ID: 925214967

View in Genome Browser
Species Human (GRCh38)
Location 2:2086629-2086651
Sequence GCTTCTGCCTGCCCTGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 379}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925214960_925214967 -1 Left 925214960 2:2086607-2086629 CCCCCTTAGCTGAAGGTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214956_925214967 15 Left 925214956 2:2086591-2086613 CCTCCATGCCTTATCACCCCCTT 0: 1
1: 0
2: 1
3: 23
4: 282
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214964_925214967 -4 Left 925214964 2:2086610-2086632 CCTTAGCTGAAGGTCCCTGGCTT 0: 1
1: 0
2: 0
3: 15
4: 144
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214957_925214967 12 Left 925214957 2:2086594-2086616 CCATGCCTTATCACCCCCTTAGC 0: 1
1: 0
2: 1
3: 15
4: 125
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214962_925214967 -2 Left 925214962 2:2086608-2086630 CCCCTTAGCTGAAGGTCCCTGGC 0: 1
1: 0
2: 1
3: 3
4: 122
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214963_925214967 -3 Left 925214963 2:2086609-2086631 CCCTTAGCTGAAGGTCCCTGGCT 0: 1
1: 0
2: 2
3: 14
4: 138
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214958_925214967 7 Left 925214958 2:2086599-2086621 CCTTATCACCCCCTTAGCTGAAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379
925214955_925214967 23 Left 925214955 2:2086583-2086605 CCTGACAACCTCCATGCCTTATC 0: 1
1: 0
2: 1
3: 32
4: 341
Right 925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG 0: 1
1: 0
2: 7
3: 47
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925214967 Original CRISPR GCTTCTGCCTGCCCTGCTGT TGG Intronic
900088088 1:908230-908252 CCTCCTGCCCGCCCTCCTGTGGG - Intergenic
900418206 1:2544664-2544686 GCTTGGGTCTGCCCAGCTGTGGG + Intergenic
901087777 1:6622154-6622176 GCTGCTGCCTGACCGGCTGGGGG + Exonic
901142269 1:7042743-7042765 GCTGCTGCCAGCCCTACTGAAGG - Intronic
901842864 1:11964776-11964798 GCTCCTGGCTGACCTGCTGCCGG - Exonic
902330415 1:15728553-15728575 GCCTCTCCTTGCCCTGCAGTAGG - Intronic
903070894 1:20726613-20726635 CCTCCTCCCTGCCCTGCTGCAGG - Intronic
903539871 1:24090861-24090883 GCTGCTGCCTACCCTGCTGATGG + Exonic
904118288 1:28178109-28178131 CCTTATACCTGCCTTGCTGTGGG - Intronic
904457441 1:30656079-30656101 GCTGATGTCTGCCCTGTTGTGGG - Intergenic
904495597 1:30884611-30884633 GCTGCTACCTGCTCTCCTGTTGG - Intronic
905646236 1:39626687-39626709 GCTCCTGGCAGCCCTGCTGCTGG + Exonic
905781202 1:40711452-40711474 ACTTTTGCCTCCCCTGCTGCAGG - Intronic
906513320 1:46423867-46423889 ACTTCTGCTGGCCCTGCTGGGGG + Intergenic
907308131 1:53524943-53524965 GCCTCCGCGTGACCTGCTGTGGG + Intronic
907371510 1:54006562-54006584 GCTCCTGCTTGCACTGCAGTTGG + Intergenic
907472197 1:54681081-54681103 GCCTCTGCCTGGCCTGCTGTGGG - Intronic
907667208 1:56443837-56443859 GCTGCTTCCTGCCCTGCTTTAGG + Intergenic
907987333 1:59544978-59545000 ACTTCTGCCTCACCTGCTTTAGG + Intronic
908119848 1:60975691-60975713 GCTTTTCCCTGCACTTCTGTAGG - Intronic
909344904 1:74573248-74573270 AATTCTGGCTGCTCTGCTGTTGG + Exonic
909902006 1:81149482-81149504 GCTTCTGCCTTCCTTTCTGGTGG + Intergenic
912430523 1:109626262-109626284 GCTGCAGCCTGCCCTTCTGCCGG + Intronic
913501266 1:119474758-119474780 GCTTCTCTCTGCCCTGCTCAGGG - Intergenic
914313877 1:146490103-146490125 GCTTCTGACTCCCTTGCTATGGG - Intergenic
914500473 1:148243277-148243299 GCTTCTGACTCCCTTGCTATGGG + Intergenic
916240545 1:162634719-162634741 CCTTCAGCCTGCACTGCTTTGGG - Intronic
917221185 1:172730389-172730411 GAATCTGCATGCCCTGGTGTTGG - Intergenic
919726881 1:200890521-200890543 GCGTCTGGCTGCCCTGCTTCTGG + Intergenic
922770430 1:228179176-228179198 GCTTCTGTCTGCCTTTCTGCTGG - Exonic
923199388 1:231696533-231696555 GTTTTTCCCTGCCCAGCTGTGGG - Intronic
1063183284 10:3626561-3626583 GGTTCTCCCTGCTTTGCTGTAGG - Intergenic
1063417970 10:5889401-5889423 GCTTCTCCCTGCCCGGCCGCCGG - Exonic
1064103043 10:12479532-12479554 GCTGCTGCCGCCGCTGCTGTGGG + Intronic
1064109621 10:12527174-12527196 CTTTCTACCTGCCCTGCTCTAGG - Intronic
1064581456 10:16797070-16797092 CCTACTGCAGGCCCTGCTGTTGG - Intronic
1067232101 10:44419155-44419177 GCTCCTGCCTTCCAGGCTGTGGG - Intergenic
1067473404 10:46551514-46551536 CCTACTGCGTGCCCAGCTGTAGG + Intronic
1069215006 10:65808976-65808998 CCTTAAGCATGCCCTGCTGTGGG + Intergenic
1070773182 10:79094569-79094591 CGTTGTCCCTGCCCTGCTGTGGG + Intronic
1071330272 10:84551985-84552007 GCTTCTGCGTGTCCTGTTCTTGG - Intergenic
1071541344 10:86487202-86487224 TCTTCTGCTTGCCCTGCTTGTGG - Intronic
1072583904 10:96764658-96764680 GCTTCTTCCTTCCCTGATGATGG - Intergenic
1073540641 10:104314318-104314340 GCATCTGCCAGCCCTGTTCTGGG - Exonic
1075337283 10:121617578-121617600 CCTTCTGCCTGAGCTGTTGTGGG - Intergenic
1075419601 10:122290982-122291004 ACCTCTGCCTGCCCAGCTGCAGG + Intronic
1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG + Intergenic
1075856472 10:125634244-125634266 GCTTCTGCTGGCTCTGCTGAAGG - Intronic
1076702622 10:132282047-132282069 GCTGCTGCCTGGCCAGCTGGCGG - Intronic
1076730867 10:132438283-132438305 GGTCCTGCCGGCCCTGCTGCAGG - Intergenic
1076829533 10:132987099-132987121 TCTTCTGCGTGGCCTGCTGCAGG + Intergenic
1077457247 11:2688480-2688502 GCCTCTGGTTGCCCTGCTCTGGG + Intronic
1077477007 11:2795277-2795299 GCTGCTGCCAGACCTGCAGTTGG + Intronic
1077517030 11:3008182-3008204 CCTCCTGCCTGCCCTGCCTTTGG + Intronic
1077538358 11:3135019-3135041 GCTTCTGCCTGGCCCTCTGCAGG + Intronic
1077805176 11:5583693-5583715 GCTTCAGCCTCCCCAGCAGTTGG + Intronic
1078066043 11:8080334-8080356 GCTTCCGCCCGCCCTGCTGTGGG + Intronic
1078413952 11:11150040-11150062 GCTTCTTCCACCTCTGCTGTGGG - Intergenic
1081634197 11:44710000-44710022 CCTCCTGCCTCCCCTGCTGCAGG - Intergenic
1083475829 11:62914820-62914842 GCTGCACCCTGCCCTGCTGCAGG + Intronic
1083992000 11:66252118-66252140 GCTTCTGCCTGCAGTGTTGTTGG - Intergenic
1084267290 11:68011645-68011667 CCTTCTGGCTGCCCTGATGGGGG + Intronic
1084693559 11:70740715-70740737 TCTTCTGGCTGCTCTGCTGTGGG - Intronic
1085475308 11:76785144-76785166 GCTTTTGCCTTTCCTGGTGTTGG - Intronic
1085655571 11:78311622-78311644 GCCTCTGCGTGCCAGGCTGTGGG + Intronic
1086102984 11:83120801-83120823 GCTTCAGCCTCCCAAGCTGTTGG + Intergenic
1086566355 11:88231159-88231181 GGTGCTTGCTGCCCTGCTGTGGG - Intergenic
1086610729 11:88752303-88752325 GCTTCTGGCTCGCCTGTTGTTGG - Intronic
1088157322 11:106823240-106823262 CCTCCTGCCTTCCCTGCTTTTGG + Intronic
1088721034 11:112591908-112591930 GCATCAGCCTTCCCTGCTGATGG + Intergenic
1089120654 11:116132371-116132393 GCTTCTGCCCTCACTGCTGTCGG - Intergenic
1089387032 11:118075148-118075170 GCTTCTCACTGCCCTGCTGCTGG + Intergenic
1089762497 11:120738602-120738624 GCTGCTGCCTGCCCTGCTGCAGG - Intronic
1089814717 11:121162194-121162216 GCTTCTTCCAGCCCTGCTATGGG + Exonic
1090116211 11:123977140-123977162 CCTTCCGCCTGCTCTACTGTGGG - Exonic
1090662606 11:128892359-128892381 GCTTCTCCCTGCAGAGCTGTTGG + Intronic
1091541789 12:1469193-1469215 TCTTCTCCCTGTCCTGCTGGTGG + Intronic
1091805738 12:3354737-3354759 GCTTCTGCCTGGCTTCCTGGGGG - Intergenic
1092532161 12:9353605-9353627 CCTACTGCCTCCTCTGCTGTGGG + Intergenic
1094339527 12:29395507-29395529 GCTTCTGCTTGCCCTCCCCTGGG + Intergenic
1095666837 12:44812014-44812036 TCTTCTGCATGCCCTGCTGAAGG - Intronic
1095941936 12:47733078-47733100 GACTCTGCCTGCCTTGCTCTTGG - Intergenic
1096415337 12:51407736-51407758 TCAGCTGCCTGCCCTGGTGTGGG + Intronic
1096518252 12:52170235-52170257 CCTTCTTCCTGGCCTGCTGGAGG + Exonic
1096884800 12:54706483-54706505 GCTTCTCCTTGCCCTGCTTCAGG + Intergenic
1097420645 12:59374669-59374691 GCTTCTGCCACCTCTGCTGTGGG + Intergenic
1097625803 12:61998838-61998860 ACTTGTGCCTTCCCTGCAGTTGG - Intronic
1098448535 12:70592786-70592808 GCTTCTGCCTGCCAAGGTTTTGG - Intronic
1098523484 12:71460163-71460185 TCTTGTGCCTGCACTGATGTGGG - Intronic
1100984435 12:100190800-100190822 TCTTCTGCGGGCCCTGCAGTTGG - Intergenic
1101434764 12:104655178-104655200 GTTTCTGCATGCCTTGCTTTTGG + Intronic
1101519434 12:105467861-105467883 GCTTCCTCCGGCCCTGCTCTTGG + Intergenic
1101811485 12:108111756-108111778 GGTTCTGCCTGCTCAGCTGGTGG - Intergenic
1102203914 12:111077235-111077257 GCCTCTGCCTGCCCTGCTTGGGG + Intronic
1103299557 12:119917756-119917778 GCTTCTGCCTGGCCTCCTGTGGG - Intergenic
1103411720 12:120716971-120716993 GCTTCTGCATCCCCAGCAGTAGG + Exonic
1104013552 12:124948246-124948268 GGTGATGCCTGCCCTGCTTTCGG - Intronic
1104771924 12:131369058-131369080 GATCCTTCCTGCCCTGCCGTGGG - Intergenic
1105948971 13:25212731-25212753 TTTTCTGTCTACCCTGCTGTTGG + Intergenic
1106036696 13:26050891-26050913 GCTGCTGGCTGCGCTGCTGGCGG - Exonic
1106227369 13:27795196-27795218 GTTTCTGCCCTCCCGGCTGTTGG - Intergenic
1106391503 13:29339220-29339242 CCTGCTGCCTGCCCTACTGCAGG - Intronic
1107650332 13:42538498-42538520 CCTTCTTCCTCCCCTTCTGTGGG - Intergenic
1107965365 13:45593053-45593075 GCATCTGACTGGCCTGCTGGGGG - Intronic
1109883963 13:68518201-68518223 ACTTCTGCCCTCCCTGCTTTTGG + Intergenic
1110904523 13:80869556-80869578 GCTCCTGCATGCCCTGATTTTGG + Intergenic
1110983161 13:81928962-81928984 GCTTCTGCTTGCTTTTCTGTAGG - Intergenic
1112303761 13:98254568-98254590 CCTTCTGCCTGTGTTGCTGTAGG + Intronic
1112388013 13:98958151-98958173 CCTCCTGGCTGCCCTGCTGTAGG - Intronic
1112567730 13:100565741-100565763 GCCCCTGCCTGTCCAGCTGTGGG + Intronic
1112861105 13:103830314-103830336 GTTTTGGCTTGCCCTGCTGTGGG + Intergenic
1112957126 13:105073593-105073615 GATTCTGCAGGTCCTGCTGTAGG + Intergenic
1113065547 13:106370690-106370712 GCTTCTGTCTTCCCTGCTTCTGG + Intergenic
1113307120 13:109090625-109090647 AGTTCTGTCTGTCCTGCTGTGGG - Intronic
1113877247 13:113602063-113602085 GCTTCTCCCTCGACTGCTGTGGG - Intronic
1113976669 13:114232602-114232624 TCTTCTGCCTACCCTGATATGGG + Intergenic
1114323940 14:21570232-21570254 CCTTCCGCCTGCCCTACTGTGGG - Exonic
1114327316 14:21602302-21602324 CCTTCCGCCTGCCCTACTGTGGG - Intergenic
1114330713 14:21634318-21634340 CCTTCCGCCTGCCCTACTGTGGG - Exonic
1115726488 14:36223013-36223035 GTTTCTCTCTGCCCGGCTGTTGG - Intergenic
1115780656 14:36764743-36764765 GTTGCTGCCTCCCCTGCTGATGG - Intronic
1115958443 14:38808653-38808675 GCCTCTGGCTGCCCTCCTGAAGG - Intergenic
1117090200 14:52242306-52242328 GCCTCTGCCTGCCTTGGTGAGGG - Intergenic
1118457964 14:65961871-65961893 GCCTCAGACTGCCCTGCTGCTGG - Intronic
1118785018 14:69038514-69038536 GCCTTTCCCTGCCTTGCTGTGGG + Intergenic
1119645226 14:76343107-76343129 CCTTCTGCCTGGGCTGCTCTTGG - Intronic
1120753369 14:88218776-88218798 GCCTCTTTCTCCCCTGCTGTGGG - Intronic
1121368721 14:93337695-93337717 CCCTCTGCTTGCCATGCTGTGGG + Intronic
1122128146 14:99590258-99590280 GATGCTGCCTGCCCTCCTGCTGG - Intronic
1122974083 14:105163950-105163972 GCTTCGGCCTGAGCTGCTGCTGG - Intronic
1127308104 15:57727946-57727968 TCTTATGCCTGCCCTGACGTAGG + Intronic
1127390595 15:58502138-58502160 GCTTCTTCCTGCCCCACTCTGGG - Intronic
1127395646 15:58542047-58542069 TCTCCTGCCTGGGCTGCTGTTGG - Intronic
1127704309 15:61532161-61532183 TCTCCTGCCTGGCCTGCTGTAGG + Intergenic
1127962539 15:63900433-63900455 GCTTGTCTCTGCCCTGCTGGTGG + Intergenic
1128032751 15:64496172-64496194 TGTACTGCCTGCCCTGCTGCAGG - Intronic
1128154281 15:65383049-65383071 GCTTCTGCTTGCCCTGCCCCAGG - Exonic
1128672648 15:69586133-69586155 GATGCTGCCTGCTCTGGTGTGGG - Intergenic
1129249896 15:74303040-74303062 GGGTCTGACTGCTCTGCTGTCGG - Intronic
1129748171 15:78039451-78039473 TCTTCTGCGGGCCCTGCAGTTGG - Intronic
1130050455 15:80479792-80479814 TGGTCTACCTGCCCTGCTGTTGG + Intronic
1131624454 15:94102892-94102914 GTTTCTGCCTGCCCCACTGATGG - Intergenic
1132242192 15:100266453-100266475 GCTTCTGCCTGCCCTTACCTGGG - Intronic
1132344995 15:101102699-101102721 GCTGCTTCCTTCCCTGCTGTGGG - Intergenic
1132934835 16:2475035-2475057 GCTCCGGCCTGCCCGGCTCTGGG - Intergenic
1132992683 16:2805102-2805124 GCTGCTCCTTGCCCTGCTGTGGG + Intergenic
1133055343 16:3142997-3143019 GCTAGTGCCTGCCCTGCTCTGGG + Intergenic
1134322381 16:13175556-13175578 CCTTCTTCCTGGCCAGCTGTGGG - Intronic
1136718338 16:32302039-32302061 GCTTGTCCTGGCCCTGCTGTGGG - Intergenic
1136836712 16:33508309-33508331 GCTTGTCCTGGCCCTGCTGTGGG - Intergenic
1136986595 16:35112247-35112269 GCTTCTGCATCCCCTGATGTTGG - Intergenic
1136993488 16:35172069-35172091 GCTCCTGCATGCCTTGATGTTGG - Intergenic
1138391187 16:56670820-56670842 GCTTGAGCCAGGCCTGCTGTTGG + Intronic
1138496353 16:57411636-57411658 GCTTCTGCCTGCCCTCTTGTGGG - Intronic
1139514169 16:67443614-67443636 GTCTGTGCCTACCCTGCTGTTGG - Intronic
1139547913 16:67658285-67658307 CCTTCTGCCTGCCCTGTCCTTGG - Exonic
1139942159 16:70613117-70613139 CCTTCGACCGGCCCTGCTGTGGG - Intronic
1140032383 16:71348903-71348925 GCAGCTGCTTGCCCTGCTGGGGG - Intergenic
1140457303 16:75112812-75112834 GGTTCTGCCCACCCTGCTGCTGG - Exonic
1140749706 16:78012092-78012114 CCTTCTGCCTGCCTGCCTGTGGG + Intergenic
1141409822 16:83825424-83825446 GTTTGTGTCTGCCCTGCTGTTGG - Intergenic
1141695056 16:85615152-85615174 GGTTCTGCCGTCCCTGCTGGTGG - Intronic
1142128486 16:88421635-88421657 GCCTCTGCCTGCCCAGCTTGCGG - Intergenic
1203008090 16_KI270728v1_random:215726-215748 GCTTGTCCTGGCCCTGCTGTGGG + Intergenic
1203125282 16_KI270728v1_random:1571791-1571813 CCTTCTGCCTGTACTGGTGTAGG + Intergenic
1143516075 17:7419861-7419883 GGTTGTGCCTGCTCTGTTGTGGG + Intergenic
1143765458 17:9134870-9134892 TCTTCCTCCTGCCCTGCTTTTGG + Intronic
1143933104 17:10452018-10452040 GCTTCTGCTTGACCCGCTGAAGG + Exonic
1143951741 17:10638120-10638142 GCTTCTGCTTGACCCGCTGCAGG + Exonic
1144513361 17:15896772-15896794 TCTTCTTCCTGCCCTGCAGGTGG - Intergenic
1144622953 17:16830139-16830161 CCTTCTCCCTGCCCTGGAGTTGG - Intergenic
1144883477 17:18442577-18442599 CCTTCTCCCTGCCCTGGAGTTGG + Intergenic
1145148751 17:20501809-20501831 CCTTCTCCCTGCCCTGGAGTTGG - Intergenic
1146672772 17:34753265-34753287 GTTTATGCCAGCCCTGCTCTGGG + Intergenic
1146938508 17:36827177-36827199 GCTTCAGCCTGCGCTGGAGTGGG - Intergenic
1147646599 17:42038061-42038083 GCCTCTGCTTCCCCAGCTGTGGG - Intronic
1147991032 17:44333616-44333638 ACTTCTCCCTGCCCTTCTCTGGG + Intergenic
1148851640 17:50558555-50558577 GTTTGTGCCTGCCCTCCTTTCGG + Intergenic
1149254719 17:54812923-54812945 GCGTCTGCCAGCTCTTCTGTTGG + Intergenic
1149868747 17:60164783-60164805 GTGTCTGCCTGCCCTACAGTTGG - Intronic
1150062908 17:62084268-62084290 GGTTCTGGCTGCCCTGGTGGTGG - Intergenic
1150644179 17:66967977-66967999 CCTTCTGCCTGCCCCTCTGCTGG + Intronic
1151095667 17:71494927-71494949 CCTTTTCCCTGCCCTCCTGTGGG - Intergenic
1151363114 17:73600419-73600441 GCTTCTGCCTCCCCTGGGGGAGG + Intronic
1151970372 17:77454573-77454595 GCCTGTGCCTGCCCAGCTGCTGG + Intronic
1151977031 17:77488937-77488959 GGTGCTGTCTGCCCTGCTGCTGG + Intronic
1152224262 17:79085476-79085498 GCTGCTGGGAGCCCTGCTGTCGG + Intronic
1152227442 17:79098939-79098961 CAGTCTGCCTGCCCTGCAGTGGG - Intronic
1152281093 17:79385227-79385249 GCTTCTTTCTGCCTTGTTGTGGG - Intronic
1152892857 17:82892250-82892272 GCTCCTGCCTGCTGTGATGTGGG + Intronic
1153921734 18:9797365-9797387 GCTTCTGCTTCTCCTGCTGGCGG + Intronic
1154191740 18:12236085-12236107 CCTTCTGCGTGCCCTGCCCTCGG - Intergenic
1154197779 18:12278995-12279017 CCTTTTGTCTGTCCTGCTGTGGG - Intergenic
1154239606 18:12640701-12640723 TCTTCTTCCCGCCCTGCAGTTGG - Intronic
1156386868 18:36613117-36613139 GCCCCTGCCTGCCCAGTTGTAGG + Intronic
1156917596 18:42480102-42480124 TCTCCTACCTGCTCTGCTGTTGG + Intergenic
1157136784 18:45063809-45063831 GATTCTGCCTGCCCGGCTTCTGG - Exonic
1157218531 18:45806766-45806788 GCCTCTGGCTGCCCTTCTGAAGG - Intergenic
1157570126 18:48706659-48706681 GCCTCAGCCTGCCCTGGAGTGGG + Intronic
1159107103 18:64015170-64015192 GCATCGGCCTGCCCAGTTGTGGG + Intergenic
1159145177 18:64445105-64445127 GTGTCTGCCTCCCCTGCTGCAGG + Intergenic
1160261302 18:77296704-77296726 TCTTCTGCCTGCCCTACAGTGGG - Intergenic
1160389447 18:78518974-78518996 GCTGTTCTCTGCCCTGCTGTGGG - Intergenic
1161030530 19:2056066-2056088 GCCTGGCCCTGCCCTGCTGTGGG + Intergenic
1161467869 19:4442201-4442223 GCTGCTGCCTGCAGTGCTGATGG + Intronic
1162323871 19:9986851-9986873 GCTTCTGCCTAGCCTCCTCTTGG - Intronic
1162815182 19:13189822-13189844 ACTTCTCTCTGCCTTGCTGTGGG - Intergenic
1163404517 19:17113804-17113826 TCTCCTGCCTGCCCTGCATTCGG - Intronic
1164962529 19:32446297-32446319 CCTTCTTCCTGCCTTCCTGTAGG - Intronic
1165138281 19:33684408-33684430 GCTGCCTCCTGCCCTGCTGCTGG - Intronic
1165304958 19:34998109-34998131 CCTTCTGCCTGCCATGCAGTTGG - Intronic
1165791342 19:38494476-38494498 GCTGCTGCGTGCCCTGCCGCGGG + Exonic
1165895502 19:39138861-39138883 GCTCCTTCCTGCCACGCTGTGGG - Intronic
1167723988 19:51198857-51198879 GCTGCTGCTGCCCCTGCTGTGGG + Intergenic
1167725624 19:51211120-51211142 GCTACTGCTGCCCCTGCTGTGGG + Intergenic
1167727292 19:51225130-51225152 GCTACTGCTGCCCCTGCTGTGGG + Exonic
1167772855 19:51531585-51531607 GCTGCTGCTGCCCCTGCTGTGGG - Exonic
1167776992 19:51564880-51564902 GCTACTGCTGTCCCTGCTGTGGG - Intergenic
1167785213 19:51630302-51630324 GCTGCTGCTGCCCCTGCTGTGGG - Intronic
1167787312 19:51646726-51646748 GCTGCTGCTGCCCCTGCTGTGGG - Exonic
1167811163 19:51831742-51831764 GCTTTTGCCTGTCCTTCTGATGG + Intergenic
925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG + Intronic
925534340 2:4900508-4900530 GCTTCTGCTGCCCCTGCTTTGGG + Intergenic
925798986 2:7578080-7578102 GCTTCTGCATGGCCTTCTCTAGG + Intergenic
925906865 2:8544900-8544922 GCTTCTGTGTGGCCTGCTGTGGG + Intergenic
927207369 2:20618868-20618890 GCTTCTGCCTGGCCTCCCCTGGG + Exonic
927917402 2:26945890-26945912 GCTCCTGTGTGCCCTGCTTTGGG + Intronic
928745344 2:34407187-34407209 GCTTCTGCCTCCCCAGCTCCAGG - Intergenic
930660786 2:54051020-54051042 GCCTCGGCCTCCCATGCTGTTGG + Intronic
930890881 2:56386004-56386026 GCTTCTGCAGGCTCTGCTGCAGG - Exonic
932025470 2:68127690-68127712 GCTTCTGCCTGGTCTTCTCTTGG + Intronic
932102173 2:68911383-68911405 GTTTCTTCCTGCCCTGTTGGGGG + Intergenic
932729244 2:74206505-74206527 GCCTCTGCCTGCCCATCTGTGGG + Intronic
933810051 2:86027478-86027500 CCTTCTGCCTGCCTTGTGGTCGG - Exonic
935335257 2:102009776-102009798 GCTTCTGCCAGCCTTGCAGGAGG + Exonic
936066594 2:109337287-109337309 GCTCCCGGCAGCCCTGCTGTGGG - Intronic
936412994 2:112276350-112276372 GCTTCTGCCCGTCCAGGTGTCGG + Intronic
936509298 2:113132490-113132512 GCTCCTGTCTGCCATTCTGTGGG - Intronic
937074186 2:119089108-119089130 GCTTCCGACTGCCCTCCTGGGGG + Intergenic
938213276 2:129486285-129486307 GCTTGGGCCTGCCCTCCTGAAGG - Intergenic
938289142 2:130140298-130140320 CCATCTGCCTGCCCTGGTGCTGG + Exonic
938467384 2:131532640-131532662 CCATCTGCCTGCCCTGGTGCTGG - Exonic
940850280 2:158681883-158681905 ACCTCTGCCTACCCTACTGTGGG - Intronic
944199325 2:197089233-197089255 GATTCTGCTTTCACTGCTGTTGG - Intronic
946054012 2:216885459-216885481 GCTTAGGCATGGCCTGCTGTAGG - Intergenic
946291541 2:218749151-218749173 GCTTCTGCCTGCCTATCTCTGGG + Intronic
948219357 2:236257375-236257397 CCTCCTGCCTGCCCTGCCGTGGG + Intronic
1169267786 20:4177232-4177254 GCTCTTTCCTGCCCTGTTGTAGG + Intronic
1170592959 20:17785102-17785124 GCTTCTGTGTTTCCTGCTGTAGG + Intergenic
1171106502 20:22438514-22438536 GCTTCTGCCTGGGTTGCTGTTGG - Intergenic
1171369507 20:24652458-24652480 GCTTCTGCCTGTCCTACGCTGGG + Intronic
1172084304 20:32367688-32367710 GCTGCTGTCTGCACTGCTGTTGG + Intronic
1172446269 20:34995054-34995076 GCTGCTCACTGCCCCGCTGTTGG - Intronic
1172812695 20:37660922-37660944 GTTTCTAGCTGCCCTGCTCTGGG - Intergenic
1174079601 20:47961588-47961610 GGTGCTGCCTGCCCTCCTGGGGG + Intergenic
1175102815 20:56591936-56591958 TCTTATGTCTGCCCAGCTGTGGG - Intergenic
1175163863 20:57029382-57029404 GCTTTTGCCTTACCTGCTCTGGG + Intergenic
1175212979 20:57373079-57373101 GCTTCTGCCTCCCCAGCTGGAGG - Intronic
1175237201 20:57523109-57523131 GCATCTGCTTGACCAGCTGTAGG + Exonic
1175412208 20:58777746-58777768 CCTGCTGCCTGCCCTGCCCTGGG + Intergenic
1175956074 20:62610090-62610112 CCTGCTGCCCGCCCTGCTGTGGG + Intergenic
1176029147 20:63002696-63002718 GCCTCTGCCTTTCCTGCTGCCGG + Intergenic
1176035550 20:63034768-63034790 GCCTCTGCCTGCCCACCTGGCGG - Intergenic
1176171125 20:63696815-63696837 GGCGCTGCCTGCCCTGCTGCCGG + Exonic
1176738071 21:10571070-10571092 CCTGGTGCCCGCCCTGCTGTTGG + Intronic
1176867290 21:14060551-14060573 GCTGCTCCCTGCCCAGCTGCTGG - Intergenic
1177331107 21:19664235-19664257 TCTTCTGCCTACTGTGCTGTGGG + Intergenic
1179147869 21:38784510-38784532 GCCTCTGCCTGCTCTCCTTTGGG - Intergenic
1179514738 21:41898855-41898877 GCATCTGCCGGTCCTTCTGTGGG - Intronic
1179982475 21:44903523-44903545 GCTGCTGCCTGGCCTGCCGGTGG + Exonic
1180036648 21:45253786-45253808 GCTTCTCCCTGCCGTGGTGGGGG + Intergenic
1180119061 21:45734447-45734469 GCTTTTGCCTCCTGTGCTGTGGG + Intronic
1180152143 21:45954485-45954507 GCTTTTGCCTGCTCAGCTGCTGG - Intergenic
1180595379 22:16969735-16969757 GCTTCTGCCTGACTTGCCTTGGG + Intronic
1180706443 22:17813164-17813186 GCTGCTGCCTGACGTGCTTTTGG - Intronic
1180977952 22:19860859-19860881 TCTCCTTCCTGCCCTGCTGGTGG + Intergenic
1180998704 22:19977987-19978009 GCTCCTGCATGCCCTGCAGTCGG - Exonic
1182071299 22:27465611-27465633 GCTCCTGACTCCCCAGCTGTAGG - Intergenic
1182151105 22:28027793-28027815 GCCTGTCCCTGCCCTGCTGTGGG - Intronic
1182546443 22:31079443-31079465 CTTTCTCCCTGCCCTACTGTAGG - Intronic
1182958886 22:34453396-34453418 GCTTCTGCCTCCCTAGCTGCTGG - Intergenic
1183548722 22:38468892-38468914 CATTCTGGCTGCCCTGCTGGGGG + Intronic
1183711250 22:39504842-39504864 GCTTATTCCTGCCCTGCTGCTGG - Intronic
1184030727 22:41892871-41892893 GCTGCTCCCTGCCCTCCTGCTGG + Intronic
1184651210 22:45920225-45920247 GCTTCCTCCTGCCCCTCTGTGGG - Intergenic
1185352998 22:50347770-50347792 GCCTCTCTCTGCCCTGCTCTTGG + Intronic
950504637 3:13387107-13387129 GCAGCTGACTGCCCTCCTGTGGG + Intronic
950644808 3:14370866-14370888 CCTTCTGCCTGCCCTGCCCCAGG + Intergenic
950725839 3:14916393-14916415 CTTTCTGTCTGCCCTGCTGTGGG + Intronic
951091405 3:18577630-18577652 TCTTCAGCCTGCCCTGTGGTTGG - Intergenic
952175547 3:30858805-30858827 GCTCCTTTCTGCCCTGCTGTAGG - Intronic
952872202 3:37910942-37910964 GCTTCTGCTTCCCCTGCTGTGGG + Intronic
953095221 3:39768203-39768225 GCTTCTGGCTCACCTCCTGTAGG - Intergenic
954957030 3:54530263-54530285 TGTTCTGCCTGCGCTGCTGGTGG + Intronic
955387455 3:58491407-58491429 CCTCCTGCCTGCCCTGCATTGGG - Intergenic
956596289 3:70971112-70971134 GCTGCTGCCTTCCTTTCTGTTGG - Intronic
959098396 3:101982660-101982682 GCTTCTGCCAACCCTGCGCTCGG - Intergenic
960239448 3:115323224-115323246 GATACTGCCTGCCCAGCTCTTGG + Intergenic
960874664 3:122284726-122284748 GCTTCTGCCTCTCGGGCTGTGGG - Exonic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962143865 3:132819737-132819759 GCTTCTCTCTGCTCTCCTGTGGG - Intergenic
962401927 3:135067775-135067797 GCCTCTGGCTGCCCTCCTGAGGG + Intronic
962929322 3:140022598-140022620 GCTCCAGCCAGCCCTGCTGGAGG + Intronic
963128515 3:141836742-141836764 GCCTCTGCCTGCCTTCCTTTGGG + Intergenic
968017519 3:195351574-195351596 GCTTCAGCCTCCCCAGCAGTTGG + Intronic
968549688 4:1215842-1215864 GCGGCTGCCAGCCCTGCTGGGGG - Intronic
968913146 4:3485820-3485842 GCTTCTGCAAGCCCTGCTGAGGG + Intronic
970860710 4:20700021-20700043 CCATCTGCATGCCCAGCTGTGGG - Intronic
973345378 4:49049274-49049296 GCTTCTGCTGGTCCTGCTCTGGG + Intronic
975744972 4:77466617-77466639 GCCTCCCCCTGCCCTGCTGTGGG + Intergenic
976337319 4:83905346-83905368 GCTTTTTCCTGCACTGATGTTGG + Intergenic
979840391 4:125432172-125432194 GCTGCTTCCTGCGCTGCTTTGGG - Intronic
980585395 4:134807463-134807485 TCTTGTGACTGCCCTGCTTTGGG - Intergenic
981498162 4:145416635-145416657 GCTTCTACCTGCCCTCATGCAGG - Intergenic
982112167 4:152066748-152066770 CTTTCTCCCTGCCCTGCTGTAGG - Intergenic
983838777 4:172428528-172428550 GCCTCTGCTTGCCCTTCCGTGGG - Intronic
984803225 4:183733362-183733384 GCCTCTCTCTGCCCTCCTGTGGG + Intergenic
985233691 4:187849710-187849732 GCTTCTGCCTGGCCTGATTAAGG - Intergenic
985835293 5:2267000-2267022 GCTTCCGCCTGCCCTGTGGTTGG - Intergenic
986336281 5:6758326-6758348 GCTTCTGCATGAGCTGCGGTGGG + Intergenic
986431986 5:7690696-7690718 GCTTCTGCTCTCCCTGCTGCCGG + Exonic
988675362 5:33427875-33427897 GGAGTTGCCTGCCCTGCTGTAGG + Intergenic
988789962 5:34598671-34598693 GGTTCTGTCTTCCCTGCTGCTGG - Intergenic
992528823 5:77636958-77636980 GCTTCTGTTGGCCCTGCTGCTGG + Exonic
997943854 5:138182186-138182208 GCTTCTTCCTGCAATGCTGCTGG - Intronic
998038415 5:138935704-138935726 GGTTCTGCCTGCCTTACTGGGGG + Intergenic
998096202 5:139396738-139396760 GCCTCTGCCTTCTCTGCTCTGGG - Intronic
999755487 5:154661268-154661290 TCCTCTGCCTGCCCTGCTGGAGG + Intergenic
999759309 5:154688170-154688192 GCCTGTGGCTGCCCTGATGTTGG + Intergenic
1001205064 5:169754663-169754685 ACTACTGCCTGTCATGCTGTAGG - Intronic
1001778590 5:174348022-174348044 GCACCTGTCTGCCCTGCTCTTGG - Intergenic
1002463588 5:179389647-179389669 GCTACTGCCTGCCATCTTGTGGG + Intergenic
1002575089 5:180169933-180169955 GCTTCTGCCTGCCCCTCCCTCGG + Intronic
1002854646 6:1026316-1026338 GCTTCTGTGTGCCCTTCCGTCGG - Intergenic
1003051238 6:2782873-2782895 CCTTCTGCCAGCCTTGGTGTGGG - Intronic
1003277642 6:4666078-4666100 TCTTCTGCCTGTCCTTCTCTTGG - Intergenic
1003599659 6:7505430-7505452 GCTCCTGCCTTCCCTTCTTTTGG + Intergenic
1004123265 6:12846885-12846907 GCTTCTGCCTCCCATGCTCAAGG + Intronic
1004369340 6:15038617-15038639 GCTTCTGCCTTCCAAGCTGGTGG + Intergenic
1004556664 6:16705099-16705121 GCTTCTGTGTGAACTGCTGTGGG - Intronic
1005363794 6:25057216-25057238 GCGTCTTCCTGCCCTGTAGTAGG + Intergenic
1005807395 6:29487594-29487616 TCTTCTGGCTGCTTTGCTGTGGG - Exonic
1006787320 6:36677278-36677300 GCTTCTTTCTCCTCTGCTGTGGG - Intronic
1006830216 6:36963908-36963930 GCTCCTGCCTCCTCTGGTGTTGG + Exonic
1007256432 6:40532586-40532608 GCCTCTGCCTGCCCTGCCTACGG + Intronic
1007280605 6:40709539-40709561 GCTCCTGCCTTCCCTCCTCTAGG - Intergenic
1007476865 6:42124792-42124814 GCTTCTGACTCCTCTCCTGTAGG - Intronic
1007583834 6:42976475-42976497 GCTTCAGCCTCCCCAGTTGTTGG + Intronic
1007584406 6:42979926-42979948 TCTGCTGCCTGCCCCGCTCTAGG - Intergenic
1007610458 6:43145593-43145615 GCTTCTGCCTTCCCTGCTCTTGG + Intronic
1009591088 6:65672104-65672126 GCTTCTGTCTGCTATACTGTAGG - Intronic
1010438180 6:75859986-75860008 GCTTCTGCCTACTCTGCTGCTGG + Intronic
1013604060 6:111731812-111731834 GTCTCTGCCTTCCCTGATGTTGG + Intronic
1013610373 6:111788965-111788987 GCTTGAGTCTGCCCTCCTGTTGG - Intronic
1015462574 6:133509548-133509570 GCATCTGCCTTCTCTGCAGTTGG - Intronic
1015889028 6:137950804-137950826 GCCTCTTCCTGTCCAGCTGTCGG - Intergenic
1017108012 6:150906385-150906407 GCTGCTGGCTGCCCTGTTGCGGG - Intronic
1017927376 6:158922168-158922190 CCACCTGCCTGCCCAGCTGTGGG + Intergenic
1019009733 6:168834392-168834414 GCTTCACCCTGCCCAGCTGCAGG + Intergenic
1019522224 7:1466177-1466199 CCCTCCGCCTGCCCTGCTGGTGG + Intergenic
1020634832 7:10684589-10684611 GCCTCTGGCTGCCCTCCTGAAGG - Intergenic
1022094700 7:27131142-27131164 CCCTCTGCCTGCCCTACTGCTGG + Intronic
1022258331 7:28681065-28681087 CATTCTGCCATCCCTGCTGTGGG + Intronic
1022632952 7:32102793-32102815 GCTTCTCCATGGCCTGCTCTTGG - Intronic
1022645995 7:32228929-32228951 GCCTTTGCCTGCCCTGCAGGAGG - Intronic
1024970954 7:55069722-55069744 GCATCTACCAGCCCTGCTGTGGG - Intronic
1025036343 7:55594574-55594596 GCTTCTCCGTGCCCTGCTACAGG - Intergenic
1025713082 7:63929882-63929904 GCTTCTGCATCCCCTGATGTTGG - Intergenic
1026287047 7:68972415-68972437 TCTCCTGCCTGCCTTGCTCTGGG - Intergenic
1026883244 7:73920610-73920632 GCCTCTGCCTGCGCCCCTGTGGG - Intergenic
1026972045 7:74474361-74474383 TTTTCTGCCTGCCCTGCTAGAGG - Intronic
1028405057 7:90465639-90465661 CCATCTCCCTTCCCTGCTGTGGG + Intronic
1029258681 7:99286707-99286729 GCTTTTGCCTCCCCAGGTGTTGG - Intergenic
1029699598 7:102237630-102237652 CCTTCTGCCTCCCCAGGTGTAGG + Intronic
1030121335 7:106112887-106112909 ACTTCTGGCTACCGTGCTGTGGG + Intergenic
1031980809 7:128123108-128123130 GCTTCTTCCAGCCCCGATGTTGG - Intergenic
1031995493 7:128227755-128227777 GCTTCTTCCTTCCCTCCTCTCGG - Intergenic
1033246194 7:139718293-139718315 GCTTCTGCAAGCCCTGTTGGGGG + Intronic
1033352605 7:140573822-140573844 TCTTCTTCCTGCCGTTCTGTGGG + Exonic
1033545885 7:142399883-142399905 GTGTCTCCCAGCCCTGCTGTGGG - Intergenic
1033548577 7:142424971-142424993 GTGTCTCCCAGCCCTGCTGTGGG - Intergenic
1033553488 7:142468642-142468664 GCTTCTATCTGCAGTGCTGTAGG - Intergenic
1035099240 7:156382680-156382702 GCTTCCTCCTCCCCTGCTGGGGG + Intergenic
1035271585 7:157722947-157722969 GCATCGCCCTGCCCTGCTGGCGG - Intronic
1035368617 7:158364183-158364205 GGTTCTGCAGACCCTGCTGTGGG - Intronic
1035368668 7:158364411-158364433 GGCTCTGCATACCCTGCTGTGGG - Intronic
1035474971 7:159136872-159136894 GCTGCTTCCTGTCCTGCTGGTGG - Intronic
1035732271 8:1861349-1861371 CCTCCTGCCGGCCCTGCTGTAGG + Intronic
1035790054 8:2296245-2296267 GCTTCGGCCTGCGGTGCTGTGGG + Intergenic
1035802751 8:2425460-2425482 GCTTCGGCCTGCGGTGCTGTGGG - Intergenic
1036582146 8:10085154-10085176 GGCTCTTCCTGCCCTCCTGTGGG + Intronic
1036677941 8:10850687-10850709 AGTTGTGCCTGGCCTGCTGTGGG - Intergenic
1040081809 8:43292570-43292592 GCTGCTGCTTCCCCTGCTGCAGG + Intergenic
1040463988 8:47677687-47677709 ACTTCTGCCTGTCCTGTTTTGGG - Intronic
1041668284 8:60467208-60467230 GCTTCTGCCTCCCCAAGTGTTGG + Intergenic
1041789234 8:61673327-61673349 CCTTCAGCCTGCCTTGCTTTGGG - Intronic
1042940644 8:74103785-74103807 GCTTCTGCCTGCATTTCTGCAGG - Intergenic
1044506022 8:93020546-93020568 GTTTCTGGCTTCCCTGCAGTTGG - Intergenic
1044744208 8:95356492-95356514 GCATCTCCCTGCCCAGCAGTGGG + Intergenic
1049185983 8:141253832-141253854 CCTTCAGCCTGCCCTGATGGTGG - Intronic
1049418743 8:142507487-142507509 GCTGCTGCCTACTCTGCTGAGGG - Intronic
1049600950 8:143507281-143507303 GCTACTCCTTGCCCTGCTGCTGG - Intronic
1049813949 8:144589412-144589434 GCTTCCCGCTGCCCTGCTCTGGG - Intronic
1051604732 9:18908235-18908257 GCTGGTGCCACCCCTGCTGTTGG + Intronic
1053147105 9:35719172-35719194 GCTGCTGGCTGCCTTGCTGGAGG - Exonic
1054769212 9:69068550-69068572 GCTGCTGCTGGCCCTCCTGTGGG + Intronic
1056581349 9:87889627-87889649 GCTGCTGCCTGCCCCTCTGGTGG + Intergenic
1056794562 9:89648793-89648815 GCTGCTGACTGCCCTGCAGGAGG - Intergenic
1056937933 9:90931938-90931960 CCTTCTCACTGACCTGCTGTGGG - Intergenic
1057203482 9:93156510-93156532 GCCCCGGCCTGCCCAGCTGTTGG - Intergenic
1057851777 9:98571708-98571730 GTTTCAGCCAGGCCTGCTGTTGG - Intronic
1058493333 9:105526415-105526437 CCATCTACCTGCGCTGCTGTGGG - Intronic
1059327288 9:113511824-113511846 GGTTTTGCCTTCTCTGCTGTAGG + Intronic
1059706217 9:116825974-116825996 GCTCCTTACTGCCCTGCTGCAGG + Intronic
1060485308 9:124042566-124042588 GCTCCAGCTTGCCCTGCTCTGGG + Intergenic
1061285491 9:129620253-129620275 GCTGCCGCCTCCCCTGCTGTCGG - Exonic
1061991225 9:134159763-134159785 GCCTGTGGCTGCCCTGCTGTGGG + Exonic
1062058827 9:134483624-134483646 TGTGCTGCCTGCCCTGCTGAGGG + Intergenic
1062535446 9:137019201-137019223 GCTGCAGCCTGCCCTGCTCCAGG + Exonic
1187143023 X:16612747-16612769 CCTTCTGCCACCACTGCTGTGGG - Intronic
1187572872 X:20522532-20522554 GCTGATGCCTGCCTTGCTGCTGG - Intergenic
1190632197 X:52398942-52398964 GCCTCTGGCTGCCCTCCTGAAGG + Intergenic
1191171627 X:57453602-57453624 GCAGTTGCCTGACCTGCTGTTGG - Intronic
1191174245 X:57482541-57482563 GCTTCTGCTCACCCTCCTGTGGG + Intronic
1192522754 X:71816083-71816105 GCCTGTGGCTGCCCCGCTGTTGG + Intergenic
1194588308 X:95765310-95765332 CCTTGTGGCTGACCTGCTGTTGG + Intergenic
1194759209 X:97774378-97774400 GCTTGTAGCTGCCCTGCTGGAGG + Intergenic
1196013543 X:110913898-110913920 TCTTCTGCATGCCCTGCTCCAGG - Intergenic
1196170829 X:112587182-112587204 GCCTCTGGCTGCCCTTCTGAAGG - Intergenic
1196757162 X:119167964-119167986 ACTTCTAGCTGCCCTGGTGTTGG - Intergenic
1199678775 X:150210226-150210248 ACTTCTGCCTGCCATGGTATTGG - Intergenic
1199858838 X:151781495-151781517 CCTTCTGCCAGGCCTGCTGCTGG - Intergenic
1200426070 Y:3021694-3021716 TCTTCTGCCTGCCTAGATGTTGG + Intergenic
1202596323 Y:26544367-26544389 CCTGGTGCCCGCCCTGCTGTTGG + Intergenic