ID: 925211891

View in Genome Browser
Species Human (GRCh38)
Location 2:2056447-2056469
Sequence GCAGCATCATATACCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925211891 Original CRISPR GCAGCATCATATACCCTGCA AGG (reversed) Intronic
900993777 1:6109597-6109619 GCAGCCTCAGTTTCCCTGCAGGG + Intronic
902400983 1:16156526-16156548 GCAGCTTGATATACTCTTCAAGG - Intergenic
911764397 1:101656646-101656668 CCTTCATCATACACCCTGCAAGG - Intergenic
915001685 1:152600182-152600204 GCATCATCGTGTACACTGCACGG + Intronic
918544150 1:185663551-185663573 CCAGCATCATCTACCCCACAGGG - Intergenic
921801301 1:219405762-219405784 GCAGCATCAAAGACCTTCCAAGG + Intergenic
922808715 1:228404019-228404041 GCAGCACAACATACCCAGCATGG + Intronic
1063522425 10:6752942-6752964 GCAGCATCGTCTGCCCTGCTTGG + Intergenic
1063546034 10:6982682-6982704 GCAGCAACATATATCCTAAAAGG - Intergenic
1068597633 10:58920215-58920237 GCAGCATCACAAATCCAGCAAGG + Intergenic
1070598453 10:77849229-77849251 ACAGCACCATTTACCCTGCAAGG + Intronic
1073157876 10:101362308-101362330 GCAAAATCAGATACCCTGAAAGG - Intronic
1073997540 10:109333068-109333090 GAAGCATTATAAACCCTGCAAGG + Intergenic
1077311825 11:1892176-1892198 GCAGCATCAAGCATCCTGCATGG - Exonic
1083224960 11:61279161-61279183 ACACCACCATGTACCCTGCAGGG + Intronic
1090411740 11:126513922-126513944 TCAGCCTCAGATACCCTTCATGG + Intronic
1100794244 12:98163830-98163852 GCTTCATCTTATTCCCTGCATGG - Intergenic
1108024781 13:46166383-46166405 GCTGAATCATATAACCTGCCAGG + Intronic
1111745148 13:92259009-92259031 GCATCTTCATATACCATTCAAGG + Intronic
1113264403 13:108601585-108601607 GCCTCCTCATATACCCTGCATGG - Intronic
1119771539 14:77223144-77223166 GCAGCAACATCTACCTTGCAAGG + Intronic
1121515316 14:94545706-94545728 GCAGCACCATAGAAACTGCAAGG - Intergenic
1122064887 14:99165908-99165930 GCAGTATCACAGACCCTGCTGGG - Intergenic
1122273708 14:100580367-100580389 ACACCTTCATATACACTGCAAGG + Intronic
1128777706 15:70336244-70336266 ACGGCATCAAATCCCCTGCATGG + Intergenic
1136640186 16:31557526-31557548 GCTGCATCATGTTCTCTGCATGG - Intergenic
1138345968 16:56320393-56320415 GCACCATCATTTTCTCTGCAAGG - Intronic
1139224662 16:65222536-65222558 GCAGAATCAGAGACCCTTCAGGG + Intergenic
1147132533 17:38417929-38417951 AAAGCAGCAAATACCCTGCAGGG + Intergenic
1149596271 17:57866565-57866587 GCCTCATCCTCTACCCTGCAGGG + Intronic
1149896935 17:60435635-60435657 GCAGCAGCATATAGGGTGCAGGG + Intergenic
1150126665 17:62640365-62640387 GCAGCACCAAATACCATGCCTGG - Intronic
1151399270 17:73844969-73844991 GCAGCATCCTATCTCCTGGAGGG + Intergenic
1151574336 17:74944199-74944221 GCTGCATCCCATACCCTACATGG + Intronic
1157024250 18:43823937-43823959 ACAGCATTATATTCCCTGGAAGG - Intergenic
1157789645 18:50520290-50520312 GGAGCAGCTTATATCCTGCATGG - Intergenic
1160086259 18:75780092-75780114 GAATCATTATATACCTTGCAAGG - Intergenic
925211891 2:2056447-2056469 GCAGCATCATATACCCTGCAAGG - Intronic
925349899 2:3193621-3193643 GCTGCATCATCTCCACTGCACGG + Intronic
928051347 2:27999392-27999414 GAAGCATCATATACCAAGGATGG + Intronic
928283904 2:29972408-29972430 GCAGCATCAGATATACAGCAAGG + Intergenic
933739840 2:85524835-85524857 GCAGCACAGTGTACCCTGCAAGG + Intergenic
937847804 2:126601009-126601031 ACAGCATCATAGCACCTGCAGGG + Intergenic
937858777 2:126692171-126692193 GCTGGATCCTATACCCTGCCTGG + Intronic
937969594 2:127538953-127538975 GTAGCATCACTTACCTTGCAGGG + Intronic
938798088 2:134735476-134735498 GAAGCATGATATGCCTTGCAGGG + Intergenic
939019083 2:136937582-136937604 GCACCATTAAATACTCTGCAAGG - Intronic
939956979 2:148535377-148535399 GAAGCTTCATATACCTTGCAGGG + Intergenic
1175373811 20:58510993-58511015 GCAGCATCTGACTCCCTGCAGGG + Intronic
1183928177 22:41220726-41220748 GCAGCACCCGATACCCTGAAAGG - Exonic
950501992 3:13370428-13370450 CCAGCATCATACAGCCAGCAAGG + Intronic
953790405 3:45943022-45943044 GCAGGATAATATCCACTGCAGGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
956846862 3:73191927-73191949 CCAGGATCATATACCCTGCCTGG + Intergenic
962988197 3:140555289-140555311 GCAAAAACATATATCCTGCAGGG + Intronic
966674603 3:182571975-182571997 GCAGCACCATCTCCCCTGCCTGG + Intergenic
971030025 4:22625832-22625854 GCAGTCTCATATACCTTGCCAGG + Intergenic
974585196 4:63864952-63864974 GCAGCTTCATGTATCCTGTAGGG + Intergenic
978648639 4:110972862-110972884 GCAGCAATATAGACCCAGCATGG - Intergenic
979140229 4:117162901-117162923 ACCCCATCATACACCCTGCAAGG + Intergenic
980519918 4:133918067-133918089 GCAACATTATATATCCTACAAGG - Intergenic
985876921 5:2606961-2606983 GCAGCACCAGGGACCCTGCAGGG + Intergenic
985889494 5:2704868-2704890 GCAGCACTGTCTACCCTGCATGG - Intergenic
988548320 5:32177542-32177564 GCAGCAGCACCTAACCTGCAGGG - Intergenic
993537160 5:89100901-89100923 GCTGCATTATATACTCTTCATGG + Intergenic
993956720 5:94243334-94243356 CCAGGATGTTATACCCTGCAAGG - Intronic
995188666 5:109298020-109298042 GAAGCATCATGAACCCTGCACGG - Intergenic
1001760558 5:174204604-174204626 GCAGCAACACCTGCCCTGCAGGG - Intronic
1001869253 5:175136320-175136342 CTAGCATCATATTCTCTGCAGGG - Intergenic
1003054887 6:2809328-2809350 GCAGCATCATAAACTCTGATTGG - Intergenic
1003122478 6:3329535-3329557 GCCTCATCCCATACCCTGCATGG - Intronic
1003900927 6:10654701-10654723 GCAGAATCAGAAACTCTGCAGGG + Intergenic
1007351009 6:41273470-41273492 CCAGGATCAGACACCCTGCAAGG + Intronic
1007466568 6:42056250-42056272 GCAGCATCATTTGCCCTTCTGGG - Intronic
1012341690 6:98133447-98133469 GCATCCTCAGGTACCCTGCAGGG + Intergenic
1013502496 6:110766612-110766634 GCAGCATCATTGACCCTGCAGGG + Intronic
1015348828 6:132192947-132192969 GCAGCCACATCTACCCTGGAGGG - Intergenic
1016157141 6:140824543-140824565 TCAGCATCACATTTCCTGCAAGG + Intergenic
1018620469 6:165725489-165725511 ACCCCATCATACACCCTGCAAGG + Intronic
1023602370 7:41892543-41892565 GCAGCAGCAGATGGCCTGCAGGG - Intergenic
1029707523 7:102283589-102283611 CAAGCCTCATATACTCTGCAGGG - Intronic
1031275026 7:119710662-119710684 TTAGCATCATAGACCCTACATGG - Intergenic
1034222708 7:149459046-149459068 CCAGCATTATATACCATTCAAGG + Intronic
1035551634 8:532262-532284 CCAGCATCCTTCACCCTGCAAGG - Intronic
1037934318 8:22904376-22904398 GCACCAGCATTAACCCTGCAGGG + Intronic
1038062965 8:23932432-23932454 CAAGCATCCTATACCCAGCATGG + Intergenic
1041783564 8:61606039-61606061 GCAACAACACATACCCTGCTGGG + Intronic
1044571913 8:93729092-93729114 GAAGCATCAGATACACTGAAAGG - Exonic
1045141307 8:99286662-99286684 TCAGAATCAGATAACCTGCAAGG + Intronic
1047621968 8:126617107-126617129 GAAGCAGCTTGTACCCTGCAAGG + Intergenic
1047791557 8:128208964-128208986 GCAGCCTCATCTTCCATGCAAGG + Intergenic
1048114264 8:131504009-131504031 GCATCATCATATCCCCTACCTGG + Intergenic
1048336695 8:133507844-133507866 CCAGCAGCATCTACTCTGCAGGG - Intronic
1049211379 8:141387937-141387959 GCAGCAGCTAATAACCTGCATGG + Intergenic
1057113092 9:92492857-92492879 GCATCATCACCTGCCCTGCAAGG + Intronic
1060445724 9:123685813-123685835 GCAGCATCATAAACTCTCCTAGG - Intronic
1190023817 X:46903897-46903919 GCATCAGCGTATACCCAGCACGG + Intergenic
1195295201 X:103469797-103469819 TCAGCATCATACAGTCTGCATGG + Intergenic
1200234020 X:154459644-154459666 GCACCACCATGTCCCCTGCAGGG - Intronic