ID: 925217529

View in Genome Browser
Species Human (GRCh38)
Location 2:2110417-2110439
Sequence AAACAGAAGCTAACATGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 453}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925217529_925217534 17 Left 925217529 2:2110417-2110439 CCAACCCATGTTAGCTTCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 453
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217529_925217536 19 Left 925217529 2:2110417-2110439 CCAACCCATGTTAGCTTCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 453
Right 925217536 2:2110459-2110481 TCCAAGTTTCCCAAAGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 209
925217529_925217535 18 Left 925217529 2:2110417-2110439 CCAACCCATGTTAGCTTCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 453
Right 925217535 2:2110458-2110480 CTCCAAGTTTCCCAAAGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925217529 Original CRISPR AAACAGAAGCTAACATGGGT TGG (reversed) Intronic