ID: 925217534

View in Genome Browser
Species Human (GRCh38)
Location 2:2110457-2110479
Sequence CCTCCAAGTTTCCCAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925217532_925217534 -9 Left 925217532 2:2110443-2110465 CCACTTCAGAATAACCTCCAAGT 0: 1
1: 0
2: 2
3: 2
4: 139
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217528_925217534 20 Left 925217528 2:2110414-2110436 CCTCCAACCCATGTTAGCTTCTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217531_925217534 12 Left 925217531 2:2110422-2110444 CCATGTTAGCTTCTGTTTTTACC 0: 1
1: 0
2: 1
3: 28
4: 321
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217529_925217534 17 Left 925217529 2:2110417-2110439 CCAACCCATGTTAGCTTCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 453
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217530_925217534 13 Left 925217530 2:2110421-2110443 CCCATGTTAGCTTCTGTTTTTAC 0: 1
1: 0
2: 1
3: 26
4: 315
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925217534 Original CRISPR CCTCCAAGTTTCCCAAAGCC AGG Intronic
900456637 1:2778084-2778106 CCCCCAAGTTTCCCACTGGCAGG - Intronic
900530203 1:3149331-3149353 GCTCCGAGATTCCCAAAACCAGG + Intronic
902887159 1:19413787-19413809 CCTTCAAGATCCCCAAAGGCAGG + Intronic
905293884 1:36942094-36942116 CCTCCAGGTCTCCCAACCCCAGG - Intronic
906875557 1:49534447-49534469 CATACACCTTTCCCAAAGCCAGG + Intronic
912194071 1:107377312-107377334 CCTCCAAGCTCCCCACTGCCTGG + Intronic
913489794 1:119368357-119368379 CCTCCAAAATCCCCAAAGCTCGG + Intergenic
915520862 1:156442601-156442623 CCTCAAAGTTTCACGAAGGCAGG + Intergenic
915661067 1:157405428-157405450 CCTTCTTGTTTACCAAAGCCTGG - Intergenic
916197666 1:162239996-162240018 CCTCCAGGCTTCCCAGTGCCTGG + Intronic
917453376 1:175165718-175165740 CTTCCAAGGGTCCCAAAGCCTGG - Intronic
917687388 1:177431227-177431249 CATCCATGTTTCCCAAAGAAAGG - Intergenic
920364040 1:205438757-205438779 CCACCCATGTTCCCAAAGCCAGG + Intronic
922148026 1:222968322-222968344 CTGCCCAGTTTCCCAAAACCTGG + Intronic
923541343 1:234890460-234890482 CCTCCCAGTCTCCCAAAGACCGG + Intergenic
1062794670 10:335558-335580 CCTAGAATCTTCCCAAAGCCTGG - Intronic
1067695602 10:48533389-48533411 CCTACATATTTGCCAAAGCCAGG - Intronic
1067716417 10:48694303-48694325 CCTCCTAGTTGGACAAAGCCAGG + Intronic
1069881803 10:71597931-71597953 CTTCCCAGTTGCCCACAGCCTGG - Intronic
1069897254 10:71687425-71687447 CCTGCATGTTTCCCCAAGGCTGG + Intronic
1070139748 10:73730398-73730420 CTTCCCAGTGCCCCAAAGCCAGG + Intergenic
1073941600 10:108705576-108705598 CCTCAAACTTTCCAACAGCCGGG + Intergenic
1074791120 10:116888641-116888663 CCTCCAGCTTTTCCAAATCCTGG - Intronic
1075849208 10:125573796-125573818 CCCCCAAGTTTCCCCAAGGTGGG + Intergenic
1076029793 10:127147604-127147626 CCTCCCAGTCTCCCAGGGCCTGG + Intronic
1077226947 11:1442743-1442765 CCTCCCAGTACCCCACAGCCTGG + Intronic
1077751772 11:4978805-4978827 TCTCCTATTTTCCCAACGCCAGG + Intronic
1077819076 11:5718255-5718277 CCTCCAAGATTGGCAAAGTCTGG + Intronic
1078454111 11:11461861-11461883 GCTGCAGGTTTCCCAAAGCAAGG - Intronic
1078897754 11:15612646-15612668 CCCCCAAGTCTCCCAAACCCAGG + Intergenic
1079218869 11:18540837-18540859 ACTCAAAGTTTCCTAAAGACAGG + Intronic
1079384491 11:19966743-19966765 CCTCTGAGTTTCCAAACGCCTGG + Intronic
1080691740 11:34564328-34564350 TCACCAGGTTTCCCAGAGCCGGG - Intergenic
1081713034 11:45230220-45230242 CCTCCAACTGTCCCACTGCCAGG + Intronic
1082193479 11:49274217-49274239 CCCCCCAGTTCCCCAAAGGCTGG + Intergenic
1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG + Intronic
1084662913 11:70557664-70557686 CCTCCAAGATTCCCACAGTCTGG + Intronic
1084709005 11:70832474-70832496 CCTCCCAGCTTCTCAAAGGCAGG + Intronic
1086055101 11:82636886-82636908 CCTCCACATTTCCCAAAGGGTGG + Intergenic
1086689118 11:89768818-89768840 CCACCATGTCTCCCAAATCCTGG + Intergenic
1088070998 11:105784968-105784990 CCTCAGTGTTTCCCAAACCCTGG - Intronic
1089079410 11:115763319-115763341 CCAGCTAGATTCCCAAAGCCAGG + Intergenic
1090235005 11:125140522-125140544 CCTGCCAGTCTCCCACAGCCAGG + Intergenic
1091828334 12:3531851-3531873 CAACCAAGATTCCCAGAGCCGGG - Intronic
1092409749 12:8243741-8243763 CCTCCCCGTTTCCCACACCCTGG - Intergenic
1095095628 12:38146970-38146992 TCTCCATGTTTTCCCAAGCCAGG + Intergenic
1096569647 12:52514708-52514730 CCTTCAGGTTTCCCACAGCATGG - Exonic
1098596616 12:72279751-72279773 CCTCCAAGCTTCTGAATGCCTGG + Intronic
1099776494 12:87138184-87138206 CCTCCAAGTACCCCAACCCCTGG + Intergenic
1099958348 12:89373057-89373079 CCTCTAAGTTTCTCTAAGACTGG + Intergenic
1101734201 12:107450770-107450792 CCTCCACCTCTCCCAAAGCAGGG - Intronic
1102748287 12:115269223-115269245 CCTCCAGGTTTCCCTGAGCATGG + Intergenic
1105830462 13:24160074-24160096 CCTACATGTTTCCCAGGGCCTGG - Intronic
1107288770 13:38827565-38827587 TCTTCAAGCTTCCCAAAGGCAGG - Intronic
1107632918 13:42360973-42360995 CCTAGAAGTTTCCCAAAAACTGG - Intergenic
1108337414 13:49459245-49459267 CCTCCAAGTTTGGCAAAGAAGGG - Intronic
1112656284 13:101455102-101455124 CCTACAAATTTGCCAAACCCTGG - Intronic
1117516580 14:56507821-56507843 CCCCCAAGTTTCCCAGCCCCAGG - Intronic
1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG + Intronic
1119711992 14:76829083-76829105 CCTCCCAGTTTCCCCAAGAAGGG + Intronic
1120095123 14:80379880-80379902 TCTGCAAGTTTCCAAAATCCTGG - Intronic
1121018202 14:90561554-90561576 CATCTAATTTTCCCACAGCCCGG + Intronic
1121447873 14:93989568-93989590 ATTCTAAGTATCCCAAAGCCAGG - Intergenic
1124624672 15:31301096-31301118 CCTCAGAGTTTCCCAGAGCTGGG + Intergenic
1127433165 15:58932180-58932202 GCTACAAGTCACCCAAAGCCTGG + Intronic
1127737575 15:61858528-61858550 TCTCCAAGATTCCCCAACCCTGG + Intronic
1128053419 15:64682647-64682669 ACTCCAAGGTTCCCCAAGCTGGG - Exonic
1130089671 15:80810085-80810107 CCACCAAGATTCCCAGAACCTGG - Intronic
1132797461 16:1732258-1732280 CCCCCAAGCCTCCCACAGCCAGG + Intronic
1132997029 16:2828810-2828832 CACCCAAGTTTTCCACAGCCAGG + Intergenic
1133312615 16:4859947-4859969 AGTCCAAGTTTTCCAAAGCCGGG + Exonic
1134692236 16:16198361-16198383 CCTCCAAGATCCCTAAAGCACGG + Intronic
1135770159 16:25212064-25212086 CTTCCTAGTTTTCCAAATCCAGG - Intergenic
1135923946 16:26675864-26675886 CCTCCCAGTTTAGCAATGCCAGG + Intergenic
1138886737 16:61089443-61089465 TTTCCAAGTTTCCCAAAGAAAGG + Intergenic
1138948619 16:61883095-61883117 CCTCCAAGGAGCACAAAGCCTGG - Intronic
1139297706 16:65917651-65917673 CCTCCAAATTGCTCCAAGCCTGG + Intergenic
1140475837 16:75238876-75238898 CCTCCCAGCCTCCCAAAGGCAGG + Intronic
1140759887 16:78100950-78100972 CATCCATGTTTCTCAAAACCAGG - Intronic
1141463385 16:84191473-84191495 CCCCCAAGTTTTCCCACGCCCGG - Exonic
1141749241 16:85947113-85947135 CCTGCCAGGTTCCCCAAGCCTGG - Intergenic
1144336613 17:14277101-14277123 CCTTCAAGTATCCCACAGACAGG + Intergenic
1146263766 17:31437960-31437982 CCTCAAAGTTTCCCTCTGCCAGG - Intronic
1146398245 17:32485559-32485581 CCCCCAAGGTTCCTAAAGCCTGG + Intergenic
1146908934 17:36635553-36635575 CCTCCTGGTTTCGCAAAGCATGG + Intergenic
1148160506 17:45447286-45447308 CCTCTTCTTTTCCCAAAGCCTGG + Intronic
1149337006 17:55645558-55645580 CCAAGCAGTTTCCCAAAGCCAGG - Intergenic
1150391796 17:64794166-64794188 CCTCTTCTTTTCCCAAAGCCTGG + Intergenic
1151541167 17:74765141-74765163 CCTCCAGGTTTCCCACTGGCTGG + Intronic
1151897322 17:76989197-76989219 CTTCCCAGTTTCCTAAACCCTGG - Intergenic
1152043450 17:77920178-77920200 CCTGCAATTTTCCCAAATGCAGG + Intergenic
1152254573 17:79230207-79230229 CCTCCAAGCCTCTCAAAGACTGG - Intronic
1155403984 18:25467727-25467749 AGTCCAAGTTTGCCACAGCCTGG + Intergenic
1155822237 18:30391836-30391858 CCTCAAAGTTTCACATAGCTAGG + Intergenic
1156156670 18:34311004-34311026 CCTCCATGCATACCAAAGCCTGG + Intergenic
1159120002 18:64157855-64157877 CCTCCCTCTTTCCCAAAACCTGG - Intergenic
1159857873 18:73611013-73611035 CTTCTAATTCTCCCAAAGCCAGG - Intergenic
1160970394 19:1765326-1765348 CCTCCAGCTGTCCCGAAGCCTGG + Intronic
1163658803 19:18564215-18564237 TCTAGAAGTTTCCCAGAGCCAGG - Intronic
1168071388 19:53954124-53954146 CCTCCAAGATTCCCACCGCCTGG - Intergenic
925067345 2:938610-938632 CCCCCCACATTCCCAAAGCCTGG + Intergenic
925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG + Intronic
925811705 2:7707804-7707826 CCTCAAAGTTTCCCTGAGCCAGG + Intergenic
925976646 2:9146546-9146568 CATCCTAGTTCCCCAAAACCTGG + Intergenic
927041935 2:19238770-19238792 CCTCAATGTTTCTCAGAGCCGGG + Intergenic
927725027 2:25415531-25415553 TATCCAAGATTCCCGAAGCCCGG - Intronic
931060194 2:58520038-58520060 CCTCTAAGCTTCCCAAACCTTGG - Intergenic
931440707 2:62288220-62288242 CCCTCAAATTCCCCAAAGCCAGG - Intergenic
933766021 2:85710291-85710313 CCTCCAAGTGTCCCAAAGCGTGG - Intergenic
936979998 2:118255513-118255535 CTTCCCAGGTTCCCACAGCCGGG + Intergenic
937231198 2:120399052-120399074 CCCCCAAGCTTCCTAAGGCCGGG - Intergenic
938899949 2:135791389-135791411 CCTTCAAGTGTCCAAGAGCCTGG + Intronic
939649714 2:144745698-144745720 CCTCCAAGTAGCCCAACTCCAGG + Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946275182 2:218626315-218626337 GCTCCAGGTTTCACAAGGCCTGG - Intronic
946499296 2:220228751-220228773 CCTCCAGGAATTCCAAAGCCAGG - Intergenic
947110270 2:226710794-226710816 CCACTTAGTTTCCCTAAGCCTGG + Intergenic
948827541 2:240579976-240579998 CTGCTGAGTTTCCCAAAGCCAGG - Exonic
949000723 2:241611231-241611253 CCTCCAGGCTTCCCAAGTCCAGG - Intronic
1169871762 20:10255198-10255220 CTGCCAAGTTTCCAAAAGACTGG + Intronic
1170620399 20:17990947-17990969 CATTTAAGTTTCCCAAACCCAGG - Exonic
1173537018 20:43823234-43823256 CTCCCAATGTTCCCAAAGCCTGG - Intergenic
1173556616 20:43970753-43970775 TCTCCAAATCTCCCAGAGCCTGG - Intronic
1174832204 20:53823339-53823361 CCTCAATGTGGCCCAAAGCCTGG - Intergenic
1178483733 21:33003936-33003958 CCTTGTAGTTTCCCACAGCCAGG - Intergenic
1179951155 21:44709420-44709442 CCCACAACTTCCCCAAAGCCTGG + Intronic
1184322418 22:43752605-43752627 CCTCCCTGTGTCCCACAGCCTGG - Intronic
1184840508 22:47049918-47049940 CCACCAAGTTCCCCAAACACAGG - Intronic
949739344 3:7212450-7212472 CTTCAAAGTTTCCCACAGACTGG - Intronic
950102421 3:10366146-10366168 CCTCAAAGTCCCCCTAAGCCAGG - Intronic
950475435 3:13211696-13211718 CCACCACGTTTCCCAAATCTAGG + Intergenic
952304386 3:32132764-32132786 CCCCCATGGTTCCCAAAGCATGG - Intronic
952318782 3:32256692-32256714 CCTTCGAGTTTCCCAAGTCCTGG + Intronic
952388839 3:32862607-32862629 CCTCCAAGGTTGCAAAAGCAAGG - Intronic
955638761 3:61059046-61059068 CCTCCAGGTTCCCCAATGTCTGG + Intronic
957054988 3:75435871-75435893 CCTCCCCGTTTCCCACACCCTGG - Intergenic
960552235 3:118988626-118988648 CCTCCAAGTTTCCCACCCCGAGG - Intronic
960970858 3:123139241-123139263 CCTCCAACTGTCCCACAGCCAGG + Intronic
961049283 3:123733328-123733350 TCTCCAGGTTGGCCAAAGCCAGG + Intronic
961469315 3:127101362-127101384 ACTCCATGCTTCCCACAGCCAGG + Intergenic
961888662 3:130112270-130112292 CCTCCCCGTTTCCCACACCCTGG - Intronic
961995542 3:131238080-131238102 CATTCAAGGCTCCCAAAGCCAGG - Intronic
962112181 3:132463987-132464009 CCTCCAGGTTTTCCATAGGCAGG - Intronic
967814438 3:193787257-193787279 CCTCCAACTTCCCCAGAGCCAGG - Intergenic
968223149 3:196953411-196953433 CCTCCAACTTTCACACACCCTGG + Intronic
969756199 4:9152477-9152499 CCTCCCCGTTTCCCACACCCTGG + Intergenic
969816523 4:9691643-9691665 CCTCCCCGTTTCCCACACCCTGG + Intergenic
974617374 4:64307075-64307097 CCTCCAAGTTTAACAACCCCTGG + Intronic
975399723 4:73920699-73920721 CCTACAATTTTCCAAAAGCTTGG - Intergenic
978143563 4:105345255-105345277 CGTTCAAGTTCCCCACAGCCTGG - Intergenic
979620968 4:122798234-122798256 CCTCCAAGTGTCCCCAAGATAGG - Intergenic
980857079 4:138453362-138453384 CCTCCGTGTCTCCCAAAGTCAGG + Intergenic
985588932 5:754943-754965 CTTCCAAATTCCCCCAAGCCTGG + Intronic
985603612 5:847459-847481 CTTCCAAATTCCCCCAAGCCTGG + Intronic
989170119 5:38465497-38465519 CATCAAAGCTTCCCAAAGACAGG - Intergenic
990099651 5:52166048-52166070 CCTCCATGTTTCTCACAGGCTGG - Intergenic
992291251 5:75282316-75282338 TCTCCAATTTTCACAAAGACTGG - Intergenic
993218270 5:85054340-85054362 CTTGCAAGTTTCCCAAATTCCGG + Intergenic
993234582 5:85287969-85287991 CAGCCAAACTTCCCAAAGCCTGG - Intergenic
994432496 5:99685425-99685447 GCTAAAAGTTTCCCCAAGCCAGG - Intergenic
1001600052 5:172922859-172922881 CTTCCATGTTCCCCACAGCCTGG - Intronic
1006921977 6:37633283-37633305 CCTCCATGCTTCCAAAGGCCGGG - Exonic
1009042426 6:58194897-58194919 CCTACATGATTCCCAAAGCTAGG - Intergenic
1010259918 6:73804011-73804033 GCTCCAGGTTTGCCACAGCCCGG + Intronic
1010776730 6:79895119-79895141 CTGCCAAATTTCCTAAAGCCTGG - Intergenic
1012031555 6:94073642-94073664 TCTCTAAGTTTCCCAATGTCAGG + Intergenic
1012954240 6:105551664-105551686 CTTTCCAGTTTCCCAAATCCAGG + Intergenic
1012973243 6:105753784-105753806 CTGCCAAGTTTCCTTAAGCCTGG + Intergenic
1013292405 6:108730735-108730757 CTTCCAAATTTCCCAAGTCCCGG + Intergenic
1015923732 6:138290004-138290026 ACTCCAGGTTTCCCAAGGCAGGG - Intronic
1017524735 6:155232586-155232608 CCTCAGAGTTTCCCCAAACCAGG - Intronic
1018859200 6:167698760-167698782 CCTGCAAGCAGCCCAAAGCCTGG + Intergenic
1019521215 7:1461334-1461356 CCTCCAGGGTCCCCGAAGCCAGG + Intergenic
1021743187 7:23709535-23709557 CCTCAAAGTTTCCTCATGCCCGG - Intergenic
1022921796 7:35023216-35023238 CCTCCCAGTTACCCCAAGCCAGG + Intronic
1023004326 7:35846855-35846877 CCTCCCAGTGTTCCCAAGCCAGG - Intronic
1024407695 7:49001630-49001652 GCTCCAAGTGTCCCAAAGCAGGG - Intergenic
1026010480 7:66631933-66631955 ACCCCAAGCTTCCCAAAGACAGG - Intronic
1027439799 7:78207453-78207475 CCTCCCATTCTCCCACAGCCTGG + Intronic
1032706339 7:134423749-134423771 CCTCCAAGGTGCCCTATGCCAGG - Intergenic
1033088207 7:138361684-138361706 TCTCCAAGTGTCCCAAAGGTTGG - Intergenic
1034405792 7:150901667-150901689 CCTCCACAGTTCCCCAAGCCTGG - Intergenic
1035281596 7:157781986-157782008 CCTCCAAGCTTGCCACAGACGGG + Intronic
1036685261 8:10905181-10905203 TCTCCAAGCTTCCCGAAGGCAGG + Intronic
1036850118 8:12194830-12194852 CCTCCCCGTTTCCCACACCCTGG - Intergenic
1036871482 8:12437103-12437125 CCTCCCCGTTTCCCACACCCTGG - Intergenic
1038039795 8:23714969-23714991 CCTACAATATCCCCAAAGCCTGG + Intergenic
1038411570 8:27363204-27363226 CCTCAAAGCTTCCCAAAAGCTGG - Intronic
1041181420 8:55253001-55253023 CCTCCAGCTTTCCAAAAACCAGG + Intronic
1041390224 8:57341217-57341239 CATCCTAGTTCCCCAAAACCTGG - Intergenic
1043327026 8:79064964-79064986 CCTCTGAGTCTCCCAAAGGCAGG - Intergenic
1044605269 8:94042440-94042462 CCTCCAAGTTTACCCCAGCGTGG - Intergenic
1047279383 8:123431949-123431971 CCTCCAAGTTTCCCTAGGATGGG - Intronic
1049132715 8:140862561-140862583 CCTCAAGGTTCCCCAAACCCTGG + Intronic
1049646117 8:143736504-143736526 CCTCCATGTGTTCCAAAGCTGGG - Intergenic
1050118793 9:2287529-2287551 GAATCAAGTTTCCCAAAGCCAGG - Intergenic
1050809387 9:9724944-9724966 TCTGCGAGTCTCCCAAAGCCAGG - Intronic
1055447790 9:76400056-76400078 CCTCCAACTTCCCCAAACCCTGG - Intergenic
1056927755 9:90849102-90849124 CCCCCAACTTGCCCAAAGCAGGG - Intronic
1058388503 9:104466547-104466569 ATTCCAAGTTCCCCAAAGTCTGG + Intergenic
1058402626 9:104635813-104635835 TCTCAAAGTTTCCCAATGGCAGG + Intergenic
1060344275 9:122803038-122803060 CCTGCCAGTGCCCCAAAGCCTGG + Intronic
1062179971 9:135186121-135186143 CTTTCAGGTTTCCAAAAGCCTGG + Intergenic
1062678928 9:137765880-137765902 CCTCGAAGCTTCCAACAGCCTGG - Intronic
1185617475 X:1432171-1432193 CCTCCTTCTTTCCCAAAGGCTGG + Intronic
1190276729 X:48904011-48904033 CCTCCATTTTTCCCACACCCTGG + Exonic
1191687793 X:63910427-63910449 CCCTCAAGTTACCCAAGGCCAGG + Intergenic
1191951223 X:66595934-66595956 CCTCCAAGATTCTCAGATCCAGG - Exonic
1196254039 X:113494736-113494758 GCTGGAAGTTTCCCACAGCCAGG - Intergenic
1196507342 X:116462935-116462957 GCCCAAAGTTTCCCAAATCCAGG - Exonic
1198059108 X:133025930-133025952 CCTCAAAGCTTTCCAAAGCCAGG - Exonic