAATTTTAGTGCTGG + Intronic
980502182 4:133670359-133670381 AAAAATCATAATTCTAGGCCAGG - Intergenic
980828584 4:138102279-138102301 AAAAATATTAATTTTAGGGCTGG - Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981441241 4:144784874-144784896 TAAAATCAGAATATTAGAGCTGG - Intergenic
982175147 4:152699207-152699229 AAGGATAAGAAGTTTAAGGCAGG - Intronic
982570751 4:157048297-157048319 AAGAAACAGAATTTCAGAGAAGG - Intergenic
983217788 4:165018174-165018196 AAGAATAATAAATTTAGGGTGGG - Intergenic
983383851 4:167032152-167032174 TAAAATCAAGATTTTAGGGCAGG + Intronic
984664663 4:182412567-182412589 AAGAATAAGAAATTATGGGCTGG + Intronic
984925295 4:184801149-184801171 AAAAATCAGGATTGTAGAGCTGG - Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985285631 4:188333704-188333726 AAGCATCTAAATTTTAGAGCAGG + Intergenic
985857082 5:2436836-2436858 AAAAATCTGAAATTTAGGCCGGG - Intergenic
986001795 5:3636147-3636169 AAGAACCACAATTTTCGGCCAGG - Intergenic
986473224 5:8095834-8095856 TGGAATCAAAAATTTAGGGCCGG - Intergenic
986878495 5:12140216-12140238 AGGTAGCAGAATTTTAGAGCTGG + Intergenic
990058176 5:51611967-51611989 TAGAATTAACATTTTAGGGCTGG + Intergenic
990190328 5:53252731-53252753 ATTAATGAGAATTTTGGGGCTGG + Intergenic
990387606 5:55282080-55282102 AAGAACAAAAATTTTGGGGCTGG - Intronic
990574118 5:57108433-57108455 GAGATTAAGAATTTTAGGCCAGG + Intergenic
991639490 5:68738744-68738766 GAGATTCAGAATTTTACAGCAGG - Intergenic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992905436 5:81340653-81340675 AAGAATCATACTTTTGGGCCAGG - Intronic
992935348 5:81697611-81697633 AAGATTAAGAATATTTGGGCTGG - Intronic
993640836 5:90403574-90403596 AAAAATCACAATTTTTGGCCGGG + Intronic
993833231 5:92785498-92785520 AAGAATTAGTATTATAGGGCCGG - Intergenic
994054808 5:95403182-95403204 CTGAATCAAAATTTTAGGGTAGG - Intronic
994539240 5:101074187-101074209 AAGAAATAGAATTTTAAGGATGG + Intergenic
995516377 5:112958287-112958309 CAGAATCAGAATTTTGGGAAGGG - Intergenic
996228173 5:121028012-121028034 AAGAATCTGATTTTTAGTGTTGG + Intergenic
996512749 5:124335522-124335544 AAGACTCATAATCTTAGGGTTGG + Intergenic
996700086 5:126442259-126442281 AAGAAAAAGCATTTTAGGGAGGG - Intronic
997324415 5:133008242-133008264 AAGAATCAGAAAATCAGGCCGGG + Intronic
997740677 5:136250949-136250971 AAGAATCAGGTTTTTATAGCAGG - Intronic
997947100 5:138212609-138212631 AAGAATCAAAAGTTTTGGTCTGG - Intronic
997978854 5:138456717-138456739 AATAATTAAAATTTTAGGCCAGG + Intergenic
998117036 5:139546020-139546042 AAGAAATAGAATTTAAGGCCAGG - Intronic
998728553 5:145047137-145047159 AAGTATCAAAATTTTAGCACTGG + Intergenic
999040332 5:148402585-148402607 AATAATGAGAATTTTAGAGATGG + Intronic
999110690 5:149118469-149118491 TTAAATCAGAATTTTAGGGATGG - Intergenic
999553495 5:152716257-152716279 AAGTATGAGAAATTTTGGGCTGG + Intergenic
1000415297 5:160977966-160977988 TAGAATCAGAATTTTAATCCAGG + Intergenic
1000927084 5:167207134-167207156 AAGAATCTGAATTTTAGAACTGG - Intergenic
1001141651 5:169149384-169149406 CAGGAACAGAATTTTAGAGCTGG - Intronic
1002110832 5:176910792-176910814 AAGAAAAAGAAATTCAGGGCTGG + Intronic
1002287452 5:178173854-178173876 AAGAATCAGGTTTACAGGGCTGG - Intergenic
1002658078 5:180769480-180769502 TAGAATCAATATTTTAGGCCAGG + Intergenic
1002839680 6:894951-894973 AAGAGTCAGAATTTGAGCCCAGG - Intergenic
1003725699 6:8760512-8760534 GAGTCGCAGAATTTTAGGGCTGG - Intergenic
1004177064 6:13349251-13349273 AAGAATCACAGTTTTAGGCTGGG - Intergenic
1004612321 6:17255078-17255100 CAGAAGCAGATTTTTAGGGATGG - Intergenic
1004847157 6:19656876-19656898 AAGAAACATAATTCTAGGCCGGG - Intergenic
1005359142 6:25014118-25014140 GGGAAACAGAATTTTAGGCCTGG + Intronic
1005952530 6:30642344-30642366 AAGACTCAGATTTCTTGGGCTGG + Intronic
1006345313 6:33476476-33476498 AAAAATTAAAATTTTAGGCCGGG + Intergenic
1006669525 6:35721053-35721075 GACAATAAGAATTTTAGGGCCGG + Intronic
1007520515 6:42448616-42448638 AAGACACAGAATTTCAGAGCCGG + Intronic
1007680095 6:43628065-43628087 AAGAATCAGAAATTCTAGGCTGG + Intronic
1007912727 6:45532332-45532354 CAGGATCAGAATTTTAGAGCAGG + Intronic
1008047918 6:46870453-46870475 AAGAATAAGATTTTTAGGCCAGG - Intronic
1009354621 6:62727525-62727547 AAGATTCAGAAATTTAAGACAGG - Intergenic
1009767832 6:68104743-68104765 AAAAATCAGAGTATTAGAGCAGG - Intergenic
1009770718 6:68140088-68140110 GAGAAGCAGAATTTTAAGGATGG - Intergenic
1009854934 6:69249668-69249690 AACAATCCAAATTTTAGGGTAGG - Intronic
1010983757 6:82398857-82398879 AAAAAACAAAATTTTAGGTCAGG - Intergenic
1011213301 6:84977371-84977393 AAGAATAATAAATGTAGGGCTGG + Intergenic
1012205032 6:96450746-96450768 AAGTATCAGAAATTGAGGACGGG - Intergenic
1012387772 6:98701655-98701677 AAGAATGGGCATTTTAGGCCAGG - Intergenic
1012574420 6:100774659-100774681 AAAAATAAGAAAGTTAGGGCCGG - Intronic
1012592524 6:101000064-101000086 TAGAATTAGAATTCTAGAGCTGG + Intergenic
1013442373 6:110183371-110183393 AAGAATCAGAATTTTAGAGCTGG + Intronic
1014041203 6:116827966-116827988 TAGAATGAGAATTTTAGAGTTGG + Intronic
1014161489 6:118174453-118174475 AAGAATCTGAATTAGATGGCAGG + Intronic
1016129754 6:140452807-140452829 AATAATCAAAAAATTAGGGCAGG + Intergenic
1017199519 6:151737103-151737125 AAGAATAATAATTTTTGGTCTGG - Intronic
1017995294 6:159527003-159527025 AAGAATCAGAATGCCTGGGCAGG + Intergenic
1018528389 6:164737403-164737425 AAGAAAAAGAAGTTTAGGGCCGG - Intergenic
1019837478 7:3403227-3403249 AAGAAACAGAAGTATAGGTCAGG - Intronic
1020220190 7:6230499-6230521 AAGACACAGAATTTTAAGTCTGG - Intronic
1020875963 7:13693962-13693984 AAGAATCAGATTTGTAGGAGCGG - Intergenic
1021620125 7:22542973-22542995 CTGATTCAGAATTTTAGGGTGGG + Intronic
1022166042 7:27763469-27763491 AAGAATCAGACCTTGAGGCCGGG + Intronic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022220704 7:28310996-28311018 AAGAATAAATATTTTAGGCCAGG + Intronic
1023181711 7:37491490-37491512 AAAAAACATAATTTTAGGCCGGG - Intergenic
1023447635 7:40248304-40248326 AAGAATCAAAACTATAGGCCGGG - Intronic
1023749978 7:43362982-43363004 AAGAATTTGAATTCCAGGGCTGG - Intronic
1023753892 7:43397958-43397980 AAAAATTAAAAGTTTAGGGCTGG + Intronic
1023810711 7:43909429-43909451 AAAAACCAGTATTTTAGGCCAGG + Intronic
1023913548 7:44571810-44571832 AAGCATCAACATTTTAGTGCAGG + Intronic
1024288210 7:47778737-47778759 AAGAATTTGAATTTCAGGACTGG + Intronic
1024623324 7:51182576-51182598 CAGAAGCAGAATTTTGTGGCCGG - Intronic
1024909887 7:54435306-54435328 TAGAATCTGAAATTTAGGCCTGG + Intergenic
1024948364 7:54834040-54834062 CAGAGTCAGAATCCTAGGGCAGG - Intergenic
1026211753 7:68312156-68312178 AAAATTCAGAGTTTAAGGGCAGG - Intergenic
1026338623 7:69416387-69416409 AAGAATGATTATTTTAGGCCAGG - Intergenic
1026368100 7:69670277-69670299 AAATCACAGAATTTTAGGGCTGG - Intronic
1026567674 7:71503006-71503028 AGGAATCAGTATTTCAGGGTGGG - Intronic
1027298822 7:76808201-76808223 GAAAATCAGAATTTTAGTCCTGG - Intergenic
1027706824 7:81545036-81545058 AAGTATGAGAATTCTAGAGCTGG - Intergenic
1028144908 7:87310886-87310908 AGGAATCAGAAGGTTAGGGAAGG - Intergenic
1028560354 7:92168402-92168424 ACAAAGCAGAATTTCAGGGCTGG - Intronic
1028875075 7:95812897-95812919 AAGAATCAGAATTATCTGGATGG + Intronic
1029143770 7:98430997-98431019 AAGAATCTGCATTTTTGGTCAGG - Intergenic
1029792707 7:102862046-102862068 AAGAAACAGACGTTTTGGGCAGG + Intronic
1031054333 7:116977166-116977188 CAGAATCAGAATGTTAGAACAGG - Intronic
1031601221 7:123712919-123712941 CAGAATAAGAATTTTAGATCAGG + Intronic
1031691111 7:124788925-124788947 AAGAATCAGATTTTAAGTGAGGG + Intronic
1031741873 7:125442723-125442745 AAAGAACAGAAATTTAGGGCCGG - Intergenic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032211485 7:129918584-129918606 AAGAATTTGGATTTTGGGGCCGG - Intronic
1032653340 7:133902555-133902577 AACATAAAGAATTTTAGGGCCGG + Intronic
1033235682 7:139636181-139636203 AAGAATAAGTGTTTCAGGGCAGG - Intronic
1033661121 7:143403068-143403090 AATAATAAGTATTTGAGGGCCGG + Intronic
1034279832 7:149845445-149845467 AACAATCAGCATTTTATGGGTGG + Intronic
1034294784 7:149962684-149962706 AGGAATTGGAATTTTAGTGCTGG - Intergenic
1034811279 7:154134268-154134290 AGGAATTGGAATTTTAGTGCTGG + Intronic
1035106095 7:156442519-156442541 AATAATCAGGATTTTAAGGTTGG - Intergenic
1036475001 8:9085067-9085089 ATGAATCAGAAATTTGGGGGTGG + Intronic
1036597540 8:10227505-10227527 AAGAATCAGAATTCCAAGGTTGG - Intronic
1036980318 8:13462699-13462721 AAGAATAAGAATAGTAGGCCGGG - Intronic
1037360934 8:18072926-18072948 AAGAATCAGGAATTTATGGCGGG - Intronic
1037626344 8:20610522-20610544 AAGAACCAGCATTTGAGTGCAGG + Intergenic
1037839754 8:22235802-22235824 AAGAAAAAGTATTTTATGGCTGG + Intergenic
1038848186 8:31249158-31249180 CAGAATAAGAATTTTAGAGAGGG + Intergenic
1039194482 8:35015579-35015601 AAGAATAAGAATTGTAGTGGAGG - Intergenic
1039308705 8:36292813-36292835 AAGAATCAGGATGTATGGGCCGG + Intergenic
1039358325 8:36846049-36846071 GAGAATCAGTGTTTTAGAGCTGG + Intronic
1039528840 8:38241270-38241292 AAGAACCAGAAAGTTAGGGTAGG + Intronic
1039978516 8:42387161-42387183 TAGAATCAGAATTTTAGAGCTGG - Intergenic
1041168089 8:55111321-55111343 CAGAATCAGAACTTTAGACCTGG - Intronic
1041205764 8:55496418-55496440 CAGAATCAGAATTTAAGCCCAGG - Intronic
1041440115 8:57885833-57885855 ATGAATCAGAAGATTTGGGCAGG - Intergenic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1042143006 8:65698434-65698456 AAGAATCACGAATTTAAGGCTGG - Intronic
1043076670 8:75710051-75710073 AAAAATCAGACTGTTAGGGCAGG - Intergenic
1043450409 8:80360762-80360784 AAGAAACATGATTTAAGGGCTGG + Intergenic
1043531461 8:81156072-81156094 AAGAAACAGATTTAGAGGGCTGG + Intergenic
1045001341 8:97880876-97880898 AAGAATAAGATTTTCAGGCCGGG - Intronic
1045037399 8:98186320-98186342 ACCTATCAGAATTTAAGGGCTGG - Intergenic
1045075908 8:98567760-98567782 AAAAATTATAATTTTAGGCCAGG + Intronic
1045151149 8:99409581-99409603 AATAATCAAATTTTTAGGCCTGG + Intronic
1045894060 8:107193140-107193162 ATGAATCAGCATTTCAGGTCTGG + Intergenic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1046732450 8:117739973-117739995 GACAATGAGAATTATAGGGCTGG - Intergenic
1048207794 8:132429562-132429584 AAGAATGAGAGTTTTCTGGCTGG + Intronic
1049528152 8:143139731-143139753 ATGGATCAAGATTTTAGGGCCGG - Intergenic
1050119796 9:2296531-2296553 AAGCATCAGACTCTTGGGGCTGG + Intergenic
1051231163 9:14957164-14957186 AAGAGTCAGAGCTTTGGGGCTGG - Intergenic
1051244957 9:15100765-15100787 TTGAGTCAGAATTTTAGAGCTGG + Intergenic
1051988520 9:23121520-23121542 AAGAATCAGAATCTCATGGGTGG - Intergenic
1052238266 9:26239606-26239628 AAATGTCAGAATTTTAGGCCTGG - Intergenic
1052527546 9:29638151-29638173 AAGAACCTGAATTTTAAGGTTGG + Intergenic
1052604989 9:30687949-30687971 AATTATCAGAATTTTGGGGGAGG + Intergenic
1052613568 9:30808856-30808878 AACAAACAGTATTTTAGGCCAGG + Intergenic
1052718383 9:32145882-32145904 AAGGAACAGAATTTTATGGATGG + Intergenic
1053079079 9:35159667-35159689 AAGAATCCTAATTCTAGGCCAGG - Intergenic
1053586396 9:39463570-39463592 ATAAATCAGAATTTTTGGCCAGG - Intergenic
1054353146 9:64037464-64037486 AAGAAATAGAACTTAAGGGCTGG + Intergenic
1054406029 9:64763559-64763581 CAGGATCAGAATATTAAGGCTGG - Intergenic
1054439655 9:65249046-65249068 CAGGATCAGAATATTAAGGCTGG - Intergenic
1054490752 9:65772893-65772915 CAGGATCAGAATATTAAGGCTGG + Intergenic
1054579908 9:66901647-66901669 ATAAATCAGAATTTTTGGCCAGG + Intronic
1055159257 9:73105091-73105113 AAGAATTAGAAGGTTAGGCCTGG - Intergenic
1055382382 9:75722952-75722974 AAGAAACAGAGTTTTAGGAATGG + Intergenic
1055630124 9:78215412-78215434 ACGAATCTGCATTTTTGGGCAGG + Intergenic
1055822746 9:80287027-80287049 TAGAAACAGACTTTTAGGGCCGG - Intergenic
1055873393 9:80913602-80913624 AAGAAACAAAATTTTTGGTCCGG - Intergenic
1056947161 9:91007902-91007924 AAGAATCAGAAATGGAGGTCAGG + Intergenic
1057045838 9:91885667-91885689 AAAAATCAGAACCTTGGGGCAGG - Intronic
1057947632 9:99343626-99343648 AAGAGTCAGAATATGAGGCCGGG + Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058466481 9:105234048-105234070 TAGAATCAGAATTTAAATGCTGG + Intergenic
1058783677 9:108364984-108365006 AAGAAAAAGAAGTTTAGGCCGGG + Intergenic
1059008993 9:110436021-110436043 AAGATGCAGAAATTTAAGGCTGG - Intronic
1060108374 9:120889047-120889069 AGGAACCAGAATTTTAAGGTGGG + Intronic
1060628502 9:125135354-125135376 AAAAATCATAATTTTAGGCCAGG + Intronic
1060805807 9:126575644-126575666 AAGGAACAGAATTTTAAGGATGG - Intergenic
1061356726 9:130111168-130111190 AAGAATCTCACTTTTAGGCCAGG + Intronic
1203741483 Un_GL000218v1:6570-6592 AAGAAATAGAATTTAAGGGCTGG + Intergenic
1203701669 Un_KI270742v1:1152-1174 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1203553742 Un_KI270743v1:188188-188210 AAGAAATAGAATTTAAGGGCCGG + Intergenic
1185531872 X:826851-826873 AAGAATAAGAATTTGAATGCAGG + Intergenic
1187241260 X:17515392-17515414 TAGACTCAGAATTTCAGAGCTGG - Intronic
1187336570 X:18386929-18386951 AACAATCAGGAATTTGGGGCTGG + Intergenic
1188133135 X:26462457-26462479 AAAAATCAGAATTTTTGGGGGGG + Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189177045 X:38968042-38968064 TTGAAACAGAATTTTAGGGTTGG - Intergenic
1190488037 X:50949418-50949440 AAGAAGCAGAAATATAAGGCAGG - Intergenic
1190552753 X:51601779-51601801 TAGAAATAGAATTTGAGGGCAGG + Intergenic
1191226179 X:58046985-58047007 TAGAATCAGAATTTTAAGGATGG + Intergenic
1191610731 X:63109559-63109581 AAGAATCTGAGTTTGAAGGCTGG + Intergenic
1191991830 X:67046302-67046324 TTGAATCAGGATTTAAGGGCTGG + Intergenic
1192245838 X:69370765-69370787 TAGAATAAGAAATTTAGGCCGGG - Intergenic
1193109827 X:77717419-77717441 AAGAAAACGAATTTTAGGCCAGG + Intronic
1194050908 X:89067888-89067910 AAGAATATAAATTTTAGGCCAGG + Intergenic
1194724785 X:97382562-97382584 TAGAATCATAATTTTAAAGCAGG - Intronic
1195538818 X:106039193-106039215 CAGCATCAGAAGTCTAGGGCTGG - Intergenic
1197834915 X:130684203-130684225 GAGAATCATAACTTTAGAGCTGG + Intronic
1198023422 X:132681486-132681508 TATAATCAGAATTTAAGGGCTGG + Intronic
1198206297 X:134468316-134468338 AAGAATTAGTATTTGATGGCCGG + Intronic
1201155011 Y:11124023-11124045 AAGAAATAGAATTTAAGGGCTGG + Intergenic