ID: 925205282

View in Genome Browser
Species Human (GRCh38)
Location 2:2000612-2000634
Sequence CCACATGACCTGAGGACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 348}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925205274_925205282 -7 Left 925205274 2:2000596-2000618 CCCAATACAGCCGACTCCACATG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205275_925205282 -8 Left 925205275 2:2000597-2000619 CCAATACAGCCGACTCCACATGA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205268_925205282 10 Left 925205268 2:2000579-2000601 CCCCGCTCCTCTGCCCTCCCAAT 0: 1
1: 1
2: 3
3: 36
4: 547
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205273_925205282 -4 Left 925205273 2:2000593-2000615 CCTCCCAATACAGCCGACTCCAC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205272_925205282 -3 Left 925205272 2:2000592-2000614 CCCTCCCAATACAGCCGACTCCA 0: 1
1: 0
2: 1
3: 6
4: 169
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205270_925205282 8 Left 925205270 2:2000581-2000603 CCGCTCCTCTGCCCTCCCAATAC 0: 1
1: 0
2: 2
3: 80
4: 841
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205271_925205282 3 Left 925205271 2:2000586-2000608 CCTCTGCCCTCCCAATACAGCCG 0: 1
1: 0
2: 0
3: 5
4: 194
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205267_925205282 14 Left 925205267 2:2000575-2000597 CCTGCCCCGCTCCTCTGCCCTCC 0: 1
1: 4
2: 10
3: 231
4: 1677
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348
925205269_925205282 9 Left 925205269 2:2000580-2000602 CCCGCTCCTCTGCCCTCCCAATA 0: 1
1: 0
2: 3
3: 34
4: 489
Right 925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG 0: 1
1: 0
2: 1
3: 22
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925205282 Original CRISPR CCACATGACCTGAGGACAGG GGG Intronic
900232672 1:1568945-1568967 GCAGATCACCTGAGGTCAGGAGG + Intronic
902368646 1:15992461-15992483 CCACCTGCCCTGAGGACCTGGGG - Intergenic
903075972 1:20766713-20766735 GCAGATCACCTGAGGTCAGGAGG + Intronic
903693177 1:25188663-25188685 CAAGATCACCTGGGGACAGGAGG + Intergenic
903896611 1:26610056-26610078 GCAGATCACCTGAGGTCAGGAGG - Intergenic
905216138 1:36409202-36409224 GCAGATCACCTGAGGTCAGGAGG - Intergenic
906319362 1:44806862-44806884 ACACATGAGCAGGGGACAGGAGG + Intergenic
906437827 1:45811992-45812014 GCAGATCACCTGAGGTCAGGAGG - Intronic
910773892 1:90855890-90855912 GCAGATCACCTGAGGTCAGGAGG - Intergenic
912183609 1:107248529-107248551 ACAGAAGACCTGAGGACAAGTGG - Intronic
912488992 1:110050863-110050885 ACACATGATCTCAGGACAGCCGG - Intronic
912587977 1:110784157-110784179 GCAGATCACCTGAGGTCAGGAGG + Intergenic
913679186 1:121172536-121172558 GCAGATCACCTGAGGTCAGGAGG + Intronic
914618951 1:149388000-149388022 GCAGATCACCTGAGGTCAGGAGG - Intergenic
915148066 1:153807242-153807264 CCTCATGCCCTAAGGACAGGAGG - Exonic
916456918 1:164980470-164980492 CCACACTACCTGAGGCTAGGTGG + Intergenic
917084415 1:171291700-171291722 CCACCAGGCCTGAGGACTGGGGG + Intergenic
917284968 1:173413998-173414020 TCACATGACAGGAGGAAAGGGGG + Intergenic
917326694 1:173840454-173840476 GCAGATCACCTGAGGTCAGGAGG - Intronic
917586793 1:176435041-176435063 ACAAATGACCTCTGGACAGGAGG + Intergenic
917798252 1:178547546-178547568 GCAGATCACCTGAGGTCAGGAGG + Intronic
919031772 1:192251763-192251785 CCACAGTATCTGTGGACAGGCGG - Intergenic
920287124 1:204888388-204888410 TCCCATGACCTGAGCAGAGGAGG + Intronic
920399302 1:205667279-205667301 GCAAATTACCTGAGGTCAGGAGG + Intronic
921293970 1:213684575-213684597 TCACATGACCTGAGGGCATGGGG - Intergenic
922030145 1:221789878-221789900 CAACATGACCAGAGGAAATGTGG + Intergenic
922498675 1:226080843-226080865 CCAGATCACCTGAGCCCAGGAGG + Intergenic
924707398 1:246511263-246511285 GCACCTGCCCTGAGGACCGGGGG + Intergenic
1064250951 10:13706025-13706047 CCCCATGAGCTCTGGACAGGAGG - Intronic
1064689572 10:17901462-17901484 GCAGATCACCTGAGGTCAGGAGG + Intronic
1065615705 10:27520690-27520712 GCAGATTACCTGAGGTCAGGAGG + Intronic
1067784009 10:49229482-49229504 CCACCTGGGCTGGGGACAGGAGG + Intergenic
1068117651 10:52752035-52752057 CCACATGCCCTGTGGCCATGTGG + Intergenic
1068190862 10:53650854-53650876 TCACTTGACTTGAGGTCAGGAGG - Intergenic
1069544710 10:69319751-69319773 CAACAACACCTCAGGACAGGAGG - Intronic
1069871484 10:71535774-71535796 CCATGTGCCCTGAGGACATGAGG + Intronic
1070592592 10:77811418-77811440 GCCCCTGAGCTGAGGACAGGTGG - Intronic
1071247088 10:83776709-83776731 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1074491654 10:113944320-113944342 CCAGTTGACGTGGGGACAGGAGG + Intergenic
1074888832 10:117718018-117718040 CCACATGACCAGAAGCCTGGAGG + Intergenic
1075053727 10:119202801-119202823 GCAGATTACCTGAGGTCAGGAGG - Intergenic
1076265896 10:129109719-129109741 GCACAGGGCCTGGGGACAGGAGG + Intergenic
1077120602 11:906156-906178 GCAGATCACCTGAGGTCAGGAGG - Intronic
1078508360 11:11968149-11968171 CAACATGACCAGAGGACATGGGG + Intronic
1079367671 11:19823430-19823452 GCAGATCACCTGAGGTCAGGAGG - Intronic
1080394017 11:31873554-31873576 GCAGATCACCTGAGGTCAGGAGG + Intronic
1081167140 11:39820384-39820406 CCACAGGACCAGAGGCCTGGGGG - Intergenic
1082021398 11:47536532-47536554 GCAGATTACCTGAGGTCAGGTGG + Intronic
1082186685 11:49191049-49191071 GCAGATCACCTGAGGTCAGGAGG + Intronic
1082788112 11:57328473-57328495 CCCCACGGCCTCAGGACAGGAGG + Intronic
1083257283 11:61504451-61504473 GCAGATCACCTGAGGTCAGGGGG - Intergenic
1083908748 11:65692665-65692687 CCAGATGAACTGAGGTCAGGTGG + Intergenic
1084092982 11:66891282-66891304 GCAGATCACCTGAGGTCAGGAGG - Intronic
1084630348 11:70344238-70344260 CCACATGAGCTGAGCACATCTGG + Intronic
1084643898 11:70443209-70443231 CCACGTGATCTGAGCACACGTGG - Intergenic
1086679658 11:89654320-89654342 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1088924028 11:114282577-114282599 TCACATGGCCTGAGGCAAGGGGG - Intronic
1089873585 11:121698417-121698439 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1090802727 11:130183182-130183204 GCAGATCACCTGAGGTCAGGAGG - Intronic
1090977441 11:131689587-131689609 ACAGATGTTCTGAGGACAGGTGG + Intronic
1093682295 12:22016525-22016547 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1093928272 12:24930166-24930188 CCACAGGAGGTGAGGACAAGGGG - Intronic
1095848722 12:46776736-46776758 TCACTTGACCTGAGGAAATGGGG - Intronic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096512223 12:52137393-52137415 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1096595412 12:52692004-52692026 CCACAGGGCCTGAGGAGAGAAGG + Intronic
1096964271 12:55612612-55612634 CCACATGACATCAGGCCAAGAGG + Intergenic
1096998942 12:55859429-55859451 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1099381858 12:81964313-81964335 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1102283140 12:111634169-111634191 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1102320854 12:111933014-111933036 GCAGATCACCTGAGGTCAGGAGG + Intronic
1102943066 12:116961218-116961240 GCAGATCACCTGAGGTCAGGAGG - Intronic
1104795812 12:131516660-131516682 TCACATGATCATAGGACAGGGGG + Intergenic
1104913726 12:132253012-132253034 TCACATGATCACAGGACAGGGGG + Intronic
1104955295 12:132461941-132461963 CCCCAAGACCTGAGGGAAGGAGG + Intergenic
1105300019 13:19125015-19125037 CCAGCAGACCTGAGGACATGCGG - Intergenic
1105341626 13:19531700-19531722 ACAGATCACCTGAGGTCAGGAGG + Intronic
1105855574 13:24368928-24368950 TCACATGATCATAGGACAGGGGG + Intergenic
1106814252 13:33389180-33389202 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1108811715 13:54233170-54233192 TTAAATGACCTGAGTACAGGTGG + Intergenic
1109944101 13:69408706-69408728 CCGCATGACTCGTGGACAGGCGG - Intergenic
1110038004 13:70713158-70713180 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1112092736 13:96099166-96099188 GCAGATCACCTGAGGTCAGGAGG - Intronic
1112996785 13:105584367-105584389 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1113302123 13:109033768-109033790 CCCCAGGAGCTGAGGGCAGGAGG + Intronic
1114779299 14:25520418-25520440 CCACATAATCTGGGGAAAGGTGG - Intergenic
1115535184 14:34366334-34366356 GCAGATCACCTGAGGTCAGGAGG + Intronic
1115599573 14:34942669-34942691 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1116459219 14:45152252-45152274 GCAGATCACCTGAGGTCAGGAGG - Intronic
1117516512 14:56507342-56507364 TCACATGACCTAAAGAGAGGGGG - Intronic
1117866521 14:60155222-60155244 GCAGATCACCTGAGGTCAGGAGG + Intronic
1118226311 14:63902781-63902803 CCACCTCACTTGAGGCCAGGAGG - Intronic
1118705002 14:68472224-68472246 GGACATGACCAGAGGAGAGGTGG - Intronic
1118786978 14:69054281-69054303 CCAGATGCCTTGGGGACAGGAGG + Exonic
1119770636 14:77218826-77218848 CCAGACGACCTGAGTACAGGGGG + Exonic
1119851799 14:77871580-77871602 GCAGATCACCTGAGGCCAGGAGG - Intronic
1120963574 14:90147944-90147966 GCAGATCACCTGAGGTCAGGAGG + Intronic
1121032021 14:90666383-90666405 GCATATCACCTGAGGTCAGGAGG - Intronic
1121132811 14:91464096-91464118 GCAGATCACCTGAGGTCAGGAGG + Intronic
1121344183 14:93123007-93123029 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1122719149 14:103712533-103712555 CTCCAAGCCCTGAGGACAGGAGG + Intronic
1122793385 14:104193729-104193751 CCAGGTGACCTGGGCACAGGGGG + Intergenic
1122862124 14:104587416-104587438 CCCCAGGACATGTGGACAGGGGG - Intronic
1123709336 15:22975534-22975556 GCAGATCACCTGAGGTCAGGAGG + Intronic
1123787676 15:23689067-23689089 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1125005336 15:34810696-34810718 CCACAGGAGCTGAAGACTGGAGG + Intergenic
1125032572 15:35087234-35087256 CCACATGCTGTGAGGGCAGGTGG - Intergenic
1125477265 15:40055620-40055642 TCACATCCCCTGGGGACAGGTGG + Intergenic
1125693319 15:41614548-41614570 ACAAATCACCTGAGGTCAGGAGG - Intergenic
1126387603 15:48109964-48109986 CCACCTCACCTGAGGGCAAGAGG - Intergenic
1126499911 15:49334491-49334513 CCACAACACCTGAGTACAGCTGG + Intronic
1126603102 15:50448742-50448764 GCACATCACTTGAGGACAGGAGG - Intronic
1127763207 15:62161446-62161468 CCACATTAGCTGAGGTGAGGTGG - Intergenic
1128062669 15:64745036-64745058 GCAGATTACCTGAGGTCAGGTGG - Intronic
1128266927 15:66274894-66274916 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1129879089 15:78995511-78995533 GCAGATCACCTGAGGTCAGGAGG - Intronic
1131224550 15:90612972-90612994 ACAGATTACCTGAGGTCAGGAGG + Intronic
1131899156 15:97068841-97068863 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1132461149 16:55561-55583 CCACATAACCTGAAGGGAGGAGG - Intronic
1132567154 16:628804-628826 CCGCACGGCCTGAGGACAGGAGG - Exonic
1132788705 16:1673000-1673022 CCACATGTCCTCAGGACTGATGG + Intronic
1133513236 16:6481410-6481432 CCACATGTGCTGAGAACACGAGG + Intronic
1134089614 16:11384561-11384583 CCACTTGAGCTGAGGACATGGGG - Intronic
1134093131 16:11402087-11402109 CCAAATGCTCTGAGGACAGGCGG + Exonic
1134692308 16:16198767-16198789 ACAGATCACCTGAGGTCAGGAGG + Intronic
1134838736 16:17383970-17383992 GCAGATCACCTGAGGTCAGGAGG - Intronic
1135188981 16:20338983-20339005 GCAGATCACCTGAGGTCAGGAGG - Intronic
1136057746 16:27702940-27702962 GCAAATCACCTGAGGTCAGGAGG + Intronic
1138783850 16:59822212-59822234 GCAGATCACCTGAGGCCAGGAGG - Intergenic
1140394600 16:74615864-74615886 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1141616677 16:85213848-85213870 TCACAGGCCCTGAGGACAGAGGG + Intergenic
1143090779 17:4448141-4448163 GGGCATGACCTGGGGACAGGAGG - Exonic
1143482271 17:7234520-7234542 TCACGTGACATGAGGAGAGGTGG - Exonic
1144568116 17:16376956-16376978 CCAGATCACCTGAGGACAGGAGG - Intergenic
1145045128 17:19607953-19607975 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1145237947 17:21222318-21222340 CCACATGAGCTATGGAAAGGAGG - Intergenic
1145258486 17:21340836-21340858 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1146249293 17:31324289-31324311 GCAGATCACCTGAGGTCAGGAGG - Intronic
1146502216 17:33373900-33373922 GCAGATCACCTGAGGTCAGGAGG - Intronic
1146712088 17:35050746-35050768 GCAGATCACCTGAGGTCAGGAGG + Intronic
1147586038 17:41654509-41654531 CCCCAAGTCCTGAGGCCAGGGGG - Intergenic
1149651296 17:58278214-58278236 CCAGAGGTCCTGAGGGCAGGGGG - Intronic
1149702732 17:58668835-58668857 CCAAAGGCCCTGAGGACTGGGGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151468134 17:74301032-74301054 CCACATGACCTGGTGGGAGGAGG - Exonic
1151621667 17:75249258-75249280 CCTCCTTACCTGAGGTCAGGAGG - Intronic
1151750850 17:76036731-76036753 TCCCAGGGCCTGAGGACAGGAGG + Intergenic
1152513339 17:80805160-80805182 CCAGATGAGCTCAGGACAGTCGG + Intronic
1153856205 18:9150019-9150041 CGAGATCACCTGAGGTCAGGAGG - Intronic
1154497531 18:14973354-14973376 CCACAGGACCTGGGAACTGGTGG + Intergenic
1157286551 18:46381011-46381033 ACACATGGCCAGAGGACATGAGG - Intronic
1158768793 18:60489553-60489575 CCCCATGACATGGTGACAGGAGG + Intergenic
1159086944 18:63803769-63803791 CCACGTGGCCTGAGGCAAGGAGG - Intronic
1160306849 18:77747952-77747974 CCACATCAGGTGAGGTCAGGTGG + Intergenic
1161010179 19:1956079-1956101 CCCCATGACCTGGAGGCAGGAGG - Intronic
1161305530 19:3565348-3565370 GAACAGGACCTGAGGCCAGGAGG - Intronic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1161843865 19:6699018-6699040 GCAGATCACCTGAGGTCAGGAGG - Intronic
1161905662 19:7154697-7154719 GCAGATCACCTGAGGTCAGGAGG + Intronic
1162027973 19:7904870-7904892 CCACCTGACCTGGGGACACCTGG + Intronic
1162065002 19:8120072-8120094 CCACATGATCTGATGAGAGATGG - Intronic
1162672361 19:12267653-12267675 CCACATGAGGTGGGAACAGGAGG - Intronic
1162748673 19:12814398-12814420 GCAGATCACCTGAGGTCAGGAGG - Intronic
1162804594 19:13130758-13130780 GCAGATCACCTGAGGTCAGGAGG - Intronic
1164773790 19:30834630-30834652 TCACAGGTCCAGAGGACAGGAGG - Intergenic
1164895801 19:31876676-31876698 CAACATGCCCTGTGGACAGATGG + Intergenic
1166278462 19:41773089-41773111 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1166558135 19:43715180-43715202 CGGCATAACCTGAGGTCAGGAGG + Intergenic
1166726777 19:45033240-45033262 ACAGCTGAGCTGAGGACAGGAGG + Intronic
1167052099 19:47085540-47085562 CCACACAGCCTGACGACAGGTGG + Intronic
1167373644 19:49099815-49099837 GCAGATCACCTGAGGTCAGGAGG + Intronic
1167444702 19:49530718-49530740 GCAGATCACCTGAGGTCAGGAGG - Intronic
1168139368 19:54374994-54375016 CCACAGGACCTGGACACAGGAGG - Intergenic
1168158616 19:54493103-54493125 CCACAGGACCTGGACACAGGAGG + Intergenic
1168329300 19:55557429-55557451 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1168390011 19:55999438-55999460 GCAGATCACCTGAGGTCAGGGGG - Intergenic
925205282 2:2000612-2000634 CCACATGACCTGAGGACAGGGGG + Intronic
926721375 2:15963981-15964003 CAACATGCCCAGTGGACAGGAGG - Intergenic
926962835 2:18377806-18377828 CCAAATGACCTCAGGAAAGAAGG - Intergenic
927668015 2:25045555-25045577 GCAGATCACCTGAGGTCAGGAGG + Intronic
927994247 2:27471803-27471825 GCAGATCACCTGAGGCCAGGAGG + Intronic
928189179 2:29145904-29145926 GCAGATAACCTGAGGTCAGGAGG - Intronic
930706559 2:54510181-54510203 GCAGATCACCTGAGGTCAGGAGG - Intronic
931843285 2:66176990-66177012 CCAGATGCCCTGAAGACAGATGG + Intergenic
932468276 2:71937830-71937852 CATCATGACATGATGACAGGGGG - Intergenic
932822332 2:74912118-74912140 CCACATGGGCTGAAGACTGGAGG - Intergenic
935635412 2:105246170-105246192 GCAAATCACCTGAGGTCAGGAGG - Intergenic
938173755 2:129105401-129105423 GCAGATCACCTGAGGTCAGGAGG + Intergenic
938772480 2:134512231-134512253 GCAGATCACCTGAGGTCAGGAGG + Intronic
939388373 2:141532759-141532781 GCAGATCACCTGAGGTCAGGAGG + Intronic
939816381 2:146902079-146902101 GCAGATCACCTGAGGTCAGGAGG + Intergenic
940299580 2:152162882-152162904 GCAGATCACCTGAGGTCAGGAGG - Intronic
940777696 2:157902018-157902040 GCAGATCACCTGAGGTCAGGAGG + Intronic
940952530 2:159692380-159692402 ACAGATCACCTGAGGTCAGGAGG - Intergenic
941712908 2:168733378-168733400 CCACATCACCTGAGAACAGATGG + Intronic
944011971 2:194983804-194983826 CCACCCAACCTGAGGACAGCAGG - Intergenic
946228285 2:218276501-218276523 CCACATGACATGCCCACAGGTGG + Intronic
946240931 2:218355271-218355293 TCACATGATCACAGGACAGGGGG - Intergenic
946735561 2:222751111-222751133 GCAGATCACCTGAGGTCAGGAGG - Intergenic
947198336 2:227591834-227591856 GCAGATCACCTGAGGTCAGGTGG + Intergenic
947391570 2:229644569-229644591 GCAGATCACCTGAGGTCAGGAGG - Intronic
948195263 2:236090961-236090983 GCAGATCACCTGAGGTCAGGAGG - Intronic
948270970 2:236672876-236672898 CCCTGTGACCTGAGGACGGGAGG + Intergenic
948961181 2:241339167-241339189 GCACATCACCAGAGGTCAGGAGG + Intronic
1169660914 20:7977161-7977183 CCCCAAGACCTCAGGACAGAGGG + Intergenic
1170035467 20:11985008-11985030 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1170214107 20:13873886-13873908 ACACATGGCCTTTGGACAGGAGG + Intronic
1170577250 20:17673631-17673653 GCAGATCACCTGAGGTCAGGAGG - Intronic
1172883492 20:38216630-38216652 CTACATGAATTTAGGACAGGTGG + Intronic
1174096888 20:48096802-48096824 GCAGATGACCTGAGGTCAGGAGG + Intergenic
1174369269 20:50075585-50075607 ACACATGCCCTGAGGCCAGCGGG + Intergenic
1174784210 20:53417519-53417541 GCAGATTACCTGAGGTCAGGAGG - Intronic
1175094648 20:56531851-56531873 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1175417135 20:58809199-58809221 CCACACACCCTCAGGACAGGAGG + Intergenic
1175766471 20:61596074-61596096 CCTCATGCTCTGAGGACAGTTGG - Intronic
1175961353 20:62638192-62638214 AGACATGACCTGAGGACACCTGG - Intergenic
1176457939 21:6929224-6929246 CCACATGCCCTGGAGCCAGGAGG - Intergenic
1176836111 21:13794308-13794330 CCACATGCCCTGGAGCCAGGAGG - Intergenic
1177063771 21:16403552-16403574 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1177173239 21:17676797-17676819 TCACATGATCACAGGACAGGTGG + Intergenic
1179996817 21:44977954-44977976 CCACATGCCCTGGAGCCAGGAGG - Intergenic
1180622858 22:17173225-17173247 CCAGATCACTTGAGGTCAGGAGG + Intergenic
1180736206 22:18019468-18019490 GCAGATCACCTGAGGTCAGGAGG + Intronic
1181279598 22:21709732-21709754 CGTCATGACCTGAGGATGGGGGG + Intronic
1182230973 22:28837291-28837313 CCACAGAAGGTGAGGACAGGTGG + Intergenic
1184104801 22:42361285-42361307 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1184422466 22:44390016-44390038 CCACATGAGGTCAGGGCAGGAGG - Intergenic
950001432 3:9659666-9659688 GCAGATCACCTGAGGTCAGGAGG - Intronic
951016696 3:17740088-17740110 ACACATCACTTGAGGTCAGGAGG + Intronic
951893274 3:27586498-27586520 GCAGATCACCTGAGGTCAGGAGG - Intergenic
953663077 3:44905208-44905230 GCAGATCACCTGAGGTCAGGTGG - Intronic
953973762 3:47367328-47367350 GCAGATCACCTGAGGTCAGGAGG + Intergenic
954321821 3:49837371-49837393 TCACATCACCTGAGCCCAGGAGG + Intronic
954918267 3:54167028-54167050 CCCCAAGACCTGAAGACAAGTGG - Intronic
956363816 3:68477603-68477625 GCAGATGACTTGAGGACAGGAGG - Intronic
957350838 3:79019883-79019905 CAACATGGCTTTAGGACAGGAGG + Intronic
958699276 3:97567784-97567806 TCACAGGTCCTGAAGACAGGAGG + Intronic
959781219 3:110235672-110235694 GCAGATCACCTGAGGTCAGGAGG + Intergenic
960779079 3:121297527-121297549 GCAGATCACCTGAGGTCAGGAGG + Intronic
961501739 3:127341053-127341075 CCACATGGCTTCAGGATAGGGGG - Intergenic
963024812 3:140909110-140909132 ACAGATCACCTGAGGTCAGGAGG - Intergenic
964083319 3:152786722-152786744 CCACAAGGCCTGGGGACATGTGG + Intergenic
968834128 4:2950232-2950254 CCACAGGGCATGAGGACAGGCGG + Intronic
973897982 4:55435334-55435356 TCAGATGACCTGAGGAAAGGAGG - Exonic
975766806 4:77677093-77677115 CCAGAAGACTGGAGGACAGGAGG + Intergenic
976425437 4:84897606-84897628 GCAGATCACCTGAGGTCAGGAGG - Intronic
976712576 4:88087918-88087940 CCACAAGCCCTGAGGCCAGAAGG + Intergenic
978788991 4:112641174-112641196 GCAGATCACCTGAGGTCAGGTGG + Intronic
979286667 4:118933396-118933418 CCAGATGCCCTGAGGACTGAGGG + Intronic
980693833 4:136329968-136329990 GCAGATCACCTGAGGTCAGGAGG + Intergenic
980995926 4:139779634-139779656 ACACATGACCATAGGATAGGAGG + Intronic
982901151 4:161003874-161003896 CCGCAGGAGCTGAGAACAGGTGG - Intergenic
982918985 4:161250257-161250279 CCACAGGAACTGGGAACAGGTGG - Intergenic
984842717 4:184082953-184082975 GCAGATCACCTGAGGTCAGGAGG + Intergenic
986104118 5:4643645-4643667 CCAAATGTCCTCAGGACAGCTGG + Intergenic
986927773 5:12778990-12779012 GAACATGACCTGTGGACATGAGG - Intergenic
992535152 5:77693572-77693594 GCAGATCACCTGAGGTCAGGAGG + Intronic
992903056 5:81318105-81318127 GCAGATCACCTGAGGTCAGGAGG - Intergenic
993372197 5:87106490-87106512 GCAGATCACCTGAGGTCAGGAGG + Intergenic
997216188 5:132113071-132113093 CCTGATCACCTGAGGTCAGGAGG + Intergenic
997600975 5:135138154-135138176 CCATAGGTCCTGAGGACAGGTGG + Intronic
998147002 5:139734687-139734709 CCACATGACTTCAGGGCAAGGGG - Intergenic
999973482 5:156888361-156888383 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1000383262 5:160647907-160647929 CCTCATGGCCTGAGGACATGTGG + Intronic
1000383261 5:160647907-160647929 CCACATGTCCTCAGGCCATGAGG - Intronic
1000551397 5:162669888-162669910 TCACAAGAGCTTAGGACAGGTGG + Intergenic
1000598755 5:163246997-163247019 CAACATGAGCTAAGGCCAGGAGG + Intergenic
1001421796 5:171593252-171593274 CCACATTACCCTACGACAGGAGG + Intergenic
1002402509 5:178999037-178999059 CCTCATGAGCAGAGGACAAGAGG - Intergenic
1003461992 6:6337911-6337933 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1003718791 6:8677103-8677125 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1003836810 6:10080434-10080456 GCAGATCACCTGAGGTCAGGAGG + Intronic
1003899406 6:10640126-10640148 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1005916468 6:30356454-30356476 CCACATGTCCTGAGGGAAGGGGG - Intergenic
1006484447 6:34327140-34327162 TCACATGATCATAGGACAGGGGG + Intronic
1007036472 6:38678906-38678928 CCACATGATCTCAGGACAATGGG - Intronic
1007133217 6:39496251-39496273 CCACATGACCACAGGACGGATGG + Intronic
1007312189 6:40955274-40955296 CCACATGCCGTGATGGCAGGTGG + Intergenic
1007549213 6:42716175-42716197 CTACTTGACCTGAGGACTGTGGG - Intronic
1007904327 6:45444072-45444094 GCAGATCACCTGAGGTCAGGAGG - Intronic
1008013555 6:46492051-46492073 CCATCAGACCTGAGGACAGAAGG + Intergenic
1010970138 6:82254086-82254108 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1013015097 6:106153833-106153855 GCAGATTACCTGAGGTCAGGAGG - Intergenic
1013132209 6:107243902-107243924 GCAGATCACCTGAGGTCAGGAGG + Intronic
1013441994 6:110179934-110179956 CCACAGAACCTCAGGAAAGGGGG - Exonic
1014889361 6:126823777-126823799 GCAGATCACCTGAGGCCAGGAGG - Intergenic
1015308949 6:131743603-131743625 GCACATCACCTGAGGTCAGGAGG + Intronic
1015322132 6:131888084-131888106 GCAGATCACCTGAGGTCAGGAGG - Intronic
1017332694 6:153218080-153218102 CCACATGATCTTAGCACTGGGGG - Intergenic
1018443783 6:163836400-163836422 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1019128661 6:169858452-169858474 CAACATGATCTGAGGACAGACGG + Intergenic
1019525152 7:1477418-1477440 ACACATGGCCTGAGAGCAGGGGG + Intronic
1019817370 7:3211138-3211160 GCAGATAACCTGAGGTCAGGAGG - Intergenic
1020120887 7:5502604-5502626 GCAGATCACCTGAGGTCAGGAGG + Intronic
1020342882 7:7131544-7131566 TCACCTGACCTGAGGTGAGGAGG + Intergenic
1020685600 7:11289824-11289846 CCACCTGCCCTGAGGAGAAGAGG - Intergenic
1021724627 7:23537096-23537118 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1022752415 7:33243997-33244019 GCAGATCACCTGAGGTCAGGAGG + Intronic
1023788706 7:43734839-43734861 TCACATGATCATAGGACAGGGGG + Intergenic
1024273917 7:47662096-47662118 TCAGATCACCTGAGGTCAGGAGG + Intergenic
1026870145 7:73846088-73846110 TCACATGATCGTAGGACAGGGGG - Intergenic
1029092461 7:98058672-98058694 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1029318828 7:99739096-99739118 CCACATGCCCTGAACACAGCAGG - Intergenic
1029323763 7:99788086-99788108 CCACATGCCCTGAACACAGCAGG - Intergenic
1029555632 7:101267145-101267167 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1031125937 7:117773438-117773460 CCACCTGATCAGAGGACAGTGGG + Intronic
1032348162 7:131136071-131136093 CTTCATGAACTGAGGCCAGGAGG - Intronic
1033121628 7:138671570-138671592 GCAGATCACCTGAGGTCAGGAGG - Intronic
1033609523 7:142952601-142952623 CCACATGATCTTAGGGCTGGTGG - Exonic
1033943396 7:146683255-146683277 GCATATCACCTGAGGTCAGGAGG - Intronic
1034175861 7:149099288-149099310 GCACATGACCTGAGCAAAGTGGG - Intergenic
1035233096 7:157477964-157477986 TCACAGGACCTGAGCAGAGGAGG + Intergenic
1037311022 8:17556831-17556853 GCAGATCACCTGAGGTCAGGAGG - Intronic
1037918917 8:22790319-22790341 CCACATGGCCTGAGGATAATTGG - Intronic
1038702163 8:29858958-29858980 CACCATGAGCTGAGGACAGTGGG - Intergenic
1041265660 8:56061900-56061922 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1042458892 8:69039111-69039133 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1042916839 8:73883869-73883891 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1043546333 8:81320054-81320076 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1044688503 8:94852830-94852852 GCAGATCACCTGAGGTCAGGAGG - Intronic
1046305911 8:112366620-112366642 GCAAATCACCTGAGGTCAGGAGG - Intronic
1046962320 8:120124753-120124775 ACACAGCACCTGAGAACAGGAGG + Intronic
1047016980 8:120734217-120734239 GCAGATCACCTGAGGTCAGGAGG + Intronic
1047233262 8:123015751-123015773 CCCCATGACCTGACCACAGACGG + Intronic
1049137390 8:140915670-140915692 GCAGATCACCTGAGGTCAGGAGG + Intronic
1049215159 8:141404432-141404454 CCCCAGGACCCCAGGACAGGGGG - Intronic
1049358825 8:142202208-142202230 TCAAATGCCCTGAGGACAGGGGG - Intergenic
1049504697 8:142989837-142989859 CGACATGACATGTGCACAGGAGG + Intergenic
1049622015 8:143602701-143602723 CCATCTGAGCTGAGGACAGCTGG - Exonic
1049768283 8:144366032-144366054 TCACATGATCATAGGACAGGGGG - Intergenic
1050335489 9:4586016-4586038 GCACATTAACTGGGGACAGGTGG - Exonic
1051650269 9:19316504-19316526 TCACATTACCTGAAGACAGCTGG - Exonic
1052155698 9:25187394-25187416 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1053344833 9:37370692-37370714 GAACTAGACCTGAGGACAGGAGG + Intergenic
1053400025 9:37810684-37810706 ACAGATCACCTGAGGTCAGGAGG - Intronic
1055429392 9:76228228-76228250 GCAGATCACCTGAGGGCAGGAGG - Intronic
1055443120 9:76355926-76355948 GCAGATCACCTGAGGTCAGGAGG - Intronic
1055575294 9:77655198-77655220 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1056616089 9:88167195-88167217 GCAGATCACCTGAGGCCAGGAGG + Intergenic
1056740402 9:89249612-89249634 ACACATGACCTGAGGGCTGGTGG + Intergenic
1057200261 9:93135974-93135996 GCAGATCACCTGAGGTCAGGAGG - Intergenic
1057434909 9:95031142-95031164 CCACATGACATGAGCTCTGGTGG + Intronic
1059446245 9:114339870-114339892 GCAGATCACCTGAGGCCAGGAGG + Intronic
1059477738 9:114561384-114561406 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1060194887 9:121617107-121617129 GCAGATCACCTGAGGTCAGGAGG + Intronic
1060477744 9:123998890-123998912 ACTCAAAACCTGAGGACAGGGGG + Intergenic
1060892420 9:127197276-127197298 CCAGGTCAGCTGAGGACAGGTGG + Intronic
1061118537 9:128629332-128629354 CCCCAGGACCTGGGGGCAGGAGG - Intronic
1061389418 9:130309287-130309309 GCAGATCACCTGAGGTCAGGAGG + Intronic
1061685587 9:132274668-132274690 GCAGATCACCTGAGGTCAGGAGG - Intronic
1062082555 9:134631999-134632021 CAGCATGCCCTGAAGACAGGTGG + Intergenic
1062485296 9:136771502-136771524 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1187511603 X:19924670-19924692 CCACAGCACCTGAGGACTGCTGG + Intronic
1188126348 X:26373946-26373968 CCACATGAGCTGAAGAGAGCAGG + Intergenic
1189299958 X:39945233-39945255 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1190216239 X:48481304-48481326 ACACATGTCCTGAAGCCAGGGGG + Exonic
1191741956 X:64445889-64445911 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1191977600 X:66890876-66890898 GCAGATAACCTGAGGTCAGGAGG - Intergenic
1192107590 X:68330320-68330342 GCAGATCACCTGAGGTCAGGAGG - Intronic
1192333589 X:70199712-70199734 TCACGTGACCTGAGGACTGCAGG + Intronic
1192774522 X:74228443-74228465 GCAGATTACCTGAGGTCAGGAGG + Intergenic
1193534313 X:82694098-82694120 CCACTTGACTTGAGTACAGCTGG + Intergenic
1193818186 X:86127757-86127779 CCAAATGACCTGAAGACTGTAGG - Intergenic
1195050625 X:101093536-101093558 GCAGATCACCTGAGGTCAGGAGG - Intronic
1197204099 X:123774792-123774814 GCAGATCACCTGAGGTCAGGAGG + Intergenic
1198180975 X:134208886-134208908 GCAGATAACCTGAGGTCAGGAGG + Intergenic
1199460363 X:148077263-148077285 CCACATAGCATGAGGCCAGGTGG - Intergenic
1199502420 X:148522164-148522186 CCACCTGTCCTGACGACAAGAGG + Intronic
1199762097 X:150912792-150912814 CCACAGGTGATGAGGACAGGGGG - Intergenic
1200049914 X:153423229-153423251 CCACAAGGCCTGAGGGCAGGTGG + Intergenic
1200787398 Y:7272896-7272918 CCCCCTGACCTGAGGACTGAGGG + Intergenic
1201917925 Y:19202800-19202822 GCAGATCACCTGAGGTCAGGAGG - Intergenic