ID: 925215318

View in Genome Browser
Species Human (GRCh38)
Location 2:2089639-2089661
Sequence CTCATTATACAGATGGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925215314_925215318 -6 Left 925215314 2:2089622-2089644 CCATTTGGTCCAATCTTCTCATT 0: 1
1: 1
2: 1
3: 27
4: 399
Right 925215318 2:2089639-2089661 CTCATTATACAGATGGACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925215318 Original CRISPR CTCATTATACAGATGGACGG AGG Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
903575520 1:24337432-24337454 CTCATTATTCAGCAGGACTGTGG + Intronic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
914522324 1:148428765-148428787 TTCATTATACAGCTGGACGATGG - Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
918693835 1:187517116-187517138 CTCATTTTTCAGATAGATGGTGG + Intergenic
920353337 1:205352263-205352285 CTCACTCTCCAGATGGAAGGAGG + Intronic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1065001384 10:21340727-21340749 TTCATTGAGCAGATGGACGGGGG + Intergenic
1072436671 10:95420562-95420584 TTCATTAGACAGAGGGACTGGGG - Intronic
1074060122 10:109957633-109957655 CTCATTACAGAGCAGGACGGTGG + Intergenic
1074268798 10:111931910-111931932 AGCATTATACAGATGGACCATGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1077296410 11:1828334-1828356 CTCACTACTCAGATGGTCGGAGG + Intronic
1078632051 11:13011313-13011335 CTCATTAAAGAGAGGGAAGGAGG + Intergenic
1081825107 11:46042651-46042673 CTCATAATACAGTTGCACTGGGG - Intronic
1087320548 11:96652748-96652770 CTCATTATACTTATGGAATGGGG - Intergenic
1091047403 11:132336836-132336858 CTCATTCTACAGCGGGGCGGGGG + Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1096235888 12:49926069-49926091 CTCATTCTACAGAGAAACGGAGG + Intergenic
1098954103 12:76670690-76670712 CTCATTTTACATATGGACAGAGG - Intergenic
1103123574 12:118401087-118401109 TTCATTTTACAGTTGGAAGGTGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1109020606 13:57086138-57086160 CTCAATATACAGAGAGACTGTGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1111995556 13:95162790-95162812 ATCATTATACGGATGGGCAGGGG - Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1118213875 14:63790001-63790023 CTCATTCTACAGAGGGAGGGTGG - Intergenic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1133496792 16:6326079-6326101 CTCCTTAAACAGAGGGACTGAGG - Intronic
1135983808 16:27168980-27169002 TTCATTATACATATGAACTGAGG - Intergenic
1140259451 16:73364919-73364941 CTCATTCTACAGGTGGACCATGG - Intergenic
1143289323 17:5817039-5817061 CTCAGTGTACAGATGCGCGGAGG + Intronic
1148085678 17:44992494-44992516 TTCATTATCCAGAGGGACAGAGG + Intergenic
1152700814 17:81818065-81818087 CTCATTTTACAGAAGTACAGGGG + Intergenic
1157147595 18:45180274-45180296 CTCATTTTACAGATGAACAGAGG - Intergenic
1159863717 18:73680547-73680569 CTCATTTTACAGATGAAAGGAGG + Intergenic
925106952 2:1299808-1299830 CTCATTTTACAGATGACAGGTGG - Intronic
925215318 2:2089639-2089661 CTCATTATACAGATGGACGGAGG + Intronic
926766392 2:16326006-16326028 CTCATTTTACAGATGAAAAGTGG + Intergenic
930956119 2:57204872-57204894 CTCTTTATACAGAGGGACTTTGG - Intergenic
931202073 2:60106993-60107015 TTCAGGATACAGATGGAGGGAGG + Intergenic
931775310 2:65535393-65535415 GTCATTATACAGATGCCAGGAGG + Intergenic
936889884 2:117356887-117356909 AGCATTATAGAGATGGATGGTGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939386314 2:141503585-141503607 CAAATTATACAGATAGAAGGAGG - Intronic
941950803 2:171154376-171154398 CTCATTTTACAGATGAAAAGAGG + Intronic
1169045618 20:2532546-2532568 CTCGATATACAGATGAACAGTGG + Intergenic
1169823671 20:9742401-9742423 CTCATTAATCAGATGGAAGTGGG + Intronic
1175057920 20:56214880-56214902 CTCATTCTACGGATGGAATGAGG - Intergenic
949369592 3:3319743-3319765 CACATTACACAGATGTAAGGAGG - Intergenic
956428453 3:69160700-69160722 CCCATTTTACAGATGGGAGGGGG - Intergenic
959885808 3:111498054-111498076 CTGATTCTTCAGATGGAAGGTGG - Intronic
961737488 3:129011131-129011153 CTCATTTTACAGATGAGCTGAGG - Intronic
963095329 3:141532553-141532575 CTCATTTTACAGATGAACTTAGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
967100772 3:186213768-186213790 ATCATTATGCAGATGGTCAGTGG + Intronic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
974827937 4:67153047-67153069 CTCATCTTGCAGATGGACAGAGG - Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
988147137 5:27324243-27324265 CTCATTGTACAGATGAATGGGGG + Intergenic
996442412 5:123507008-123507030 CTCATTTTACAGATGAGCTGAGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998114194 5:139523957-139523979 CTATTGATACAGAAGGACGGGGG + Intergenic
998227499 5:140338333-140338355 CCCATTTTAAAGATGGACTGAGG + Intronic
998692976 5:144607738-144607760 CTCATTTTACAGATGAAAGGAGG - Intergenic
1002937810 6:1688325-1688347 CCCATTACACAGATGAACGACGG + Intronic
1003860817 6:10320093-10320115 TTCATGATACAGAGGGAGGGAGG - Intergenic
1012515995 6:100060209-100060231 CTCATTTTTGAGATTGACGGTGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1021633501 7:22668633-22668655 CTCATTATCCAAATGAAGGGCGG + Intergenic
1028239090 7:88397698-88397720 ATGATTATACAGATGGTAGGTGG - Intergenic
1030335564 7:108322083-108322105 CTCATTATAAAGATGAAATGAGG + Intronic
1033858427 7:145594576-145594598 CCCATTATACAGAAGGTCAGCGG + Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037932774 8:22892359-22892381 AGCATTATGCAGATGGATGGTGG - Intronic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046690638 8:117280771-117280793 CCCATTTTACAGATGCATGGAGG + Intergenic
1057252775 9:93517118-93517140 CCCATTTCACAGATGGACAGAGG - Intronic
1060103332 9:120858276-120858298 CTTCTGATACAGATGGACAGTGG - Exonic
1199474304 X:148228984-148229006 CTCATTATACTGATGGAAAGAGG + Intergenic
1201532470 Y:15007041-15007063 CACATTATTAAGATGGAAGGTGG + Intergenic