ID: 925213889

View in Genome Browser
Species Human (GRCh38)
Location 2:2075588-2075610
Sequence CTGTAAGAATCATTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925213885_925213889 15 Left 925213885 2:2075550-2075572 CCACATGTCATTGTAAGTACTCA 0: 1
1: 0
2: 2
3: 21
4: 182
Right 925213889 2:2075588-2075610 CTGTAAGAATCATTGGAGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925213889 Original CRISPR CTGTAAGAATCATTGGAGGA GGG Intronic
900410896 1:2512184-2512206 CTGTCAGGAGCATTGGAGGAGGG - Intronic
900939309 1:5787522-5787544 CTGTCAAAATCCTGGGAGGAGGG - Intergenic
903340293 1:22649699-22649721 CTGTAAGAATCGTGGGGGCAGGG + Intergenic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
906642068 1:47447188-47447210 AGGTAAGAATCTTGGGAGGAGGG - Intergenic
906782976 1:48589106-48589128 CTGTAAGAATCTCTATAGGATGG - Intronic
908962163 1:69711057-69711079 CTGTAAGAATCAGAGTTGGAGGG - Intronic
911186462 1:94909504-94909526 CTGGAAGAATAATTGGCTGAAGG - Intronic
911806397 1:102213584-102213606 ATGTAAGAATCATTCCTGGAGGG - Intergenic
918153152 1:181816251-181816273 TTGTAAGAATCATATGAGGTAGG - Intergenic
920108378 1:203570278-203570300 CTGGATGAGTCAGTGGAGGAAGG - Intergenic
920673625 1:208023869-208023891 CTGTTAATCTCATTGGAGGAGGG - Exonic
920687019 1:208117209-208117231 CTGTGTGAATTATTGGAGGGAGG + Intronic
923734508 1:236591707-236591729 CATTAAGAATCATCAGAGGACGG - Intronic
1069763575 10:70834181-70834203 CTGTCAGAATCACCGGAGGGAGG + Intronic
1073590745 10:104755220-104755242 CTGTATGAATCATTGAATAAAGG - Intronic
1073669665 10:105573780-105573802 CTGAATGAATCATGGGATGATGG - Intergenic
1075357911 10:121799391-121799413 CTGTAAGACATATTGCAGGAGGG - Intronic
1079852666 11:25556666-25556688 CTGTAATAATCATTGCAGCATGG + Intergenic
1083263839 11:61537186-61537208 CTTTGGGAATCATGGGAGGAGGG - Intronic
1083449963 11:62736899-62736921 CTTTAAGAGTGATTGGAGGCTGG + Intronic
1083472526 11:62893662-62893684 CTTTAAGAATCATTTGGGGAAGG - Intergenic
1083641965 11:64150472-64150494 CTGCACCAAGCATTGGAGGAAGG - Intronic
1088133806 11:106528907-106528929 CAGAAAGAATCATTCCAGGAAGG - Intergenic
1089816922 11:121184086-121184108 CTTTAAGAATTATTGTAGGCTGG - Intronic
1090104957 11:123843080-123843102 CTGTAAGAATCAGTTGGAGAAGG - Intergenic
1091482781 12:851258-851280 CTTTCAAAATGATTGGAGGAAGG + Intronic
1098183900 12:67876745-67876767 CTGTAAGACTCATGTGGGGAAGG - Intergenic
1100081212 12:90853824-90853846 ATGTAACAATGATTGGAGAAAGG - Intergenic
1100756146 12:97752910-97752932 CTGTTAGAATAAGTGGAGGCAGG + Intergenic
1101484093 12:105133511-105133533 ATGTAAGCATCATGGGAGGAGGG + Intronic
1104423636 12:128657237-128657259 CTGTATGTATCTTTGGGGGAAGG - Intronic
1105828620 13:24144471-24144493 ATTTAAGAAGCGTTGGAGGATGG + Intronic
1106093324 13:26619373-26619395 CTGTAAGTCTCCTTGGAGGCTGG + Intronic
1107716278 13:43202584-43202606 CTTTAAGGATCTTGGGAGGAGGG - Intergenic
1108045005 13:46375102-46375124 CTGTAAGCTTCATGAGAGGAGGG + Intronic
1109029382 13:57173775-57173797 CTGTCAGCATCCTGGGAGGAGGG - Intergenic
1113060070 13:106313580-106313602 CTGGAAGAACCAATGCAGGATGG + Intergenic
1113110695 13:106820135-106820157 CTGTAAGAAATATTGTAGGTGGG + Intergenic
1113307129 13:109090674-109090696 CTGTCAGAATCATGGGAAGGAGG + Intronic
1116188907 14:41637370-41637392 CTATTAGAATCAAGGGAGGAAGG + Intronic
1117620125 14:57577028-57577050 CTGGAAGAGGCAGTGGAGGATGG - Intronic
1118982258 14:70726363-70726385 CTGGAAGAATCTTTGGAAAAGGG - Intronic
1119589103 14:75868285-75868307 CTTTAACAATCATGGGAGAAAGG + Intronic
1121952381 14:98182915-98182937 CTGTAAGACTCATTGGACAGAGG + Intergenic
1122065296 14:99168997-99169019 CTGTCAGAATCTCTGGAGGCAGG - Intergenic
1125184853 15:36918707-36918729 CTGTCAGAATCCTTCAAGGAAGG - Intronic
1126388108 15:48114943-48114965 CTGTAAGAAACAATGAAAGAGGG + Intergenic
1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG + Intronic
1127175330 15:56348832-56348854 TTGTAAAAATCACAGGAGGAAGG - Intronic
1128130185 15:65222095-65222117 ATGGAAGAGTCATTGGAGGGAGG - Intergenic
1135851753 16:25970112-25970134 CTGTATAAATGATTGGAGAAGGG - Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1138943869 16:61823589-61823611 CAGAAAAAAACATTGGAGGAAGG + Intronic
1139368623 16:66450411-66450433 CTGCAAAAATCTTTGCAGGATGG + Intronic
1139745727 16:69072987-69073009 TTGTAACAAACACTGGAGGATGG + Intronic
1140204340 16:72921631-72921653 CTGCACGAAGCATTGGGGGAAGG - Intronic
1140668248 16:77247895-77247917 CTGCAAGAAAGATTGGAGGTGGG + Intronic
1142007344 16:87695768-87695790 CTGCAAGAATCACTGCAGAAGGG + Intronic
1143301220 17:5911977-5911999 ATGCATGGATCATTGGAGGATGG - Intronic
1143301472 17:5913766-5913788 ATGGACGGATCATTGGAGGATGG - Intronic
1143301503 17:5913923-5913945 ATGGATGGATCATTGGAGGATGG - Intronic
1143301508 17:5913946-5913968 ATGGATGGATCATTGGAGGATGG - Intronic
1148088833 17:45010424-45010446 CAGTAAGAATATTGGGAGGAGGG + Intergenic
1150540949 17:66098726-66098748 CTGTATGTGTCTTTGGAGGATGG - Intronic
1155579456 18:27286393-27286415 GTGTTAGAATCATGGGAGCAAGG - Intergenic
1158124743 18:54088612-54088634 CTATGAGAAAGATTGGAGGATGG - Intergenic
1158840516 18:61381348-61381370 CTGAAAGAATCATTTGGGCAAGG + Intronic
1159514561 18:69441547-69441569 TTGAATGAATCATTGGAGGTAGG - Intronic
1163866383 19:19776691-19776713 CTGTGCGCATCACTGGAGGAAGG - Intergenic
1165308367 19:35015929-35015951 CTGTAGGAAGCCCTGGAGGAAGG - Exonic
1168627255 19:57929128-57929150 CTGGAAGATTCGTTGGGGGATGG + Intronic
925213889 2:2075588-2075610 CTGTAAGAATCATTGGAGGAGGG + Intronic
927516755 2:23676157-23676179 CTGTAAGAATTTTTGGAGGATGG + Intronic
929325226 2:40602133-40602155 TTGTAAGATTGATTAGAGGAAGG - Intronic
930869289 2:56153780-56153802 CAGGAAGAATCACTGGAGCAAGG - Intergenic
932145564 2:69313064-69313086 CTGTAGGTATCATTGTAAGAGGG - Intergenic
937005035 2:118503694-118503716 CTTTAAGAAAGACTGGAGGAAGG + Intergenic
937085304 2:119167768-119167790 CTGTAAGATTCATTTAGGGAGGG + Intergenic
940136312 2:150439998-150440020 CTGTAAGCATCATGGGGGCAGGG + Intergenic
940552886 2:155183942-155183964 CAGGAGGAAACATTGGAGGAAGG + Intergenic
945307865 2:208276178-208276200 CTGTCAGAATCTTTGAAGGCTGG + Intronic
945992285 2:216406110-216406132 ATATAAGAATCAATGGATGAAGG + Intergenic
947232380 2:227901532-227901554 CTGACAGAATCTTGGGAGGATGG + Intronic
1168913349 20:1467272-1467294 ATGTAAGAAGCATGGGAGCAGGG - Intronic
1173319854 20:41977626-41977648 CAGGAAGAATCATTTGAGGAAGG - Intergenic
1178021636 21:28414961-28414983 CTGTAATAAACATAGGAGGCTGG - Intergenic
1178079969 21:29053082-29053104 CTGTGAGAATCATAGATGGACGG + Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1181116148 22:20633509-20633531 GTGTAAGAAAAATCGGAGGAAGG + Intergenic
1181347923 22:22233840-22233862 CTCTAAGCTTCATGGGAGGAGGG + Intergenic
1185208692 22:49554736-49554758 CTGTCAGAATCAATGGTGGGAGG - Intronic
950082997 3:10236710-10236732 CTGAAAGAATAATTGGTTGAAGG - Intronic
950574019 3:13820273-13820295 ATGAAAGAATGAATGGAGGAAGG + Intronic
951940444 3:28072059-28072081 CTCCCAGAATCATTGGAGGCAGG + Intergenic
956030733 3:65034706-65034728 ATCTAAGAATCATTTCAGGATGG - Intergenic
956458641 3:69449542-69449564 CTGTAAGAGTCCTTTTAGGATGG - Intronic
957157400 3:76562617-76562639 TAATTAGAATCATTGGAGGATGG - Intronic
958874082 3:99595825-99595847 CTGTAAGAAATACTAGAGGATGG - Intergenic
959885560 3:111495991-111496013 CTGTAAGAATTTATGGTGGATGG - Intronic
961791946 3:129382565-129382587 CTGTAAGATTCAGAGGAGGGAGG + Intergenic
962380429 3:134894137-134894159 CTGCAAGGATCCTTGGAAGACGG - Intronic
963034129 3:141010419-141010441 CTGTGTGAAACAGTGGAGGAAGG + Intergenic
964046415 3:152333005-152333027 CTGAAACCAACATTGGAGGAAGG - Intronic
964048413 3:152360223-152360245 ATGAAAGATTTATTGGAGGAGGG - Intronic
964509601 3:157436646-157436668 CAGTCAGATTAATTGGAGGAGGG - Intronic
966880885 3:184350262-184350284 CTGAAAGAATCCTGGGAGCAGGG + Intronic
968621713 4:1606339-1606361 CAGTAAGAGTCATAGGAGGCCGG - Intergenic
969449889 4:7266956-7266978 CTGGAAGAATCAGTGGGGGGTGG + Intronic
970250779 4:14113455-14113477 CAGCAAGAAGCATGGGAGGAAGG - Intergenic
971236163 4:24844278-24844300 ATCTAAGAAGCATTTGAGGACGG - Intronic
977163266 4:93663268-93663290 CTGTATGAATCACTGAAGGGAGG - Intronic
978398164 4:108304433-108304455 CTGTGAGAATCACTGGATTAGGG + Intergenic
981158731 4:141471560-141471582 CTATAAGAGTCATTGGAAGCTGG + Intergenic
981215103 4:142155701-142155723 CTGTAGGCATCATTAGAGAAAGG + Intronic
983922254 4:173358514-173358536 CTGCATGAAGCACTGGAGGAGGG + Intergenic
987573271 5:19693594-19693616 CTTTAAAAATCATGAGAGGAAGG + Intronic
989533975 5:42542202-42542224 GTGGAAGAATCAATGGAGAAGGG + Intronic
990708912 5:58561803-58561825 ATTTATGAATCATTGCAGGACGG + Intergenic
990732712 5:58826992-58827014 CTCTAAGAATATTTGGTGGAAGG - Intronic
990821016 5:59840390-59840412 CTGTAAGCCTCATGAGAGGAGGG + Intronic
992265760 5:75016864-75016886 ATGTAAGAATCATTGGCCAATGG - Intergenic
992898300 5:81266985-81267007 CTGTAACAATCAGTAAAGGATGG - Intergenic
993491441 5:88556278-88556300 ATGTAAGATGCATTGGAGAATGG + Intergenic
996625438 5:125564805-125564827 CTGAAAACATCATTGGAGCAGGG - Intergenic
997198479 5:131995200-131995222 CTGTGAGAAGCACTGGAGAATGG + Intronic
997490777 5:134274108-134274130 CAGAATGAATCACTGGAGGAGGG - Intergenic
999425204 5:151481964-151481986 CAGTATGAATCACTGAAGGATGG - Intronic
999993437 5:157069416-157069438 CTATAAAGATCTTTGGAGGAGGG - Intergenic
1001126222 5:169022051-169022073 CTGGAGGAATCTTTGGTGGAGGG - Intronic
1001543443 5:172555151-172555173 CTGGATGAATGAATGGAGGAGGG - Intergenic
1001975194 5:175993135-175993157 CTGTTGGAATTGTTGGAGGATGG - Intronic
1002242237 5:177850635-177850657 CTGTTGGAATTGTTGGAGGATGG + Intergenic
1003131890 6:3401940-3401962 CTGTCAGACTCATGGGAGGAAGG + Intronic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004109237 6:12698970-12698992 CTTTAAGAAACATTCGAGGCCGG - Intergenic
1004474358 6:15957291-15957313 CAGTAAGAGTGATTGGAGGAGGG - Intergenic
1005584551 6:27263038-27263060 CTGTTTGCATCATTGAAGGAGGG + Intergenic
1011761359 6:90569402-90569424 CTGTATGGATCATTGGATCAGGG - Intronic
1012405263 6:98889265-98889287 CTGTTATAATCATTGGAGTATGG - Intronic
1013992243 6:116266315-116266337 CTTTAAGAGCCATTTGAGGAAGG + Intronic
1016818222 6:148323352-148323374 ATGTCAGAATCATTGGAGATGGG - Intronic
1020677546 7:11198851-11198873 CTCCAAGATTCATGGGAGGATGG + Intergenic
1022133125 7:27422440-27422462 CTGAACCAATCACTGGAGGATGG + Intergenic
1024586655 7:50848133-50848155 CTATAAAAGTCATTTGAGGAAGG - Intergenic
1028593272 7:92521260-92521282 CTGTAAGAATAATGTGAGGCTGG - Intronic
1028923319 7:96330509-96330531 CTGCAAGAGTCATTGGAGACTGG - Intergenic
1030300703 7:107971578-107971600 CTTTGAGAATCATTGGTGGAGGG - Intronic
1031243340 7:119273576-119273598 CTGTAGGAAACAATGCAGGAAGG - Intergenic
1031772166 7:125857549-125857571 CTGAAAGCATCATTGAAGGAGGG + Intergenic
1031824259 7:126543358-126543380 GTGTCAGAATCACTAGAGGAAGG - Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1033867915 7:145714805-145714827 CTGAAAGAGGCATTGGAAGAAGG - Intergenic
1035288666 7:157822983-157823005 CTGTATGGATCATGGGTGGATGG - Intronic
1036071298 8:5442488-5442510 CTGGAAAAATGATTTGAGGAGGG - Intergenic
1036778306 8:11628606-11628628 CTGTGGGAATGATTGCAGGAAGG + Intergenic
1037806130 8:22058745-22058767 CGGTAAAAAACATTGGAGTAGGG + Intronic
1037989335 8:23309428-23309450 ATGTTAGAAGCATTGGAGGCAGG + Intronic
1040776564 8:51050586-51050608 CTATAAGGTACATTGGAGGATGG + Intergenic
1041536388 8:58930631-58930653 CTAGAAGAAGCACTGGAGGAAGG + Intronic
1043391417 8:79795707-79795729 CAGTGAGAATCATTGCAGGCAGG + Intergenic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1047754860 8:127910699-127910721 CTGTAATAATCCTAGGAGGATGG + Intergenic
1048661208 8:136603836-136603858 CTGTCAGAATCATGGGTGTAGGG - Intergenic
1052484968 9:29085481-29085503 CTTTTCGAATAATTGGAGGAAGG - Intergenic
1055068153 9:72139698-72139720 CACTAAGAATCACAGGAGGAAGG - Intronic
1055459197 9:76501647-76501669 TTCTAAGAATCTTTGAAGGAAGG - Intronic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1058681632 9:107445464-107445486 CTCTGCGAATCGTTGGAGGAAGG - Intergenic
1059005829 9:110400966-110400988 CTGCAAGATTCATCGGAGAATGG + Exonic
1059867319 9:118530062-118530084 CTGTGAAAAGCATAGGAGGAGGG + Intergenic
1060893186 9:127201474-127201496 ATGTAAGAAGCAGTGCAGGATGG - Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187716421 X:22106878-22106900 CTGTAATAAGCAATGGAGGCCGG - Intronic
1190130391 X:47742645-47742667 CTGAAAGAATAGTTAGAGGATGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1196920965 X:120584813-120584835 CTGTAAAAAGTATTGGATGAGGG + Intergenic
1196989673 X:121314325-121314347 CTGTAAGATTTAGGGGAGGATGG + Intergenic
1199420933 X:147643943-147643965 CAGGAACAATCATTGGTGGAAGG - Intergenic
1200951357 Y:8902635-8902657 CTGGGAGAGTCCTTGGAGGAAGG - Intergenic