ID: 925217528

View in Genome Browser
Species Human (GRCh38)
Location 2:2110414-2110436
Sequence CAGAAGCTAACATGGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925217528_925217536 22 Left 925217528 2:2110414-2110436 CCTCCAACCCATGTTAGCTTCTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 925217536 2:2110459-2110481 TCCAAGTTTCCCAAAGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 209
925217528_925217534 20 Left 925217528 2:2110414-2110436 CCTCCAACCCATGTTAGCTTCTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217528_925217535 21 Left 925217528 2:2110414-2110436 CCTCCAACCCATGTTAGCTTCTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 925217535 2:2110458-2110480 CTCCAAGTTTCCCAAAGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925217528 Original CRISPR CAGAAGCTAACATGGGTTGG AGG (reversed) Intronic