ID: 925219482

View in Genome Browser
Species Human (GRCh38)
Location 2:2126452-2126474
Sequence TCTGGGGCCCAGAAAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 521}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925219469_925219482 8 Left 925219469 2:2126421-2126443 CCACCACCCCTGCTGTTTCATAG 0: 1
1: 0
2: 3
3: 41
4: 262
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521
925219475_925219482 0 Left 925219475 2:2126429-2126451 CCTGCTGTTTCATAGCCATGGGG 0: 1
1: 0
2: 2
3: 17
4: 113
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521
925219473_925219482 1 Left 925219473 2:2126428-2126450 CCCTGCTGTTTCATAGCCATGGG 0: 1
1: 1
2: 1
3: 6
4: 166
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521
925219470_925219482 5 Left 925219470 2:2126424-2126446 CCACCCCTGCTGTTTCATAGCCA 0: 1
1: 0
2: 3
3: 17
4: 214
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521
925219468_925219482 19 Left 925219468 2:2126410-2126432 CCATGTGTTCACCACCACCCCTG 0: 1
1: 0
2: 7
3: 83
4: 502
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521
925219471_925219482 2 Left 925219471 2:2126427-2126449 CCCCTGCTGTTTCATAGCCATGG 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521
925219467_925219482 22 Left 925219467 2:2126407-2126429 CCGCCATGTGTTCACCACCACCC 0: 1
1: 0
2: 2
3: 32
4: 345
Right 925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925219482 Original CRISPR TCTGGGGCCCAGAAAGAAGA GGG Intronic
900013079 1:132677-132699 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
900043145 1:488664-488686 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
900064582 1:723661-723683 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
900153793 1:1195293-1195315 TCTGAGGAACAGAAAGAAAAAGG - Intronic
900429371 1:2594606-2594628 CTTGGGCCCCAGAAAGCAGAGGG + Intronic
900525364 1:3125853-3125875 GCTGGGGCCCACAAAGGAGCCGG - Intronic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901108776 1:6778752-6778774 TCTGGGTCTCAGGAAGTAGAGGG + Intergenic
901498810 1:9638856-9638878 ACTTGAGCCCAGAAAGCAGAGGG - Intergenic
902132081 1:14270774-14270796 TATGAGGTCCAGAAAAAAGAGGG - Intergenic
902154385 1:14472398-14472420 TCTGGGGCCCAGACTGATGGAGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902678889 1:18029340-18029362 TGAGGGGCACAGAAACAAGAAGG - Intergenic
902822516 1:18951807-18951829 TCTGGGGCAGAGATAGGAGAGGG + Intronic
903019474 1:20383964-20383986 TCTGGGGCCCAGGAAGGATTTGG - Intergenic
903465003 1:23545882-23545904 GCTGAGACCCAGAAATAAGAAGG - Intergenic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903653222 1:24933457-24933479 TGTGAGGCCCAGAGAGAGGAGGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903679469 1:25087586-25087608 TCTGGGGCCCAGAGAGGGAAGGG + Intergenic
903788528 1:25876525-25876547 CCTGTGGCCCAGAGAGAACAAGG - Intergenic
904208555 1:28871014-28871036 TCTGGGACCCAGGAACATGAGGG - Intergenic
904684719 1:32251706-32251728 CCTGAGGCCCAGAGAGAACAAGG + Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905249117 1:36636679-36636701 TAAGGGGCCCTGAAAGGAGAGGG + Intergenic
905263297 1:36734080-36734102 TCTGGGGTCAAGAAAGCTGAGGG - Intergenic
906013095 1:42547994-42548016 TCAGGGGCCAAGCAAAAAGATGG + Intronic
906280209 1:44548077-44548099 TGTGAGGCCAAGAGAGAAGACGG - Intronic
906711149 1:47930808-47930830 ACTGAGGCCCAGAAAGGAAAAGG + Intronic
906845175 1:49183990-49184012 ACTGAGGCCCAGAAAGGTGAAGG + Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
907276733 1:53320956-53320978 ACTGAGGCTCAGAAAGGAGACGG - Intronic
907313827 1:53554913-53554935 TCTGGGGCACAGAAAGGAAAGGG + Intronic
907460802 1:54604290-54604312 TCAGGGGCCCTGAAGGAAGGGGG + Intronic
908153903 1:61333161-61333183 TCCAGGTCCCAGTAAGAAGAAGG + Intronic
908984614 1:70002276-70002298 TCTGATGCCCATAGAGAAGAAGG - Intronic
909272947 1:73647535-73647557 TCTGGGGCTAAGAAATAATAAGG - Intergenic
910737945 1:90482756-90482778 TGTGGGGCCCCAGAAGAAGAAGG - Intergenic
912730151 1:112095045-112095067 TCATGGGGCCAGATAGAAGAGGG + Intergenic
913671921 1:121105050-121105072 GCTGGTGACCAGAAAGAACAAGG - Intergenic
914023696 1:143892495-143892517 GCTGGTGACCAGAAAGAACAAGG - Intergenic
914662172 1:149800442-149800464 GCTGGTGACCAGAAAGAACAAGG - Intronic
914807025 1:150999150-150999172 GCTGGGTCCCAGAGTGAAGATGG + Intronic
915446679 1:155978259-155978281 TTTGGCGCCCAGAAAGCAGGCGG + Intronic
915621633 1:157089742-157089764 TCACAGGCCCAGAGAGAAGAAGG - Intergenic
916436999 1:164786476-164786498 TCTGTGGCTGAGAAAGAAGAGGG + Intronic
917510487 1:175665401-175665423 CCTGGGGCCCAGAAGGCAGGTGG + Intronic
918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG + Intergenic
919885958 1:201935052-201935074 TCTGGGGCTCAGTGGGAAGAGGG - Intronic
920097608 1:203496751-203496773 ACTGGGGCCCAGAGAGGAGAGGG - Intronic
920671088 1:208004062-208004084 TCTGGCCGACAGAAAGAAGAAGG - Intergenic
921705630 1:218319565-218319587 TCTGGGACACAGAAAGCACAAGG - Intronic
922099480 1:222469677-222469699 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
922261518 1:223949173-223949195 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
922593794 1:226798508-226798530 GCTGGGGCCCAGGAAGGAGGCGG - Intergenic
922735560 1:227976571-227976593 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
924067161 1:240235830-240235852 TATGGGGCAGAGGAAGAAGAGGG - Intronic
924342681 1:243051349-243051371 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
924948199 1:248859748-248859770 ACTGGGGCCCAAAATGTAGAGGG - Intergenic
1063097097 10:2917848-2917870 TCTGGGGTTCAGAAAGACCAAGG - Intergenic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1066616504 10:37300366-37300388 TCAGGGCCCCAGGAAGAAGGGGG - Intronic
1066733798 10:38454205-38454227 TCCCGGGCCCAGTAAGAAGGAGG + Intergenic
1067251745 10:44592700-44592722 TATGGGTCCCAGAAGGCAGAAGG + Intergenic
1067459717 10:46448827-46448849 TTTGGGGCCCAGGAAGGATACGG + Intergenic
1067511287 10:46896988-46897010 GCTGGGAAACAGAAAGAAGAAGG + Intergenic
1067627470 10:47935786-47935808 TTTGGGGCCCAGGAAGGATACGG - Intergenic
1067832566 10:49618775-49618797 TTTGGGGCCCCCAAAGAATATGG + Intronic
1068205097 10:53840092-53840114 TCTGATGCCCATAAAGAAAATGG + Intronic
1068928029 10:62560003-62560025 TCTGTGGCCAAGAAAAAAAAAGG - Intronic
1069063514 10:63918679-63918701 TATGGAGGCCAGAAACAAGAAGG + Intergenic
1069099296 10:64298219-64298241 TCTGAGGCCCAGAAAGCACTTGG + Intergenic
1069651942 10:70055045-70055067 CCTGGGAACCAGACAGAAGATGG - Intronic
1070506347 10:77116700-77116722 ATTGGGGCAGAGAAAGAAGAAGG - Intronic
1070629215 10:78072571-78072593 GCTTGGGTCCAGACAGAAGAAGG + Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1071267886 10:83980515-83980537 TCTGGGGCCAACACAGAAGGAGG + Intergenic
1071860240 10:89664871-89664893 TCTGCAGCTTAGAAAGAAGAGGG + Intergenic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072660133 10:97358810-97358832 ACTGAGGCCAGGAAAGAAGAAGG - Intronic
1074355168 10:112776455-112776477 TCTGTGTCCCGGAAACAAGATGG + Intronic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1075287182 10:121196874-121196896 TATGAGGCCAAGAAAGAAAAAGG + Intergenic
1075349112 10:121708304-121708326 TGTGGGGCACAGCAAGAAGGTGG - Intergenic
1075982021 10:126748283-126748305 ACTGAGGCCCGGAAGGAAGAAGG + Intergenic
1076554810 10:131314251-131314273 TCTGGTCCCCAGGAAGAAGGTGG - Intergenic
1076969416 11:124881-124903 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
1077021249 11:418039-418061 TCTGGCGCCCAGAAGTCAGAGGG + Intronic
1077832530 11:5890216-5890238 TCTGGGGTCCAAAGAGGAGAAGG + Intronic
1077841686 11:5982518-5982540 GCTGGGACCCAGAAAGAGGCTGG + Intergenic
1078558322 11:12349438-12349460 TCTGGGGGAGAAAAAGAAGAAGG + Intronic
1078568778 11:12439723-12439745 GCTGGGGCAGAGAAAGCAGAGGG - Intronic
1078883189 11:15473643-15473665 ACTGAGGACCAGAAATAAGAAGG + Intergenic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1081813789 11:45927674-45927696 ACTGAGGCCCAGAAAGGAGCAGG - Intronic
1083279677 11:61619240-61619262 GCTGGGGCATAGAAAGAACAAGG - Intergenic
1084954380 11:72683706-72683728 TCTGGGAACCAGGAAGAGGAGGG - Intergenic
1085036704 11:73305302-73305324 CCTGGGGCCCAGAGAAAAGGGGG + Intergenic
1085646522 11:78227024-78227046 TCTGGTGCCCTGAGAGAAGCTGG + Exonic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1087973279 11:104512295-104512317 TGTGGGACCAAGAAAGAAGAGGG + Intergenic
1088428357 11:109729785-109729807 TCTGGCACCCAGAAAGAATCAGG - Intergenic
1088930211 11:114343621-114343643 TCTGGAGCTAAGGAAGAAGAGGG - Intergenic
1089137434 11:116260955-116260977 TCTAGTGCCCAGGTAGAAGAGGG - Intergenic
1089330594 11:117686392-117686414 ACTGGGCCTCAGAAAGAAGCAGG + Intronic
1089563334 11:119356977-119356999 TCGGGGGCACAGAAAGAAGCCGG - Intronic
1090379736 11:126318053-126318075 TCTGAAGTCCAGAAAGCAGAGGG - Intronic
1090678930 11:129032087-129032109 TCTGGGGTCCAGGAAGAATCAGG - Intronic
1090876983 11:130798931-130798953 TGTGGGGCACAGAGAGAAGGTGG + Intergenic
1090989813 11:131806599-131806621 AATGAGGCCCAGAAAGGAGAAGG + Intronic
1091840193 12:3615134-3615156 TCTGGGGTCTAGAAAGAGAAAGG + Intronic
1093141664 12:15516748-15516770 TGTGGGAACTAGAAAGAAGAGGG - Exonic
1093822480 12:23638272-23638294 TCTAGAGACCAGAAATAAGAAGG - Intronic
1094396414 12:30011303-30011325 TTTGGGGCTAAGAAAGAAAATGG - Intergenic
1095598067 12:43981389-43981411 GCTGGAGCACAGAAAGAGGAAGG + Intronic
1096149224 12:49298076-49298098 GCTGGGGCTCAGAAATAATATGG - Intronic
1098324427 12:69286743-69286765 TCTAGGGGCAAGAAAGTAGAGGG + Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1101554627 12:105797203-105797225 TCTGGCAGCCAGAAATAAGAGGG + Intergenic
1101581917 12:106049377-106049399 TCTTGGGCCCAGGAAGCATAAGG - Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1102050065 12:109855769-109855791 TCTGTGGCCCAGGGAGGAGAAGG + Exonic
1102419931 12:112795483-112795505 TGTGAGGCACAGAAAGAAGGGGG - Intronic
1102618482 12:114175188-114175210 TCTGGGGTCTAGACAGAAAAAGG - Intergenic
1102804642 12:115769021-115769043 TCAGGGTCCCAGCAAGAAGCAGG + Intergenic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1103839039 12:123847907-123847929 TCTGGTGCACAGAAGGAAGTGGG - Intronic
1104460152 12:128948746-128948768 TTTGGGGTCCAGAGAGAACATGG + Intronic
1104584494 12:130037138-130037160 TCTGGGCCGCAGAAAGAAACGGG - Intergenic
1105280119 13:18958417-18958439 TCTGGGGTACAGAAAGGAAAGGG + Intergenic
1106024962 13:25947716-25947738 TCACGGCCCCAGGAAGAAGAGGG - Intronic
1106251242 13:27983169-27983191 TTTGGGGCACAGAAAGATCAAGG - Intronic
1106896651 13:34310083-34310105 TCTGGGTTACAGAAAGCAGACGG + Intergenic
1107452377 13:40521508-40521530 GCTGACGGCCAGAAAGAAGATGG + Intergenic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1108321055 13:49290997-49291019 TCTGGGGACTGGAAGGAAGACGG - Intronic
1109262789 13:60163780-60163802 TCCGGGGACCGGAAAGAAGGTGG + Exonic
1109357782 13:61253699-61253721 TCTAGGGCCCCAAAAGAGGAAGG + Intergenic
1110513662 13:76383021-76383043 TCTGAGGCCCAAAGAGATGATGG - Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1113435455 13:110287615-110287637 TGTGAGACCCAGAAAGAAGCCGG + Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1113641597 13:111961515-111961537 TTTGGGGCCCAGAAAGATTGAGG - Intergenic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1114584931 14:23802631-23802653 TCTGGAGCCCAGGAAGATCAAGG + Intergenic
1115266405 14:31505168-31505190 TGTAGGCACCAGAAAGAAGATGG + Intronic
1115344400 14:32326998-32327020 TCTGAAGCCCAGAAAGATAATGG - Intergenic
1115641887 14:35340393-35340415 TCTGGGAACCAGAAGGAAGTGGG - Intergenic
1117823602 14:59677144-59677166 GCTGGGGTCCTGGAAGAAGAGGG - Intronic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118440099 14:65804429-65804451 TCAGAGGCCCAGAAAGGAGGAGG - Intergenic
1118770476 14:68939412-68939434 TCTGTGGGCCAGAATGATGATGG + Intronic
1118893556 14:69928093-69928115 TCTGAGGCCCAGTGAGGAGAAGG + Intronic
1119129894 14:72162422-72162444 TCTGGGGAGTAGAAAGAAGTAGG + Intronic
1120829366 14:88984519-88984541 TCTGTGCCCCAGGAAGAAGGTGG - Intergenic
1121223452 14:92303941-92303963 TCTGGGGCCCATAGAGTAGACGG - Intergenic
1121597244 14:95173822-95173844 TCTAGGGCACAGAAAGAGGAAGG - Intergenic
1122028478 14:98895124-98895146 TCTGGAGCTCAGGAAGGAGAGGG - Intergenic
1122261083 14:100523448-100523470 CCTGGTCCTCAGAAAGAAGAAGG - Intronic
1122850648 14:104528070-104528092 ACTGGAGCCCAGAAAAGAGATGG + Intronic
1123468427 15:20532868-20532890 TTTGGGTCCCAGGAAGGAGATGG + Exonic
1123649688 15:22468195-22468217 TTTGGGTCCCAGGAAGGAGATGG - Exonic
1123728744 15:23128078-23128100 TTTGGGTCCCAGGAAGGAGATGG + Intergenic
1123740090 15:23277015-23277037 TTTGGGTCCCAGGAAGGAGATGG - Intergenic
1123746908 15:23325543-23325565 TTTGGGTCCCAGGAAGGAGATGG + Intergenic
1123761754 15:23438847-23438869 TTTGGGTCCCAGGAAGGAGATGG + Intergenic
1123817478 15:23994487-23994509 TGTGGGGGCAAGGAAGAAGAGGG + Intergenic
1124035291 15:26048851-26048873 CCTGGGGCCCAGGGAGAAGCGGG - Intergenic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1124532416 15:30519204-30519226 TTTGGGTCCCAGGAAGGAGATGG - Intergenic
1124766237 15:32488441-32488463 TTTGGGTCCCAGGAAGGAGATGG + Intergenic
1127284894 15:57523841-57523863 TCTGGTGCCCAGAATCCAGAGGG - Intronic
1127318277 15:57817790-57817812 TCAGAGGCCCAGAAGGAAGAGGG - Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128241619 15:66105235-66105257 TCTAGGGTCCAGATAGAAGGAGG + Intronic
1128248964 15:66151758-66151780 TCTGGCTCCCAGGAAGAAGGGGG - Intronic
1128284644 15:66426558-66426580 TCTGGGGTTCAGGAAGAGGAAGG + Intronic
1128354151 15:66912842-66912864 TCTGGGCTGCAGCAAGAAGAAGG - Intergenic
1128390972 15:67182252-67182274 TCTGGGGGCTAGAAGGCAGAAGG - Intronic
1128622723 15:69164398-69164420 ACTGGGGCCCTGAAAGATTAAGG - Intronic
1128752521 15:70159478-70159500 AATGGGGCCCAGAGAGATGAAGG + Intergenic
1129202887 15:74015693-74015715 TCTGGAGCTATGAAAGAAGAGGG - Intronic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129254843 15:74328409-74328431 TCTGAGGCTCAGAAAGGTGAAGG + Intronic
1129258716 15:74350450-74350472 ACTGAGGCCCAGTGAGAAGAAGG - Intronic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130905703 15:88239631-88239653 TCAGGGGTGCAGAGAGAAGAGGG + Intronic
1131409680 15:92196673-92196695 GCTGGGGCCAAGAAAGTAAAGGG - Intergenic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132645444 16:997357-997379 TCGGGGGCCCAGGGAGAAGCAGG - Intergenic
1132781096 16:1626071-1626093 TCTGGTGGCGAGAAGGAAGAAGG + Exonic
1134802468 16:17098285-17098307 TCTGAGGCCCAGAGAGATTAGGG + Intergenic
1134874057 16:17680558-17680580 TCTGAGGAACAGAAAGAAAAAGG - Intergenic
1135109258 16:19677973-19677995 ACTGGGGTGCAGAAAGATGAAGG + Intronic
1135123169 16:19784313-19784335 ACAGTGGCCCAGAGAGAAGATGG - Intronic
1136026138 16:27470182-27470204 AATGAGGCCCAGAGAGAAGAGGG + Exonic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136605045 16:31327932-31327954 TCAGGGGACCAGTTAGAAGAAGG + Intronic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137328185 16:47461980-47462002 GTTAGGGCCCAGAAAGAAAAGGG + Intronic
1137399141 16:48139208-48139230 TGTGGGCCCCAGAATGAAAAAGG + Exonic
1137519895 16:49183801-49183823 TCTGGGGTCCAGAGAGAGAAAGG + Intergenic
1137927445 16:52554067-52554089 TCAGGGGATCAGAAAGAAAAGGG - Intergenic
1138570618 16:57869634-57869656 GCTGGGGCCCAAATAAAAGAAGG + Intergenic
1138583770 16:57957692-57957714 TCTAGGCCCCAGAGAGAGGAAGG - Intronic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1139706937 16:68747298-68747320 TCCTGGGCACAGAAAGAGGAGGG + Intronic
1139824049 16:69743028-69743050 TCTGGGGCACAGGCAGGAGATGG + Intronic
1141242160 16:82274227-82274249 TCAGGAGCTCAGAAATAAGATGG - Intergenic
1141404052 16:83775913-83775935 TCTGGGGCCCAGGAAATATAGGG - Intronic
1141464767 16:84198122-84198144 TATGGGGCTGAGTAAGAAGATGG + Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142276301 16:89120644-89120666 CCTGTGACCCAGAGAGAAGATGG - Intronic
1142341541 16:89526307-89526329 GCTGGGGGGCAGAAAGGAGAGGG - Exonic
1142451256 16:90174241-90174263 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1142985287 17:3691524-3691546 TCTTGGGCCAAGAGAGATGATGG + Intronic
1143274673 17:5701295-5701317 TCTGGGACCCAGAGAGATGGGGG + Intergenic
1143550297 17:7626641-7626663 TCTGGGGTCAAAAAAGAAAAAGG + Intronic
1143636023 17:8164029-8164051 TTTGGGGTCCAGAGAGAGGAGGG - Intergenic
1143964714 17:10748826-10748848 TCTGGAGCCCTGAAAGGAAAGGG - Intergenic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144450815 17:15377013-15377035 ACTGGGGCTCAGAAAGAAGGAGG - Intergenic
1144773455 17:17772015-17772037 TCTGAGGCCCAGAGAGGACAAGG - Intronic
1146579629 17:34025174-34025196 TCAGGGGCTCAGAAGGAACAAGG - Intronic
1146940425 17:36840310-36840332 ACAGGGGCCCAGACAGAAGTTGG - Intergenic
1147349721 17:39831604-39831626 TCTTGGGCCCACACAGAAGCAGG - Intronic
1147920417 17:43913401-43913423 ATTGGAGCCCAGACAGAAGAGGG + Intergenic
1148448292 17:47755087-47755109 TGTGGGGTAGAGAAAGAAGAAGG - Intergenic
1148780692 17:50119741-50119763 TCTGGGGCTGAGAGAGAAGAAGG - Intronic
1149334425 17:55620909-55620931 TCAGTGTCCCAGTAAGAAGAGGG + Intergenic
1150251836 17:63709853-63709875 TCTGGGGCACAGAAAGAAGGAGG + Intronic
1150862788 17:68818382-68818404 TCTGGAGAGCAGAAAGCAGATGG - Intergenic
1151566091 17:74899185-74899207 ACTGGGGCACAGGAAGAAAATGG - Intergenic
1152640829 17:81448515-81448537 TCTGGGGCCCACAGGGAAGACGG - Intronic
1154155908 18:11943981-11944003 TCTGGTGTCCAGAAAGAATTAGG + Intergenic
1155354712 18:24941134-24941156 TCTGGGAACCAGAAATAGGAGGG - Intergenic
1155778836 18:29804465-29804487 TCTGTGGAACAGAAAGACGAAGG - Intergenic
1155954113 18:31942886-31942908 ACTGGAGCCTAGAAACAAGAAGG + Exonic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1157758330 18:50238757-50238779 TCTGGTGCCCAGAAAGATGTTGG - Intronic
1158716583 18:59885712-59885734 CCTGGGACCCTGAAAGGAGAGGG + Intergenic
1159089678 18:63833616-63833638 TCTGGGCCTCAAAATGAAGATGG - Intergenic
1160137584 18:76285789-76285811 TCAGGGGTCCAGAGAGTAGAAGG + Intergenic
1160646221 19:194807-194829 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
1160911195 19:1474542-1474564 CCCGGGGCCCAGAAGGAAGTGGG + Exonic
1161522542 19:4732874-4732896 TCTGGGGCCCGGAGTGGAGATGG - Intergenic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1163755392 19:19103662-19103684 CCTAGGGCCCAGAAGCAAGATGG + Intronic
1164576394 19:29407797-29407819 ACTGAGGCCCAGTGAGAAGAAGG + Intergenic
1164894990 19:31867665-31867687 TTGGGGGCCCAGAAAGCATAAGG + Intergenic
1165356572 19:35308039-35308061 TGTGGGGCCCAGAGTGGAGAAGG + Intronic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1167026005 19:46918739-46918761 TCTGGGACCGAGAAGGAAAAGGG + Exonic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925319169 2:2948804-2948826 TGTGGGTCCCAGAGAGGAGAGGG + Intergenic
925834326 2:7929309-7929331 TCTGGAGTCCAGAATGCAGAGGG - Intergenic
926094681 2:10073415-10073437 TTTGGGGCCCAGCAAGGAGTGGG - Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927307518 2:21590540-21590562 TCTGAGGCCCAGAGAGAAAGGGG + Intergenic
927373540 2:22385820-22385842 TCTGAGGCCCATAAAGAGAATGG - Intergenic
927660401 2:24988443-24988465 AGTGGGGTCCAGAAAGGAGAAGG + Intergenic
928797873 2:35046208-35046230 TCTGGGGAAGAGAAAGTAGATGG + Intergenic
929489992 2:42387646-42387668 GCTGGGCCCCAGAAAGAAGGTGG - Intronic
930877999 2:56241482-56241504 TCAGAGGCCCAGAAAGATAATGG - Intronic
932416659 2:71577717-71577739 TCTGGGTCCCAGCAGGAAGACGG - Intronic
932459768 2:71874709-71874731 TCAGGGGCCAAGGAAGAAAAGGG + Intergenic
933479045 2:82831521-82831543 AGTGGGGCCAAGGAAGAAGAAGG - Intergenic
933968004 2:87445930-87445952 CCTGGGACACAGCAAGAAGAAGG - Intergenic
934146998 2:89104800-89104822 TGTGGGGGCAAGGAAGAAGATGG - Intergenic
934222268 2:90095795-90095817 TGTGGGGGCAAGGAAGAAGATGG + Intergenic
934233206 2:90205567-90205589 TGTGGGGACAAGGAAGAAGATGG + Intergenic
936469795 2:112788920-112788942 TCTGGAGCTCAGAGAGAGGAGGG + Intergenic
936478950 2:112867637-112867659 TCTGGGGACCAACAAGAAGCAGG - Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
937426653 2:121805552-121805574 ACTGGGGCCCAGAGAGGGGAGGG + Intergenic
938392097 2:130914738-130914760 TCTGGGGACCAGGACAAAGAAGG + Intronic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
939153955 2:138502226-138502248 TCCGGGACCCAGAGAGCAGAGGG - Intronic
940036891 2:149320723-149320745 CCTGGGGCTCAGGAAGTAGAAGG - Intergenic
941218098 2:162739098-162739120 TCTGAGGCTCCCAAAGAAGATGG - Intronic
942276603 2:174327985-174328007 AATGGGGCTCAGACAGAAGAGGG - Intergenic
943025491 2:182623132-182623154 TTTGGGGCCTGGCAAGAAGAAGG + Intergenic
944507736 2:200430185-200430207 TCTGGGGCCTGGAACAAAGATGG + Intronic
944738596 2:202590206-202590228 GTTGGGGCACAGAAAAAAGAGGG - Intergenic
945160275 2:206883342-206883364 TTTGGGGCTCAGAGAAAAGAGGG + Intergenic
946218094 2:218201889-218201911 TCTGAGAGCCAGAAAGAAAATGG + Intergenic
946306748 2:218860552-218860574 TCAGGAGCCCAGAGAGAAGCCGG - Intronic
946310143 2:218878778-218878800 ACTGAGGCCCAGAAAGAATTAGG - Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947079534 2:226380703-226380725 ACTGGGGCCTGGAAAGAAAAAGG + Intergenic
947731011 2:232431653-232431675 ACTGAGGCCCAGAGACAAGAAGG - Intergenic
948314626 2:237017953-237017975 CCTGGGGTTCAGAAAAAAGAGGG + Intergenic
948939628 2:241189402-241189424 TCTGTGGCCCTGGAAGGAGAGGG - Intronic
948994753 2:241572683-241572705 TCCTGGCCCCAGAAAGAAAAGGG - Exonic
1169464336 20:5824078-5824100 TGTGGGGCCCAGAGAGCTGATGG - Intronic
1170492066 20:16887059-16887081 TCTGAGGCACAGAAGGAAAAGGG - Intergenic
1170571507 20:17635382-17635404 TCAGGGGCCCAGAACCCAGACGG + Intronic
1171402430 20:24883833-24883855 TCTGAGGAACAGAAAGAAAAAGG + Intergenic
1171437726 20:25136043-25136065 TCTGAGGCCGAGCAGGAAGATGG + Intergenic
1172184275 20:33021561-33021583 GCTGGGGCTCAGAGAGAAAAAGG - Intronic
1172784319 20:37456522-37456544 TCTTGGTCCCAGAGTGAAGAAGG - Intergenic
1172870641 20:38133441-38133463 TATGGGGATGAGAAAGAAGATGG + Intronic
1172910341 20:38404321-38404343 CCTGGATCCCAGAATGAAGAGGG - Intergenic
1173944729 20:46941415-46941437 ACTGAGCCCCAGAAAGATGAAGG - Intronic
1175348818 20:58303013-58303035 TCAAGGGCCCAGGCAGAAGAGGG - Intergenic
1176279285 20:64291409-64291431 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1177791905 21:25731433-25731455 TCTGTTGCCCAGAATGAACACGG + Intronic
1178132416 21:29588876-29588898 TATGGGGCCCAGAATGACAAAGG - Exonic
1178285341 21:31321124-31321146 CCTGGGCCACAGAAAGAAGGGGG + Intronic
1178452530 21:32716740-32716762 TGTGGATCCCAGAAAGAAGTTGG - Intronic
1178597808 21:33970647-33970669 TCTGGGGCCCAGAGAGCTTAGGG - Intergenic
1179141467 21:38729317-38729339 TCTGGGACTCAGAAAGAAAATGG - Intergenic
1179397001 21:41049711-41049733 TCAGAGGCTCAGAAAGGAGAGGG - Intergenic
1179419695 21:41225601-41225623 TCTGGGGACCAGAAGGGAAAGGG + Intronic
1179586189 21:42375470-42375492 GCTGGGGCCCGGGAGGAAGAAGG - Intronic
1180079331 21:45479760-45479782 TCTGGGGCCCGGAAAGTACGAGG - Intronic
1180162710 21:46005507-46005529 TTTGGGGCAGAGCAAGAAGAGGG + Intergenic
1181871755 22:25904897-25904919 CCTGGTGGCCAGAAAGAAAAAGG + Intronic
1183634975 22:39056116-39056138 TCTGGGGTCCATAAAGGAGAAGG - Intronic
1183909704 22:41069236-41069258 CATGGGGGGCAGAAAGAAGAAGG - Intergenic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
949940432 3:9150322-9150344 GCTGGAGCCCAGAAGTAAGAAGG + Intronic
950405109 3:12799301-12799323 TCTGAGGCCCAGAGAAAAGGAGG + Intronic
950432549 3:12959222-12959244 CCAGGGGCCCAGCAAGACGAGGG + Intronic
950653700 3:14423672-14423694 ACTGAGGCCCAGGCAGAAGATGG - Intronic
952817273 3:37456534-37456556 TCTGGGGCAGAGAAGGAGGAGGG - Intronic
953784758 3:45902794-45902816 AGTGGGCCTCAGAAAGAAGAGGG - Exonic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954481893 3:50807003-50807025 ACTGGGGCCCAGAGACAGGAGGG - Intronic
954656060 3:52195020-52195042 CCTGGGGCCCAGAATAAAAAGGG + Intergenic
956370673 3:68556947-68556969 TCTGAGGGCTAGAAAGAAGGGGG + Intergenic
956390480 3:68767628-68767650 TTTGGGACACAGAAAGATGAGGG + Intronic
956482629 3:69688323-69688345 TCTGAGACCCAGGAAGCAGAAGG - Intergenic
960484985 3:118240643-118240665 TGTGGGAACCAGAAAGCAGAGGG - Intergenic
960561937 3:119094131-119094153 TATGGGTCCCAGGAAGATGAAGG + Intronic
960963498 3:123089114-123089136 TCTGGGGCCCAGCCAGAAGCTGG + Intronic
961086352 3:124070839-124070861 ACTGAGACCCAGAAAGGAGAAGG - Intergenic
961311290 3:126003761-126003783 TCTGGGGCCCTGAGAGCACAGGG - Intergenic
961781794 3:129324898-129324920 TCTGGGGCTCAGCAGGGAGAAGG + Intergenic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962257373 3:133881648-133881670 TCTGAGGCCTAGAAAGAAGGAGG + Intronic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
962922765 3:139965731-139965753 TCTGGGCCCCTGCAAGAAGGAGG - Intronic
964307528 3:155357053-155357075 TCTGATGCCCAAAAAGAATAAGG + Intergenic
964337997 3:155678117-155678139 TCTGGGGTCAAGAAAGAGGAAGG + Intronic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
966217006 3:177514318-177514340 TCTTGGGCCTTTAAAGAAGAGGG + Intergenic
966683770 3:182671501-182671523 TCTGTGGCCCTGAAAGAACTTGG + Intergenic
966854220 3:184183351-184183373 GCTGGGGTCCTGAAAGAAGCTGG - Intronic
967054980 3:185823887-185823909 GCTGGAGCCCAGACAGGAGACGG - Intronic
967139110 3:186538659-186538681 TTTGGGCCCCAGGAAGAATATGG + Exonic
967231107 3:187338272-187338294 TCTGAGCCCAAGAGAGAAGAAGG + Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
968371460 3:198224719-198224741 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
968592556 4:1466229-1466251 TCTGGGGCCCAGGAAGTGAACGG - Intergenic
968791135 4:2663190-2663212 CCAGGGGCCCCGAAGGAAGATGG + Exonic
968846431 4:3044808-3044830 GCTGGTCACCAGAAAGAAGAAGG + Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969656512 4:8501812-8501834 GCTGGGGCCCAGAAAGGACAGGG - Intergenic
971092335 4:23360473-23360495 TCTGGGGCCCCGAGAGCACAGGG - Intergenic
972957614 4:44411865-44411887 TCAGGGTCTCAGAAAGAACAAGG + Intronic
973333104 4:48929840-48929862 TCTTGAATCCAGAAAGAAGAAGG + Intergenic
975195955 4:71523785-71523807 TCCAGGGCCTAAAAAGAAGATGG - Intronic
978579090 4:110214705-110214727 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
979260146 4:118637192-118637214 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
979328229 4:119403436-119403458 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
979726573 4:123969636-123969658 TTTGGAGCCAAGAAAGAAAATGG + Intergenic
981384436 4:144112034-144112056 TGTGGTGCCCAAATAGAAGAAGG - Intronic
982924161 4:161315187-161315209 TCTGGATCCAAGTAAGAAGATGG + Intergenic
983441960 4:167797968-167797990 TCTGGGGGCCAAGAAGCAGATGG + Intergenic
983655024 4:170074039-170074061 TCTGGGGCTTAGAAGAAAGATGG + Intronic
985170054 4:187139135-187139157 TCTCATGCCCAGGAAGAAGAGGG + Intergenic
985620526 5:952515-952537 TCTGGACCCCAGAAAGCAGGTGG - Intergenic
985775044 5:1837026-1837048 TCTGGGGTCCACAGAGAGGAAGG - Intergenic
986241077 5:5960713-5960735 GCTGGGGCCAAGAAAGGACAGGG - Intergenic
986892906 5:12331147-12331169 TGTGGGGGCAAGGAAGAAGAGGG - Intergenic
987130002 5:14851345-14851367 TTCGGGGCTCAGAAGGAAGATGG + Intronic
987333446 5:16877022-16877044 TGTGAGGCCCAGCAAGAAGCTGG + Intronic
987462466 5:18229112-18229134 TCTACAGCCAAGAAAGAAGAGGG - Intergenic
988137607 5:27194238-27194260 TCTGGGGAACAGAAAGCAAAAGG + Intergenic
989563357 5:42875908-42875930 TCCGGGGGCCACAGAGAAGAAGG + Intronic
990273548 5:54171736-54171758 TCTTGGGATGAGAAAGAAGAAGG + Intronic
990507251 5:56456884-56456906 TGTGGGACCCAGGAAGAAGCAGG + Intergenic
991963973 5:72072868-72072890 TCTGAGGAACAGAAAAAAGAGGG + Intergenic
992097580 5:73377199-73377221 TCTGGGGAGCTGAAAGCAGAGGG + Intergenic
992839113 5:80669272-80669294 TCTAGTGACCAAAAAGAAGAGGG - Intronic
993602646 5:89947438-89947460 TCTGGGCCCCAGAGATAAGAAGG + Intergenic
993633651 5:90318031-90318053 TCTGGGGAGGAGAGAGAAGATGG - Intergenic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
995931966 5:117456226-117456248 GCTAGGGCACAGAAAAAAGAAGG - Intergenic
996761121 5:126986906-126986928 TCTGGAGGCCAGGAAGAAGATGG + Intronic
997758654 5:136423765-136423787 TCTGGGGCCAAGAGTGCAGAGGG + Intergenic
997758738 5:136424364-136424386 TCTTTGGACCAGAAAGAAAAAGG + Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
997953895 5:138263649-138263671 CCTGGATCCCAGAATGAAGAAGG + Intronic
998062147 5:139127143-139127165 AGTGTGGCCCAGAAAGAACAGGG + Intronic
998151923 5:139762639-139762661 TCTAGGGCCAAGCTAGAAGAGGG - Intergenic
998329333 5:141309953-141309975 TCTGGTGGCCAGAAAGACCAAGG - Intergenic
999156091 5:149458554-149458576 TCTGGGTGCCAGAAAGATGGGGG - Intergenic
999258851 5:150225461-150225483 TCTGGGGGCCAGCACTAAGATGG + Intronic
999411192 5:151351218-151351240 ACTGAGGCCCAGATAGGAGAAGG + Intergenic
999519365 5:152334799-152334821 GCTGAGGCCCAGAGAAAAGAAGG - Intergenic
999749408 5:154615747-154615769 ACTGGGACCCAGAGAGAAGCAGG - Intergenic
1000622715 5:163504226-163504248 TCAGGGGACAACAAAGAAGAGGG - Intronic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001249175 5:170132998-170133020 TCTGAGGCACAGAGAGGAGAAGG - Intergenic
1001419248 5:171574246-171574268 ACTGAGGCCCAGAGACAAGAAGG - Intergenic
1001570548 5:172727732-172727754 TCGGGGGCCCAGCTAGACGAAGG - Intergenic
1002293875 5:178217894-178217916 TCTGAAGACCAGAAAGAAAAAGG + Intronic
1002465479 5:179406199-179406221 ACAGGGGCCCAGTAAGAAGCTGG - Intergenic
1002730698 5:181330265-181330287 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1002753832 6:143839-143861 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
1003511511 6:6785019-6785041 GCTGGGGCCAAGGAACAAGATGG + Intergenic
1004016572 6:11737328-11737350 CCTGGGGCTCAGGAACAAGATGG - Intronic
1004868062 6:19873828-19873850 TTTGGAGCACATAAAGAAGATGG - Intergenic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006504216 6:34477504-34477526 CCAGGGGCACAGAAAGATGAGGG + Intronic
1006890753 6:37425612-37425634 TCTGGAGGCCAGAAAGCAGTGGG - Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007398655 6:41591335-41591357 ACTGGGGCCCAGAAGGTGGAAGG - Intronic
1008418448 6:51270062-51270084 TCAGGGGCCCAGACAGATGGAGG - Intergenic
1009369979 6:62887372-62887394 TCTGGTGACCAGTTAGAAGAAGG - Intergenic
1011722701 6:90175839-90175861 TCTGAGGGCCAGATAGAGGAGGG - Intronic
1012397213 6:98812175-98812197 GGTGTGGCCCAGAAAGAAGCTGG + Intergenic
1013269686 6:108534390-108534412 CCTGGGTCACAGCAAGAAGAGGG - Intergenic
1014207288 6:118669894-118669916 TCTGGGGCCCAGAGAGCTTATGG - Intronic
1015228305 6:130883919-130883941 TCTGAGGCCCAGCATGGAGAAGG - Intronic
1015937549 6:138418341-138418363 CCTGGGGCCCTGAAGGAAGGTGG + Exonic
1016269498 6:142272389-142272411 ACTGGGGAGCAGAAAGAAAAGGG + Intergenic
1016410275 6:143775497-143775519 TCTGAGGCCCAGAGAGATTAAGG + Intronic
1016667569 6:146659810-146659832 TTTGGGCCCCCGAAAGAAGCAGG + Intronic
1016856800 6:148678825-148678847 TCAGGGGCCTAGACAGGAGAGGG + Intergenic
1018751020 6:166806067-166806089 TCTGAGGAACAGAAAGAAAAAGG + Intronic
1019257714 7:62389-62411 TCTGGGTCCCAGAAAGGAGCTGG - Intergenic
1019328839 7:452892-452914 CCTGGGTCCCAGAAAGACGACGG + Intergenic
1019453477 7:1112211-1112233 TCTTTGGCCCAGAATGAGGATGG + Intronic
1019501802 7:1368540-1368562 TCTGGCCCCCAGAAAGGAGCAGG - Intergenic
1019801146 7:3089312-3089334 TCTGGGGACCAGCAGGAAGCAGG + Intergenic
1020084550 7:5303397-5303419 TCTGGAGCCCTGAGAGGAGAGGG + Exonic
1021375321 7:19899932-19899954 TCTGGGACCCAGAAAAGTGAGGG - Intergenic
1022510649 7:30933075-30933097 ACTGAGGCCGAGAAAGGAGAAGG - Intergenic
1023401862 7:39796793-39796815 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1023475279 7:40571048-40571070 ACTGAGGCCCAGAAAGAAAGTGG - Intronic
1023693428 7:42818604-42818626 GGTGGAGCACAGAAAGAAGAAGG + Intergenic
1023818653 7:43968445-43968467 CCTGGTGCCCAGAAAGGATAAGG + Intergenic
1024095207 7:45977365-45977387 TCTGGTGCCCAGAAAGACATGGG + Intergenic
1024647756 7:51383869-51383891 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
1025176939 7:56806906-56806928 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1025603532 7:63022727-63022749 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
1025694853 7:63769480-63769502 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1026499830 7:70935013-70935035 TCAGGGGCCAGGAAAGATGAGGG - Intergenic
1026972199 7:74475381-74475403 ACTGGGGCCCAGAGAGGGGAAGG + Intronic
1026995080 7:74610471-74610493 TCTGAGGTTCAGAAAGATGAAGG + Intergenic
1027141595 7:75661625-75661647 TGAGGGGCCCTGAAAGAAGGGGG + Intronic
1027249760 7:76391784-76391806 TATGGTGTCCAGAAAGAAGGAGG - Intronic
1029799177 7:102928024-102928046 TGTGGGGACCAGGAAGAGGAAGG + Intronic
1030687936 7:112505787-112505809 TCCAGGCCCCAGCAAGAAGAGGG - Intergenic
1032052374 7:128657185-128657207 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1032407515 7:131667469-131667491 TCTAGAGCCCACAGAGAAGATGG + Intergenic
1034604990 7:152303903-152303925 ACTTGGGCCCAGGAAGCAGAAGG + Intronic
1034722709 7:153309391-153309413 ACTGGGACCCAGAAGGAAGCAGG + Intergenic
1035098267 7:156374678-156374700 TTTGGGATCTAGAAAGAAGATGG - Intergenic
1035339344 7:158150539-158150561 CCTGGAGCCCAGAAACAAGTGGG + Intronic
1035435185 7:158854347-158854369 TCTAGTCCCCAGCAAGAAGAGGG + Intergenic
1035560179 8:598423-598445 TCTGGGATCCAGGAAGAAGAGGG - Intergenic
1036764848 8:11543023-11543045 TATGGGCCCCCGAAAAAAGATGG + Intronic
1037735755 8:21564553-21564575 ACTGGGGCCAGGAAAGAGGAAGG - Intergenic
1037905657 8:22714665-22714687 TCTGATACCCAGACAGAAGAGGG + Intronic
1038355770 8:26827974-26827996 GCTGGAGCCCAGAAAGTTGAGGG - Intronic
1038404121 8:27309253-27309275 TCTGGGGCCCAGGTAAAGGAGGG - Intronic
1039385633 8:37133474-37133496 TCTGGGACCCTGAAAGAAGTCGG - Intergenic
1039475306 8:37836492-37836514 CCTGGCACCCAGAAAGCAGATGG + Intronic
1039513490 8:38111015-38111037 TCTGGGACCCAGGAGGCAGAGGG - Intronic
1039567770 8:38563732-38563754 GCTGGAGCTCAGAAAGAAAAGGG - Intergenic
1039811774 8:41055311-41055333 ACTGGGGCCCTGAAAGAGCAGGG + Intergenic
1039837130 8:41265388-41265410 GTTGGGGCCCATCAAGAAGAAGG - Exonic
1041439383 8:57877637-57877659 TCTTGGGACCAGAAAGGAGCAGG - Intergenic
1042011548 8:64251269-64251291 TCTGTGGGCCAAAAGGAAGATGG - Intergenic
1044263562 8:90156444-90156466 TCTGGGGCGTGGAAAGAAAAAGG + Intergenic
1044352079 8:91178326-91178348 TAAGTGGCCCAGAAAGAGGAGGG - Intronic
1045321354 8:101084238-101084260 TCTGGGGAACAAAAGGAAGATGG + Intergenic
1045325788 8:101116739-101116761 TCCGGGGCCCAGTAAGGGGATGG + Intergenic
1045953750 8:107882738-107882760 ACTGGGGCCCAGAAAAAAGAAGG - Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047416187 8:124666652-124666674 TCTGAGGTCCAAAAAGATGAAGG + Intronic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1047614601 8:126553926-126553948 TCTGGGACAGAGGAAGAAGACGG + Exonic
1048276039 8:133066915-133066937 TCTTTGGCCCAGACAGAGGAAGG - Intronic
1048474565 8:134731822-134731844 TCTGGCTCCCAGAAAGGAAAGGG + Intergenic
1049010118 8:139881887-139881909 TCTGGGGGACAGTAAGGAGAGGG - Intronic
1049494417 8:142923027-142923049 CATGTGGCCCAGAAAGCAGAGGG + Intergenic
1050432698 9:5577959-5577981 ACTGGGGCTGAGAAAGAATAGGG + Intergenic
1052356651 9:27511900-27511922 TCAGGTGCCCAGGAAGGAGAGGG - Intronic
1053293633 9:36898448-36898470 TCTGGGGCCCGGAGACCAGAGGG - Intronic
1054869015 9:70032019-70032041 TCTGGAAGCCGGAAAGAAGATGG - Intergenic
1056491691 9:87114684-87114706 TCAGGGGCTCAGAGAGAGGACGG - Intergenic
1056721850 9:89078766-89078788 TCAGGGGTCCAGAAAGGAGCTGG + Intronic
1057018554 9:91677786-91677808 TGTGGGGCCCAGAGAGGAAAGGG - Intronic
1057272784 9:93660170-93660192 TCTGGGATACAGAAAGGAGAGGG - Exonic
1058763057 9:108155032-108155054 TCTGGAGCCCAGAAAGACTCTGG + Intergenic
1059322011 9:113477255-113477277 ACTGTGGTCCTGAAAGAAGAGGG + Intronic
1059323098 9:113484249-113484271 GCTGGGCCCTAGAAAGGAGAGGG + Intronic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1060010804 9:120041413-120041435 TCTGGAGCCCAGAGAGGTGAAGG + Intergenic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061517691 9:131098928-131098950 TCTGGGGCCCTGTAGGAAGGAGG + Intronic
1061539207 9:131268476-131268498 TCTGGGTCCCAGAAGGAATGGGG - Intronic
1061597047 9:131637597-131637619 TGAGGGGTCCAGAAAGGAGAGGG + Intronic
1061766396 9:132884161-132884183 ACTGGGGCCCAGAGAGGGGAAGG + Intronic
1061881555 9:133571587-133571609 CGTGGGGCCCAGAAGGCAGAGGG - Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1062178928 9:135180293-135180315 ACTGGAGCCCAGAAAGCTGAAGG + Intergenic
1062466545 9:136684101-136684123 TCAGGGTCCCAGACAGAAAAGGG - Intronic
1062755107 9:138282775-138282797 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1203579015 Un_KI270745v1:26944-26966 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1203655737 Un_KI270752v1:22610-22632 TGTAGAGCCCAGGAAGAAGAGGG + Intergenic
1186672548 X:11781857-11781879 TCTGGGGCCCAGATGACAGAGGG + Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1188077251 X:25793576-25793598 TCTGGGTACCAGAAAGTACAAGG - Intergenic
1188326405 X:28808035-28808057 CCTTGGACACAGAAAGAAGAAGG - Intronic
1188956447 X:36439768-36439790 TCTGGGGCAAAGAAAGAACTAGG - Intergenic
1188973060 X:36640494-36640516 TCTGGGGCCCAGCAGGAAACAGG + Intergenic
1189446695 X:41086398-41086420 TCTGGGGCCGAGTAGGAGGATGG + Intronic
1191650826 X:63536350-63536372 TCATGGGCACAGAAAGTAGAAGG + Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191936737 X:66435071-66435093 TCTTGGGGCAAGAATGAAGAGGG + Intergenic
1191955665 X:66640025-66640047 TTTGGGGGCCAGTAGGAAGAAGG + Intergenic
1192196490 X:69032156-69032178 TCTGGGGCCCAGAGAAGGGAAGG - Intergenic
1192342944 X:70279004-70279026 CCTGAGGCTCAGAGAGAAGAAGG + Intronic
1193693926 X:84682506-84682528 GCTGGGGGCCAGAAGGAAAAGGG + Intergenic
1194221625 X:91200367-91200389 TGGGGGAGCCAGAAAGAAGATGG - Intergenic
1195130592 X:101847150-101847172 TGTGTGGGTCAGAAAGAAGAGGG + Intronic
1195175662 X:102313098-102313120 TGTGTGGGTCAGAAAGAAGAGGG - Intronic
1195183202 X:102373995-102374017 TGTGTGGGTCAGAAAGAAGAGGG + Intronic
1195379621 X:104257878-104257900 TATGGAGCCCAAAGAGAAGAAGG - Intergenic
1195907054 X:109854450-109854472 TATGGGGTCCAGGAAGTAGAAGG + Intergenic
1196881185 X:120199501-120199523 TGTGGGGCTGAGAAAGAAGAAGG - Intergenic
1196931019 X:120682133-120682155 TGTAGGGGCCAGAAGGAAGATGG - Intergenic
1196968472 X:121083885-121083907 TGTGTGGAGCAGAAAGAAGAGGG + Intergenic
1197297847 X:124740906-124740928 TCTGTGCCCCAGAGAGAGGAAGG + Intronic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1202174150 Y:22082105-22082127 TCTTGAGGCCAGAAGGAAGAAGG - Exonic
1202217210 Y:22504277-22504299 TCTTGAGGCCAGAAGGAAGAAGG + Exonic
1202325976 Y:23691782-23691804 TCTTGAGGCCAGAAGGAAGAAGG - Intergenic
1202381635 Y:24279562-24279584 TCCTGGGCCCAGTAAGAAGGAGG + Intergenic
1202489150 Y:25390564-25390586 TCCTGGGCCCAGTAAGAAGGAGG - Intergenic
1202544795 Y:25978272-25978294 TCTTGAGGCCAGAAGGAAGAAGG + Intergenic