ID: 925217534

View in Genome Browser
Species Human (GRCh38)
Location 2:2110457-2110479
Sequence CCTCCAAGTTTCCCAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925217531_925217534 12 Left 925217531 2:2110422-2110444 CCATGTTAGCTTCTGTTTTTACC 0: 1
1: 0
2: 1
3: 28
4: 321
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217532_925217534 -9 Left 925217532 2:2110443-2110465 CCACTTCAGAATAACCTCCAAGT 0: 1
1: 0
2: 2
3: 2
4: 139
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217528_925217534 20 Left 925217528 2:2110414-2110436 CCTCCAACCCATGTTAGCTTCTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217529_925217534 17 Left 925217529 2:2110417-2110439 CCAACCCATGTTAGCTTCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 453
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195
925217530_925217534 13 Left 925217530 2:2110421-2110443 CCCATGTTAGCTTCTGTTTTTAC 0: 1
1: 0
2: 1
3: 26
4: 315
Right 925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925217534 Original CRISPR CCTCCAAGTTTCCCAAAGCC AGG Intronic