ID: 925217532

View in Genome Browser
Species Human (GRCh38)
Location 2:2110443-2110465
Sequence ACTTGGAGGTTATTCTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925217532_925217536 -7 Left 925217532 2:2110443-2110465 CCACTTCAGAATAACCTCCAAGT 0: 1
1: 0
2: 2
3: 2
4: 139
Right 925217536 2:2110459-2110481 TCCAAGTTTCCCAAAGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 209
925217532_925217535 -8 Left 925217532 2:2110443-2110465 CCACTTCAGAATAACCTCCAAGT 0: 1
1: 0
2: 2
3: 2
4: 139
Right 925217535 2:2110458-2110480 CTCCAAGTTTCCCAAAGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 228
925217532_925217534 -9 Left 925217532 2:2110443-2110465 CCACTTCAGAATAACCTCCAAGT 0: 1
1: 0
2: 2
3: 2
4: 139
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217532_925217541 19 Left 925217532 2:2110443-2110465 CCACTTCAGAATAACCTCCAAGT 0: 1
1: 0
2: 2
3: 2
4: 139
Right 925217541 2:2110485-2110507 CTTTTCTGCTCTCACTCGATTGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925217532 Original CRISPR ACTTGGAGGTTATTCTGAAG TGG (reversed) Intronic