ID: 925217530

View in Genome Browser
Species Human (GRCh38)
Location 2:2110421-2110443
Sequence GTAAAAACAGAAGCTAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925217530_925217535 14 Left 925217530 2:2110421-2110443 CCCATGTTAGCTTCTGTTTTTAC 0: 1
1: 0
2: 1
3: 26
4: 315
Right 925217535 2:2110458-2110480 CTCCAAGTTTCCCAAAGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 228
925217530_925217534 13 Left 925217530 2:2110421-2110443 CCCATGTTAGCTTCTGTTTTTAC 0: 1
1: 0
2: 1
3: 26
4: 315
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217530_925217536 15 Left 925217530 2:2110421-2110443 CCCATGTTAGCTTCTGTTTTTAC 0: 1
1: 0
2: 1
3: 26
4: 315
Right 925217536 2:2110459-2110481 TCCAAGTTTCCCAAAGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925217530 Original CRISPR GTAAAAACAGAAGCTAACAT GGG (reversed) Intronic