ID: 925208478

View in Genome Browser
Species Human (GRCh38)
Location 2:2026886-2026908
Sequence GCCCCAGGATAACCCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925208478_925208487 23 Left 925208478 2:2026886-2026908 CCTCTGTGGGGTTATCCTGGGGC 0: 1
1: 0
2: 1
3: 20
4: 160
Right 925208487 2:2026932-2026954 TGGGGCCCCGTCACGACCAGCGG 0: 1
1: 0
2: 0
3: 3
4: 53
925208478_925208486 5 Left 925208478 2:2026886-2026908 CCTCTGTGGGGTTATCCTGGGGC 0: 1
1: 0
2: 1
3: 20
4: 160
Right 925208486 2:2026914-2026936 GGTGCTTTTCTCTGAGTGTGGGG 0: 1
1: 0
2: 3
3: 25
4: 259
925208478_925208485 4 Left 925208478 2:2026886-2026908 CCTCTGTGGGGTTATCCTGGGGC 0: 1
1: 0
2: 1
3: 20
4: 160
Right 925208485 2:2026913-2026935 GGGTGCTTTTCTCTGAGTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 215
925208478_925208484 3 Left 925208478 2:2026886-2026908 CCTCTGTGGGGTTATCCTGGGGC 0: 1
1: 0
2: 1
3: 20
4: 160
Right 925208484 2:2026912-2026934 GGGGTGCTTTTCTCTGAGTGTGG 0: 1
1: 0
2: 0
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925208478 Original CRISPR GCCCCAGGATAACCCCACAG AGG (reversed) Intronic
900853818 1:5164750-5164772 GCCCCAGGATCACCCCTCACTGG + Intergenic
900869560 1:5292355-5292377 GTCCAAGGATGACCCCACACAGG + Intergenic
901441143 1:9279257-9279279 GCCCCAAGAAAACCACACCGAGG + Intergenic
914946335 1:152069985-152070007 GCCCCAGTATCCCCCCACACAGG - Intergenic
915334550 1:155133481-155133503 GCTGCAAGATAAGCCCACAGGGG - Exonic
915664686 1:157433912-157433934 GTCCCAAGATAACCCCACTCTGG + Intergenic
916724447 1:167510339-167510361 GCGCCAGCATATGCCCACAGGGG + Intronic
918145501 1:181752508-181752530 GCCCCAGGACAAAGCCACACAGG - Intronic
920339511 1:205267213-205267235 GCCCCAGTGGAAGCCCACAGAGG + Intronic
922745175 1:228039269-228039291 GCCCCAGGATGGGGCCACAGAGG + Intronic
1062787269 10:275661-275683 GCCCCAGTGTGACCCCGCAGTGG - Exonic
1063628713 10:7714795-7714817 GGTCCAGGAAATCCCCACAGAGG + Intronic
1064406988 10:15072757-15072779 GCCCCAAGATAACCCCCCTCTGG - Intronic
1064831212 10:19468671-19468693 GCCCCCAGCTAACCTCACAGAGG - Intronic
1065628820 10:27657322-27657344 CCACCAGTATGACCCCACAGAGG - Intergenic
1066978932 10:42393278-42393300 GCCCCAAGATAACCCCCTTGTGG - Intergenic
1069664378 10:70145233-70145255 GCCCCAGATTCTCCCCACAGGGG + Intronic
1070355558 10:75636778-75636800 GCCCCAGGTGGACTCCACAGAGG - Intronic
1070963610 10:80516182-80516204 GCTGCAGGAAAACACCACAGGGG - Exonic
1075747213 10:124736342-124736364 TCCCCAGGATCATGCCACAGAGG + Intronic
1076149089 10:128148878-128148900 GCTCCAAAATAACCCCACAGGGG + Intergenic
1077146590 11:1049230-1049252 ACCCCAGGGTGACCCCACGGCGG - Intergenic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1084176543 11:67425250-67425272 GCTCCAGGATTATACCACAGTGG + Exonic
1084311348 11:68317919-68317941 CCCCCAGGACAACCTCCCAGGGG - Intronic
1085317262 11:75553185-75553207 GCCCAAGGATTACCCCATAGAGG - Intergenic
1089607581 11:119650536-119650558 GCACCAGCCTAACTCCACAGGGG - Intronic
1090333884 11:125950347-125950369 GCCCCAGAACAGCCCCACAAAGG - Intergenic
1090802876 11:130184691-130184713 GCCCCAGCAGACTCCCACAGTGG + Intronic
1092319102 12:7452866-7452888 GCCCCAGCAAAACCCAACACTGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1102561794 12:113767439-113767461 GCACCAGGCTAGGCCCACAGGGG - Intergenic
1103362410 12:120361864-120361886 GCCCCAGGAGAAGCCGTCAGCGG - Intronic
1108080552 13:46730455-46730477 TCCCCAGGAGAGCCTCACAGTGG + Intronic
1108164572 13:47678616-47678638 GCCCCAGGATAAGAGTACAGAGG + Intergenic
1108253936 13:48592907-48592929 GCCACAGGAAAACCCCAAGGGGG - Intergenic
1113619013 13:111700577-111700599 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113624542 13:111785838-111785860 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1114305509 14:21419703-21419725 GCTACAGGACAACCCCCCAGGGG + Intronic
1122011571 14:98753372-98753394 GCTCCAGGAGAACCAGACAGGGG - Intergenic
1124347220 15:28930883-28930905 GCCCCAGGCTGGCCCCACACTGG + Intronic
1126541769 15:49831803-49831825 GGGCCAGGATAACACCTCAGGGG + Intergenic
1128300702 15:66564826-66564848 GCCCCAGGAGAAGCCTGCAGGGG + Exonic
1128457875 15:67843041-67843063 GCCCCAGGATCAGCCCCCAGGGG + Intergenic
1128548753 15:68584407-68584429 CTCCCAGAATCACCCCACAGTGG + Intronic
1130189749 15:81722408-81722430 GCCCCAGGAAAACAGTACAGTGG + Intergenic
1130906422 15:88243753-88243775 GCCCCAGGAAAACACCAGAAAGG + Intronic
1132375853 15:101327686-101327708 GCCCCAGCAAAACCCCACTGTGG - Intronic
1132836137 16:1954359-1954381 GCCCCAGGCTGAGCCCACAGAGG - Intronic
1133326500 16:4945247-4945269 GCCCACGGCTAACCCCTCAGTGG - Intronic
1134422479 16:14107311-14107333 GCCCCAGAATCACACCACAGAGG - Intronic
1136928236 16:34395148-34395170 GCACCAGAATAACCCCAGGGGGG + Intergenic
1136976338 16:35016656-35016678 GCACCAGAATAACCCCAGGGGGG - Intergenic
1137792593 16:51187409-51187431 GCCCCAGGAGAACCCCTCCCAGG - Intergenic
1140041160 16:71409191-71409213 GCCCCAAGATAACCCCCCTCTGG + Intergenic
1140954485 16:79849396-79849418 GCCCCAGCATCACCACAGAGAGG - Intergenic
1141131585 16:81441253-81441275 GGCCCGGGGTGACCCCACAGTGG + Intergenic
1141133075 16:81447945-81447967 GCCTCAGGGAAACCCCACAGGGG - Intronic
1141512255 16:84519974-84519996 GCCCCCGGACCAACCCACAGGGG + Intronic
1141717177 16:85733743-85733765 ACTCCAGGCTGACCCCACAGAGG - Intronic
1142053042 16:87972909-87972931 CCACCAGGAGAACCACACAGGGG - Intronic
1203012038 16_KI270728v1_random:303305-303327 GCCCCAGGATAAACACTAAGAGG + Intergenic
1203030373 16_KI270728v1_random:576464-576486 GCCCCAGGATAAACACTAAGAGG + Intergenic
1203041348 16_KI270728v1_random:757967-757989 GCCCCAGGATAAACACTAAGAGG - Intergenic
1144780841 17:17807649-17807671 GCCCCAGCACCACCCCACATGGG - Intronic
1145798684 17:27670230-27670252 GCCACAGGACAACCCCAGTGAGG + Intergenic
1146985294 17:37210641-37210663 CCCCCAGGATACCTCCAAAGAGG + Intronic
1147438022 17:40429931-40429953 GCCCCTGGGGAACCCCCCAGGGG + Intergenic
1148577037 17:48719498-48719520 CCCCCCGGATAACCCCGCCGAGG + Intergenic
1149997294 17:61411867-61411889 GCCCCAGGAGCACCCCACGCAGG - Exonic
1151361678 17:73592966-73592988 GTCACAGGATCACCCCAGAGTGG + Intronic
1152569727 17:81116382-81116404 GGCCCAGGAGAGCCCCACCGAGG - Exonic
1155452545 18:25977854-25977876 GCCCCCGCATAACGCCACAGAGG - Intergenic
1157238589 18:45987684-45987706 ACCCCAAGATAAGCCCACTGGGG + Intronic
1161112162 19:2476577-2476599 GCGCCAGGATCGCCTCACAGTGG + Exonic
1162337945 19:10073208-10073230 CCCCCAGGGTGACCCCACACTGG - Intergenic
1162620162 19:11836590-11836612 GCCCAAGGAGCACCCCAAAGAGG + Intergenic
1162624283 19:11871775-11871797 GCCCAAGGAGCACCCCAAAGAGG + Intronic
1162629442 19:11915480-11915502 GCCCAAGGAGCACCCCAAAGAGG + Intergenic
1163380919 19:16968091-16968113 GCCCCAGGACAAGCTCTCAGGGG + Intronic
1164442614 19:28291080-28291102 GCCCCACCATCACCCCACTGTGG + Intergenic
1165245414 19:34495762-34495784 GGCCCAGGCTCACCTCACAGTGG - Exonic
1166608766 19:44169834-44169856 GAACCAGGCTAACCACACAGTGG - Intronic
1167664628 19:50817051-50817073 CCCCCAAGGTCACCCCACAGAGG - Intergenic
1167665665 19:50821752-50821774 GCACCAGGATGCCCCCACACTGG + Exonic
925208478 2:2026886-2026908 GCCCCAGGATAACCCCACAGAGG - Intronic
926719182 2:15946241-15946263 GTCCCAGCAGAACCCCACACTGG - Exonic
934653321 2:96104437-96104459 GCCCCAGGCTGCCCCCTCAGGGG - Intergenic
936288734 2:111201301-111201323 GCACCAGGGTGACCCCTCAGTGG - Intergenic
939068217 2:137508988-137509010 GCCCCAGGACGACCTCATAGTGG - Intronic
940246243 2:151619926-151619948 TCCACAGAATAACCCCACAATGG + Intronic
942439637 2:176019359-176019381 ATCTCAGGCTAACCCCACAGAGG - Intergenic
1168841288 20:911621-911643 GCCCCAGGAGAGATCCACAGAGG + Intronic
1168976337 20:1968824-1968846 AGCCCAGGAGAAACCCACAGGGG + Intergenic
1169190850 20:3658478-3658500 GCCTCAGCTTGACCCCACAGGGG + Intergenic
1172726281 20:37044637-37044659 GCCACAGAATAAGGCCACAGTGG - Intronic
1172785578 20:37466254-37466276 GCCTCAGCCTCACCCCACAGGGG - Intergenic
1173576677 20:44116427-44116449 GGCCCAGGATCACCCAACAGTGG - Intronic
1173667880 20:44775570-44775592 CCCCCAGAGTAACCCCACAGCGG + Intronic
1173750262 20:45470525-45470547 GCCCAATGGTAACCCCACGGCGG + Exonic
1174133048 20:48359484-48359506 GCCCCAGGAGGACGCCACACAGG - Intergenic
1174163245 20:48566388-48566410 GACCCCGGAGAAACCCACAGAGG - Intergenic
1175083540 20:56440859-56440881 GCCACAGTAAAACCCCCCAGGGG + Intronic
1175409152 20:58754597-58754619 GCTCCAAGATAAAACCACAGTGG - Intergenic
1175494863 20:59406840-59406862 GCCTCAGTGTAAACCCACAGGGG + Intergenic
1176258793 20:64168002-64168024 GCTCCAGGACAGCCCCACTGGGG + Intronic
1176964190 21:15193532-15193554 GCACCAAGATAGTCCCACAGCGG - Intergenic
1179980772 21:44894611-44894633 GCCACAGGAAACCCCCACAGTGG - Intronic
1180183099 21:46126687-46126709 GCCCCAGGATGGCAGCACAGGGG + Intronic
1180980286 22:19875232-19875254 GTCCCAGGAAAAACCCTCAGTGG + Intergenic
1181403382 22:22665400-22665422 GCCCCAGGCTAAGCCCCCACAGG + Intergenic
1181408391 22:22701385-22701407 GCCCCAGGTTAAGCCCCCACAGG + Intergenic
1181413704 22:22744867-22744889 GCCCCAGGCTAAGCCCCCACAGG + Intronic
1181456077 22:23060954-23060976 GCCCCAAGATAAACACGCAGGGG + Intronic
1182047668 22:27288522-27288544 GCCCCAGAAGAAGCGCACAGAGG - Intergenic
1182878262 22:33711112-33711134 GCTCCAGCTTAATCCCACAGAGG + Intronic
1183829164 22:40408875-40408897 CCCACAGGCTAACCCCAGAGAGG - Intronic
1184213974 22:43054121-43054143 GCCCCACCATATCCCGACAGGGG - Intronic
950110069 3:10413128-10413150 GCACCAGGCTAGGCCCACAGTGG - Intronic
959541089 3:107539514-107539536 GGCCCAGGCTAACCCCACCTGGG + Intronic
964054640 3:152438421-152438443 GACTCAGGGTAATCCCACAGAGG + Intronic
965466616 3:169037581-169037603 GTGCCAGGATAACTCCTCAGAGG - Intergenic
966411747 3:179652806-179652828 GCCCCGGGAAAACACCACGGAGG - Exonic
968747432 4:2367646-2367668 GGGCCAAGAGAACCCCACAGTGG + Intronic
977210044 4:94208028-94208050 TCCCCAGTATAACCCCCTAGCGG - Intronic
983833611 4:172362484-172362506 GCCCAAGGAAAAGCCCATAGAGG - Intronic
985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG + Intergenic
992484643 5:77182531-77182553 GCCCCACACTAACCCCTCAGTGG + Intergenic
993005835 5:82427204-82427226 GCCCCACAATAATCCCACAGAGG + Intergenic
993991209 5:94660682-94660704 GCCCTGGGACAACCCCCCAGTGG + Intronic
995028002 5:107446907-107446929 GTCCCAGAATTACCTCACAGAGG - Intronic
996874740 5:128228259-128228281 GGCCCAGGCTAACCCCACCCTGG + Intergenic
998251604 5:140557311-140557333 GCCCCAGTATAAGCTAACAGTGG - Intronic
1001700723 5:173704958-173704980 CCGCCAGGATAACCCCAGCGTGG - Intergenic
1002173077 5:177386063-177386085 GCTCCAGGACCTCCCCACAGGGG - Exonic
1003409351 6:5849589-5849611 ACCCCAGGATAACTCAAAAGTGG - Intergenic
1005831578 6:29675329-29675351 GGCCCAGGATAACCCCTGAAAGG - Intronic
1007660019 6:43478210-43478232 GCCCCAGTCCAACCCCAGAGCGG + Exonic
1007779435 6:44244314-44244336 TCCCCAGGATCTCCACACAGTGG + Intergenic
1012991046 6:105926238-105926260 CCCCCAGGATATCCCCAAAATGG - Intergenic
1013560180 6:111295851-111295873 GCCCCCTGATTACCCGACAGAGG - Intergenic
1019288984 7:240821-240843 GCTCCAGGAAAGCCCCACAGAGG + Intronic
1019350000 7:550142-550164 CCCCCAGGAGAAGCCCACAGAGG + Exonic
1019579816 7:1755955-1755977 GCCCGAGGAAAACCCTCCAGAGG + Intergenic
1022173248 7:27849532-27849554 GCCCCAGGTTCCCACCACAGTGG - Intronic
1023347804 7:39289204-39289226 GCCCCAGCATTACCCAACACAGG + Intronic
1023962130 7:44935668-44935690 CGCCAAGGATACCCCCACAGCGG - Intergenic
1025149896 7:56539794-56539816 GCCTCAGGATAAGCCCGAAGGGG + Intergenic
1025529097 7:61854434-61854456 GCCCCAGGATAAACACTAAGAGG - Intergenic
1025529118 7:61854701-61854723 GCCCCAGGATAAACACTAAGAGG - Intergenic
1026235351 7:68522069-68522091 GCACCAAGATCACCCCACATGGG + Intergenic
1026299272 7:69083044-69083066 GCCTCTGGATAAAGCCACAGTGG + Intergenic
1034143846 7:148850755-148850777 GCCCCCCGCCAACCCCACAGCGG + Intronic
1034163312 7:149007813-149007835 GGCCCAGGCCAAACCCACAGTGG + Intronic
1035299269 7:157886813-157886835 GCCCCAGGATAGACCCGCTGTGG - Intronic
1036679895 8:10864332-10864354 GCCCCAGGATAAGGCTAGAGAGG - Intergenic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1038441640 8:27574735-27574757 GCCCCTAGATAAGCCCACATAGG - Intergenic
1039435470 8:37556637-37556659 CCCCCAGGATCACCCCACACTGG + Intergenic
1040618635 8:49064559-49064581 CCCCCAGGACAAGCCCACCGAGG + Intronic
1049312098 8:141938676-141938698 GCCCTGGGATGACCACACAGGGG + Intergenic
1049808607 8:144553009-144553031 GCCCCATGCCAGCCCCACAGGGG - Intronic
1053344386 9:37367446-37367468 GACCCAGGAAAACTTCACAGAGG + Intergenic
1055086185 9:72316239-72316261 GCTCCAGTAAAACCCCACATGGG - Intergenic
1057275797 9:93675469-93675491 GCCCCATGCAAACCCCACTGTGG + Intronic
1058666123 9:107317605-107317627 GACCCAGGATAATTACACAGAGG + Intronic
1059367854 9:113800616-113800638 GCCCCAGGCAAATCCCAAAGAGG + Intergenic
1060983275 9:127805800-127805822 GCCCCAGGGCAAAGCCACAGTGG - Intronic
1062320933 9:135990255-135990277 GCCCCAGGCCAGGCCCACAGCGG - Intergenic
1186107879 X:6226599-6226621 GGCCCAGGAGAACCCCGCCGAGG + Intronic
1187118028 X:16373501-16373523 GCCCCAAGATAACCCCTCTCTGG - Intergenic
1188977070 X:36688718-36688740 GCCCATGGATGACCCCAGAGGGG - Intergenic
1190096149 X:47482768-47482790 GCCACTGGAAAATCCCACAGGGG - Exonic
1192572792 X:72220564-72220586 GCCCCAAGATAACCCCCCTCTGG + Intronic
1192574262 X:72230283-72230305 GCCCCAAGATAACCCCCCTCTGG + Intronic
1198855433 X:141010681-141010703 GCCCCAAGATAACCCCACCCTGG + Intergenic
1198907262 X:141576687-141576709 GCCCCAAGATAACCCCACCCTGG - Intergenic
1198909529 X:141597714-141597736 GCCCCAAGATAACCCCACCCTGG + Intronic
1198917557 X:141690431-141690453 GCCCCAAGATAACCCCACCCTGG - Intronic
1201635029 Y:16113116-16113138 GCCCCAAGATAAACCCATACTGG - Intergenic
1201636403 Y:16127816-16127838 GCCCCAAGAGAACCCCACTCTGG + Intergenic