ID: 925220053

View in Genome Browser
Species Human (GRCh38)
Location 2:2131803-2131825
Sequence TCTCTGTGCAGCACAGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925220053_925220057 18 Left 925220053 2:2131803-2131825 CCTCACTCTGTGCTGCACAGAGA 0: 1
1: 0
2: 4
3: 28
4: 349
Right 925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG 0: 1
1: 0
2: 1
3: 8
4: 94
925220053_925220055 11 Left 925220053 2:2131803-2131825 CCTCACTCTGTGCTGCACAGAGA 0: 1
1: 0
2: 4
3: 28
4: 349
Right 925220055 2:2131837-2131859 GACACCACGTTCTCTGCAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 136
925220053_925220054 8 Left 925220053 2:2131803-2131825 CCTCACTCTGTGCTGCACAGAGA 0: 1
1: 0
2: 4
3: 28
4: 349
Right 925220054 2:2131834-2131856 TCAGACACCACGTTCTCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925220053 Original CRISPR TCTCTGTGCAGCACAGAGTG AGG (reversed) Intronic
900114681 1:1023446-1023468 CCTCAGTGCAGCACAGAGGAGGG + Intronic
900331632 1:2137670-2137692 GCTCCGGGCAGCACAGGGTGTGG + Intronic
900567087 1:3338788-3338810 TCTCTGGGCAGGACACACTGTGG + Intronic
900896038 1:5483626-5483648 TCTCTGTCCTCCACAGACTGAGG + Intergenic
902152411 1:14454139-14454161 TCTCTGTGCAGCAAGGAGCTAGG + Intergenic
902682295 1:18051904-18051926 TCTAAGTGCAGCACAGTGTTGGG - Intergenic
902694623 1:18132121-18132143 TCTGTGTCCAGCACAGTGTTAGG - Intronic
903476101 1:23619993-23620015 CCTCTGTGCCGCACAGGGTTGGG + Intronic
903489649 1:23718711-23718733 TGTATGTGGAACACAGAGTGGGG + Intergenic
903926416 1:26833867-26833889 ACTCTGTGCAGCAGGGAGGGAGG + Intronic
904415193 1:30356666-30356688 TCTCTTTCTAGCACAGAGTAGGG + Intergenic
904838977 1:33358300-33358322 TCCATGAGCAGCACAGGGTGGGG - Intronic
904970130 1:34413099-34413121 TCTCTGAGCAGCACAGTGCTGGG - Intergenic
905128694 1:35735175-35735197 TCTCTCTGCCCCACAGACTGTGG + Intronic
905525260 1:38633491-38633513 TCTCTATCCAGAATAGAGTGGGG - Intergenic
906279033 1:44540793-44540815 TCTCTGTCCAGAACCGAGGGAGG + Intronic
906725922 1:48044165-48044187 TCTCTGTGCAGCCCAGGCTCAGG + Intergenic
909665850 1:78132370-78132392 GCTCTGGGCAGTACTGAGTGTGG + Intronic
910506123 1:87951804-87951826 TCCCAGTGCAGCCCAGTGTGGGG - Intergenic
912269290 1:108192862-108192884 TCCCAGCGCAGCCCAGAGTGCGG - Intronic
912373049 1:109188370-109188392 TCGATGTGCTGCAGAGAGTGGGG - Intronic
913042474 1:115040882-115040904 TCTCTGTGCTGCACTGCCTGGGG - Intergenic
913274252 1:117122037-117122059 TCTCTGGTCACCACAGAGAGAGG - Intronic
913547953 1:119887977-119887999 CCTCTGCTCAGCACAGAGTGAGG + Intergenic
915101948 1:153507186-153507208 TGTCAGTGCAGGACAGGGTGAGG + Intergenic
917803000 1:178587244-178587266 TCTCTCTGCAGCTCTGGGTGTGG + Intergenic
919137491 1:193529178-193529200 TCTCTCTGAAACACACAGTGTGG - Intergenic
919823963 1:201490701-201490723 TCTCTGTTGAGGGCAGAGTGAGG - Intronic
919920274 1:202163134-202163156 TCTGGGAGCAGCACAGGGTGAGG + Intergenic
920498400 1:206471222-206471244 ACTCAGGGCAGCTCAGAGTGTGG + Exonic
920801914 1:209196293-209196315 TATTTGTGGGGCACAGAGTGAGG - Intergenic
920807542 1:209249471-209249493 TGTCTGCCCAGCAGAGAGTGTGG + Intergenic
921075794 1:211699220-211699242 TGCCTGTGGAGCACAGAGCGGGG + Intergenic
921449321 1:215285768-215285790 TCTATGTACAGGAAAGAGTGAGG - Intergenic
922337514 1:224629741-224629763 AGTCTGTGCAGCAAAGACTGAGG - Intronic
923446812 1:234078896-234078918 TCTCTTTGCAGATCACAGTGTGG - Intronic
924048546 1:240057366-240057388 TATCTGTGCAGCACACATTTAGG - Intronic
924262365 1:242245458-242245480 TGCCTGTTCAGCACAGCGTGTGG + Intronic
924356760 1:243186046-243186068 GCTCTGCGCATCACAGAGGGGGG - Exonic
1063362451 10:5469441-5469463 TCTCCGTGCAGGACAGAGCTGGG - Intergenic
1063603086 10:7499747-7499769 TCTCTTTGCAGCGCACAGTAAGG + Intergenic
1063821957 10:9846328-9846350 TCTCTCTGCTGCAGAGAGAGGGG + Intergenic
1063966394 10:11349621-11349643 CTTCTGTGCAGCACAGAAAGTGG + Intergenic
1064186312 10:13165029-13165051 CCACTGTGCATCACAGTGTGAGG - Intronic
1066678881 10:37917167-37917189 GCTCTCTGCAGCAAAGAGGGGGG + Intergenic
1066687500 10:37994594-37994616 TCCCTGTGCAGCAATGAATGGGG + Intergenic
1067430052 10:46236890-46236912 TCTCCTTGCAGCACAGAGTTGGG + Intergenic
1067443594 10:46326952-46326974 TCTCCTTGCAGCACAGAGTTGGG - Intronic
1067688392 10:48481692-48481714 TCACTTTGCAGAACAGTGTGTGG - Intronic
1067776678 10:49169356-49169378 ACTCTGGGCATCACTGAGTGTGG - Intronic
1070149440 10:73796980-73797002 TCTCTGTGAAGCCCTCAGTGGGG - Exonic
1071297415 10:84232383-84232405 TCTTTGGGCAGCACAGCATGCGG - Exonic
1071471017 10:85984119-85984141 TCTCCCTGCACCACAGAGAGAGG + Intronic
1071899367 10:90102296-90102318 TGTCTGTGCATCAAAGAGTTAGG - Intergenic
1073034908 10:100557189-100557211 TGTCTGTGGAGGACACAGTGTGG + Exonic
1073618874 10:105026323-105026345 ACTCTGTGGAGCAGAAAGTGGGG - Intronic
1074553064 10:114463162-114463184 GCTCTGTGCAGCAAGGAGTCAGG + Intronic
1075160758 10:120022785-120022807 TCAATGTGCAGCACAGCGAGGGG + Intergenic
1075471726 10:122696010-122696032 TCTCTGTGCAGCTTAGGGTCTGG + Intergenic
1076368204 10:129935722-129935744 TTTCTGTGCAGCAGTGACTGCGG - Intronic
1076518454 10:131063120-131063142 AGTCTGTCCTGCACAGAGTGAGG - Intergenic
1076692049 10:132228834-132228856 TCTCCTTGCAGGACAGGGTGAGG - Intronic
1076866439 10:133168562-133168584 TCTGTGGGCAGCTCAGACTGTGG + Intronic
1077230189 11:1455261-1455283 GCTGGGTGCAGCACAGGGTGGGG - Intronic
1077326613 11:1966801-1966823 TCTAGGGGCAGCACAGAGGGAGG - Intronic
1077416463 11:2426433-2426455 TCCCTGTGCATCCCAGGGTGGGG + Intergenic
1077531069 11:3095178-3095200 TCTCTGTGCAGCTCTGATGGGGG + Intronic
1078582271 11:12547689-12547711 CCTCTGTGCAGGACAAAGTCAGG - Intergenic
1079175842 11:18139625-18139647 ACTCTGTGCTGCTCACAGTGAGG + Intronic
1079351938 11:19699064-19699086 TCACTGTGGGCCACAGAGTGGGG - Intronic
1080718393 11:34825664-34825686 TCTCTGGGCTGCACAGATAGAGG - Intergenic
1081648177 11:44804565-44804587 TCTCAGTTCAGCACAGAGCCTGG + Intronic
1084683640 11:70681203-70681225 TCTCTCTGCTGCTCAGCGTGGGG + Intronic
1085025852 11:73236130-73236152 TCTGTGCTCAGCACAGAGTCAGG - Exonic
1085912727 11:80847601-80847623 TCTCCATGCAGCACTGAGTCAGG + Intergenic
1086914512 11:92513311-92513333 TCATTGTTCAGCACAGTGTGTGG - Intronic
1088537358 11:110875853-110875875 CTTCTGTGCAGCTCAGAATGGGG - Intergenic
1088795448 11:113263703-113263725 TCGCAGATCAGCACAGAGTGGGG + Intronic
1089379627 11:118018471-118018493 TCTCTGTGGATGACAGAGAGAGG + Intergenic
1090442599 11:126736846-126736868 TTCCTGGGCAGCACAGGGTGGGG - Intronic
1202809593 11_KI270721v1_random:21980-22002 TCTAGGGGCAGCACAGAGGGAGG - Intergenic
1091594101 12:1864238-1864260 TCTGAGTGCAGCAAAGAATGAGG + Intronic
1091675738 12:2488138-2488160 GGTCTGTGCACCACAGAGTAAGG + Intronic
1091826419 12:3516112-3516134 TCTCAGAGCAGCATTGAGTGGGG + Intronic
1091957580 12:4660311-4660333 TCTGAGTGCAGCAAAGATTGAGG + Intronic
1092388316 12:8052845-8052867 ACTTAGTGCATCACAGAGTGTGG + Exonic
1093756943 12:22863208-22863230 TCTAGGTGCAGAACAGACTGGGG + Intergenic
1093959133 12:25253129-25253151 TCTCTGAGCTGCACGGAATGTGG - Intergenic
1096351065 12:50901957-50901979 TCACTGTGCACCACAGCCTGAGG + Intergenic
1096477618 12:51917957-51917979 CCTCTGTGCAGCACTGATTAGGG + Intronic
1096593843 12:52681264-52681286 TCTCTTTGCAGTCCAGTGTGAGG - Intergenic
1096668340 12:53181565-53181587 TCTCTGTGAAGCTCAGAACGAGG - Intronic
1097276538 12:57817498-57817520 ATTCTGAGCAGCACAGGGTGGGG - Intronic
1097552980 12:61098946-61098968 TCTCTCTGCAGGCCACAGTGTGG - Intergenic
1098070026 12:66663630-66663652 TTTCTGTGCAGAAGTGAGTGGGG + Intronic
1098075221 12:66722641-66722663 TTTCTGTGAAGCACATAGGGAGG + Intronic
1100583213 12:95955802-95955824 ACTCTGGGCAGCAAGGAGTGTGG - Intronic
1100594775 12:96062457-96062479 TCTCTGTGCCACACAGAGAGAGG + Intergenic
1101778401 12:107814727-107814749 TCTCTGTGGACCACACAGAGAGG + Intergenic
1102346819 12:112166119-112166141 TCTGGGTGCAGCACAGGCTGGGG - Intronic
1103929118 12:124439962-124439984 TCTCGGTGCAGCAGTGGGTGGGG - Intronic
1104308503 12:127632661-127632683 TCTCTGTGCAGCTAAGCCTGTGG + Intergenic
1104583514 12:130029047-130029069 TCTCTGTGCAGGGCTCAGTGGGG + Intergenic
1104781718 12:131425763-131425785 TCTCTGTCCTGCAGAGAGAGAGG + Intergenic
1104889001 12:132130785-132130807 CATCTGTGCAGCTCAGCGTGAGG - Intronic
1106326969 13:28701397-28701419 TCTCAGTGAAGCACTGATTGTGG + Intronic
1106583562 13:31037871-31037893 TCTCTGGGCAGCACCGAGGTAGG + Intergenic
1107266952 13:38567265-38567287 TCTCTGTGTGGGGCAGAGTGAGG - Intergenic
1107640849 13:42441629-42441651 TCCCTGAGAAGAACAGAGTGAGG + Intergenic
1107691881 13:42961658-42961680 TCTGTGTGCAGCATTTAGTGAGG - Intronic
1108050079 13:46426493-46426515 TCCCTGGGCAGGACAGAGTGGGG - Intronic
1108494460 13:51010216-51010238 TCTCTGTACAGCTCAGAGTGGGG - Intergenic
1110472409 13:75874996-75875018 TCTCTTACCAGCACAGACTGAGG - Intronic
1113389733 13:109883947-109883969 CCTCTGTGAAGCACAGCTTGTGG - Intergenic
1116475724 14:45336480-45336502 TCTTTGTGCAGCATACAGTTGGG + Intergenic
1118159579 14:63275001-63275023 TCTCTTTGCTGCTCAAAGTGTGG + Intronic
1118410336 14:65470856-65470878 TGACTGTGCTGCACAGAGGGCGG + Intronic
1118670097 14:68115823-68115845 GCTCTGTGCATCACAGAGTGGGG + Intronic
1119094409 14:71815562-71815584 TCTATCTGCAGCACAGCGTAGGG + Intergenic
1119211765 14:72837235-72837257 CCTCTGTGCATGACAAAGTGTGG - Intronic
1119552087 14:75522500-75522522 TCCCTCTGCACCCCAGAGTGAGG + Exonic
1121097039 14:91224703-91224725 TCTTGGTGCAGCACAAAGTCCGG + Exonic
1122004347 14:98689575-98689597 AATATGTGCAGCAAAGAGTGTGG + Intergenic
1122202262 14:100129738-100129760 TCTCTGTGCAGCGCTGGGGGCGG - Intronic
1124235569 15:27986764-27986786 TCTTTCTGCATCTCAGAGTGAGG - Intronic
1124841318 15:33244625-33244647 TCTCTGGGCATTACAGATTGTGG - Intergenic
1125973211 15:43929113-43929135 TCACTGTGCAGCTCTGAGGGTGG + Intronic
1127098310 15:55535537-55535559 TCTCTGTGCACCACAGGCAGGGG - Intergenic
1128330854 15:66754635-66754657 TAGCTGTTCAGCACAGAGTTGGG + Intronic
1128802146 15:70503758-70503780 TCTCTGCCCAGCACAGAGCCTGG + Intergenic
1129243202 15:74264043-74264065 CATCTGTGCAGCAGAGAGAGGGG + Intronic
1129741959 15:77993626-77993648 TCTCTGAGGACCACAGAGTGGGG - Intronic
1129843746 15:78758844-78758866 TCTCTGAGGACCACAGAGTGGGG + Intergenic
1129905472 15:79184228-79184250 GCTCGTGGCAGCACAGAGTGAGG + Intergenic
1129985203 15:79912845-79912867 CCTGTGTGCAGCACAGTGTTGGG - Intronic
1130258059 15:82334956-82334978 TCTCTGAGGACCACAGAGTGGGG - Intergenic
1130596873 15:85255007-85255029 TCTCTGAGGACCACAGAGAGGGG + Intergenic
1131274480 15:90969396-90969418 TCTCTGGGGAGCACACAGTTGGG - Intronic
1131511790 15:93053149-93053171 TCTCTGAGCAGGACAGAGGATGG - Intronic
1131997539 15:98146506-98146528 CCTCTCTGCAGAACAGAGGGTGG + Intergenic
1132122650 15:99191299-99191321 ACTCTGTGGAACACAGTGTGGGG + Intronic
1132497290 16:269879-269901 TCCGTGTGCCCCACAGAGTGAGG + Intronic
1132602360 16:779385-779407 TCTGTGTGCAGCCCAGAGCCTGG - Intronic
1133605358 16:7381908-7381930 TCTTTGGGCATCACAGTGTGGGG - Intronic
1133830841 16:9322054-9322076 TCCCTGAGCAGCACAGAGGATGG + Intergenic
1134028313 16:10971760-10971782 TGTCAGTGCAGCGGAGAGTGGGG - Intronic
1134423095 16:14112590-14112612 TCTATGTGAAGAACAGACTGTGG - Intronic
1135585932 16:23670857-23670879 TCTCTGTGCAGCATATGGTGAGG - Exonic
1136694580 16:32066348-32066370 ACTGTGTGAAACACAGAGTGAGG + Intergenic
1138412994 16:56854356-56854378 GCTGTGTGCAGCACAGAATCTGG - Intergenic
1138748468 16:59391070-59391092 TCTCTCTGCCGCACAGAAAGGGG + Intergenic
1139344554 16:66294129-66294151 CCTCTCTGCAGGACAGAGAGTGG - Intergenic
1141315375 16:82957580-82957602 TGTTTGTTCAGCACAGAGGGTGG - Intronic
1141463114 16:84189951-84189973 TGTGTGTGCAGCCCAGAGAGTGG - Intergenic
1142414636 16:89934718-89934740 TCCCTGTACAGGTCAGAGTGGGG + Exonic
1203097338 16_KI270728v1_random:1271267-1271289 ACTGTGTGAAACACAGAGTGAGG + Intergenic
1142801858 17:2351304-2351326 TCCCTGGGCAGCACAGAGTCTGG - Intronic
1143038353 17:4014445-4014467 TCTCAGTGCAACACAGAGGAGGG - Exonic
1143361377 17:6374506-6374528 TCTCTGGGCAGCAGACAGTTGGG - Intergenic
1143409379 17:6699380-6699402 TCCATGGGCAGGACAGAGTGGGG + Intronic
1143539372 17:7560178-7560200 CCTCTGTGAAGCTCAGAGTGTGG - Intronic
1144686237 17:17228068-17228090 CCTCCGTGCAGAAGAGAGTGCGG + Exonic
1145243086 17:21251065-21251087 TGGCTGTGCAGCACAGGGTGGGG - Intronic
1145721742 17:27079730-27079752 TCTCTGTGAAGAAGAGACTGGGG - Intergenic
1145987346 17:29055960-29055982 TATCTGGGCAGCTAAGAGTGTGG - Intronic
1148466481 17:47868145-47868167 GCTCTGTGCTGCAGTGAGTGGGG - Intergenic
1148507824 17:48142135-48142157 ACTATATCCAGCACAGAGTGGGG + Intronic
1148567086 17:48639808-48639830 TGGTTGTGCAGCACAGAGAGGGG + Intergenic
1150488309 17:65559201-65559223 TATCTGTGCAGGGCCGAGTGGGG - Intronic
1150572943 17:66404131-66404153 TTTCTGTGCAACAGAGATTGGGG - Intronic
1150915009 17:69428074-69428096 TATCAGTCTAGCACAGAGTGAGG - Intronic
1151485703 17:74398126-74398148 TATCTTTGAAGCAGAGAGTGAGG + Intergenic
1152688641 17:81707503-81707525 ACACTGTGCAGCTCAGTGTGTGG + Exonic
1152881094 17:82815655-82815677 TGTCTGTACAGGATAGAGTGGGG + Intronic
1154092356 18:11377752-11377774 TCTGTATACAGCACTGAGTGAGG - Intergenic
1156291337 18:35750931-35750953 TCTCTCTGCTGCAGAGAGAGGGG + Intergenic
1157395704 18:47339097-47339119 TCTCTCTGCATCACTGAATGAGG - Intergenic
1157749847 18:50168534-50168556 TCTCTGAGGAGCAGGGAGTGGGG - Intronic
1157764454 18:50286255-50286277 TCTCTGTGGGGCAGAGAGTAGGG + Exonic
1159066893 18:63579858-63579880 TCTGTTTGAAGCACAGTGTGAGG + Intergenic
1159252202 18:65893667-65893689 TCTCTCTGCTGCAGAGAGAGGGG - Intergenic
1160242274 18:77132514-77132536 TCTCTGTGCCCCTCCGAGTGGGG - Intronic
1160859826 19:1233083-1233105 TCACTGTGGAGCGCAGAGGGTGG - Intronic
1161017809 19:1991812-1991834 GCTCTGTGCAGCCCAAAGGGCGG - Intronic
1161668101 19:5589317-5589339 TCTCTGGGCAGCACAGACGGTGG - Intronic
1161736881 19:5996975-5996997 GCTCTGAGCAGCCCAGAGAGAGG - Intronic
1163458699 19:17423794-17423816 TCTCAGGTGAGCACAGAGTGGGG + Exonic
1164551461 19:29216059-29216081 TCTCTGGGCAGAAATGAGTGGGG - Intergenic
1164857426 19:31535898-31535920 TCCCTGTGGAGCACAGACTGGGG - Intergenic
1164859947 19:31554993-31555015 TCCCTGGTGAGCACAGAGTGTGG - Intergenic
1165684219 19:37804539-37804561 TGTCACTGCAGCACAAAGTGGGG - Intronic
1166247705 19:41541622-41541644 TCTCTTTCCAGCACAGAGAGGGG + Intergenic
1166464676 19:43021966-43021988 TCTATGTGCAGGAATGAGTGAGG - Intronic
1167211126 19:48134808-48134830 TCTCTGCTCAGCACCCAGTGGGG + Intronic
1167341990 19:48921821-48921843 TCCATGTGCAGCACAGCCTGTGG - Exonic
1167448509 19:49553683-49553705 TCTTTGTGCAGTGCAGGGTGGGG - Intergenic
1167912593 19:52716231-52716253 TCTCTGTGGATCACAGGCTGAGG + Intronic
1168268765 19:55238389-55238411 TCCCTGTACAGCACAGCGTAAGG - Intronic
1168665627 19:58202909-58202931 ACTGTGTACAGAACAGAGTGTGG + Intronic
925102910 2:1264550-1264572 TTGCTGTGCACCACAGATTGAGG + Intronic
925114063 2:1363505-1363527 TCTCTGTGCAGGAAACAGTGTGG - Intronic
925204747 2:1996466-1996488 GCTCTGTGCAGCCCACACTGAGG - Intronic
925220053 2:2131803-2131825 TCTCTGTGCAGCACAGAGTGAGG - Intronic
925651682 2:6097025-6097047 TCTTAGTGCAGCAGACAGTGGGG + Intergenic
927037076 2:19189027-19189049 TCACTGTGCAGCACACACTGAGG - Intergenic
927152815 2:20205514-20205536 TACCTGTGCAGCACAGGGTAGGG - Intronic
927631375 2:24777090-24777112 TCTCTCTGCTGCAAAGAGAGGGG + Intergenic
928406690 2:31020453-31020475 TCTCTGGGTAGCACAAAGTTGGG + Intronic
928576984 2:32665146-32665168 TCTCTAAGAAGCACAGAATGTGG - Intronic
932085334 2:68752635-68752657 TCTCTGTGAACCTCAGACTGAGG - Intronic
932585283 2:73023874-73023896 TCTCTTTCCAGCACAGAGACAGG + Intronic
933733934 2:85480015-85480037 TCTCTGGGAAGCAGAGATTGAGG + Intergenic
935346405 2:102112283-102112305 TTTATGGCCAGCACAGAGTGGGG + Intronic
936909035 2:117571805-117571827 TCTCTGTGAACCACAGACAGGGG + Intergenic
937157363 2:119730524-119730546 TGTCTGTGCAGCACGGAGTGAGG - Intergenic
937342728 2:121101508-121101530 TCTCTGGGCATCCCAGGGTGGGG + Intergenic
937474823 2:122205887-122205909 CTGCTGTGCAGCACAGAGGGTGG - Intergenic
938201235 2:129374607-129374629 ACTCTGTGCAGAACTGATTGTGG - Intergenic
938217641 2:129533682-129533704 TCTCTTGGCAGAAGAGAGTGGGG + Intergenic
939276175 2:139999250-139999272 TTTCTGAGCAGCACAGAGCAGGG + Intergenic
944470665 2:200050204-200050226 TCTCTGTGCTAGAGAGAGTGGGG - Intergenic
1168842030 20:915776-915798 TCTCTGAGCTGCACAAAGAGGGG - Intronic
1169046335 20:2537043-2537065 TCTCTGTGCAGGGCAGGGGGTGG + Intronic
1170418527 20:16169586-16169608 TGCCTGTGCAGGACAGAGTTGGG + Intergenic
1171189825 20:23151036-23151058 TCACTGTGCAGAAAAGAGAGTGG - Intergenic
1171785147 20:29457203-29457225 TCACTCTGGAGCACAGGGTGCGG + Intergenic
1173572480 20:44086344-44086366 TGTGTGTGAAGCACAGAGCGTGG + Intergenic
1173612419 20:44379763-44379785 TCACTGTGTGGCACAGACTGGGG + Intronic
1175012039 20:55747744-55747766 TCTCTGAGGAGCCCAGTGTGAGG - Intergenic
1175674752 20:60936932-60936954 TCCTTGTGGAGCACAGAGAGAGG - Intergenic
1178479587 21:32968085-32968107 TCTCTCTGCTGCAGAGAGAGGGG + Intergenic
1180718373 22:17887862-17887884 TCTGTGTGCAGCTCAGAGTGTGG - Intronic
1180846406 22:18984833-18984855 TCTCTGCTCAGCCCAGGGTGTGG + Intergenic
1181467186 22:23116565-23116587 TCCCTGAGGAGCCCAGAGTGGGG - Intronic
1182300561 22:29334622-29334644 TCTCGGAGCAGCTCAGGGTGGGG + Intronic
1184238690 22:43200257-43200279 TCTCCCTGGAGCACAGCGTGCGG + Exonic
1184614917 22:45631457-45631479 TATTTGTGCAGCAAAGAATGAGG + Intergenic
1185377566 22:50489217-50489239 TCTCACTGCAGCACAGAGCTCGG + Exonic
950448361 3:13051410-13051432 GCTCTGTGCTGCACAAAGTCAGG + Intronic
950710030 3:14807352-14807374 GCTCTGGGAAGCACAGGGTGAGG + Intergenic
952151912 3:30602663-30602685 TATCTGTAGAGCACGGAGTGTGG + Intergenic
956209819 3:66791358-66791380 TGTCTGCGCAGCCCAGAGGGTGG + Intergenic
956212470 3:66815716-66815738 ACTCTGTGCATCACAGAGTCTGG - Intergenic
957402094 3:79729361-79729383 TTTCTGTGCATGTCAGAGTGTGG - Intronic
959115840 3:102177361-102177383 TCTCTCTGCTGCAGAGAGAGGGG + Intronic
959301416 3:104607090-104607112 TTTCTTTGCAGCAAAGAGTAAGG - Intergenic
960109327 3:113829976-113829998 TCTCTCTGCTGCAGAGAGAGGGG + Intronic
960353213 3:116618573-116618595 GCTCTCTGCAGCAGAGAGGGGGG - Intronic
960638899 3:119809328-119809350 TCTCTGCGCACCGCAGAGAGGGG + Intronic
961541227 3:127600778-127600800 TCTCTGAGAAGCAAAGAGAGAGG + Intronic
961621577 3:128228613-128228635 CCTCTGTGGAGAAGAGAGTGAGG - Intronic
961739436 3:129023806-129023828 CCTCTGTGCACCTCAGAGAGGGG - Intronic
962366923 3:134793069-134793091 TCTCTCTTCAGCAGACAGTGAGG + Intronic
962816674 3:139006438-139006460 TCTCTCAGCAGCACGGACTGCGG - Intronic
963079608 3:141378725-141378747 TCTCTGAGAAGCAGAGGGTGCGG - Intronic
964933112 3:162049337-162049359 TCTCAGTGCAGCACAAGGTCGGG + Intergenic
966053925 3:175658463-175658485 TTTCTGTTCAGCAGAGATTGAGG + Intronic
966676200 3:182593213-182593235 TCTCTGTGGAGAACAGACTGAGG + Intergenic
966785791 3:183621350-183621372 GCTTTGTGCAGCAGAGAGGGGGG - Intergenic
968089614 3:195892093-195892115 TCTTTGTGCAGCACAGGGCATGG + Intronic
968468633 4:765904-765926 TCTCTGTGCAGCCCTGCATGTGG + Intronic
968934688 4:3603876-3603898 TGTGTGTGGAGCATAGAGTGAGG + Intergenic
969226163 4:5799760-5799782 TGTCTGTGCAGCAAAGAGGCTGG + Intronic
969518134 4:7660139-7660161 GCTGTGTGCAGCACAGACTCAGG + Intronic
970367716 4:15377039-15377061 TCTGTGCCAAGCACAGAGTGAGG - Intronic
970564529 4:17318669-17318691 TCTTTGGGAAGCACACAGTGGGG - Intergenic
971906975 4:32738865-32738887 TATCTGTGCAATAGAGAGTGGGG - Intergenic
972762593 4:42121750-42121772 AGTCTGTGCAGGACAGAGAGAGG + Intronic
973279762 4:48347059-48347081 CCTGTGTGCAGCACAGTGTTGGG + Intronic
975766997 4:77679356-77679378 TTTCTGTGTAGCCCAGACTGTGG + Intergenic
976350533 4:84055352-84055374 TCTCTGTGTATCACAGAGTAGGG - Intergenic
976381639 4:84406191-84406213 TGTCTGTGTAGCACTGTGTGTGG + Intergenic
978094564 4:104760069-104760091 TTTCTGTGAAGCACAGAGCCTGG - Intergenic
979245059 4:118493556-118493578 GCTCTGTGCATCACAGAGGGGGG + Intergenic
979610540 4:122684384-122684406 TGTCTGTTGATCACAGAGTGGGG + Intergenic
980257606 4:130402568-130402590 TCTCTGTGCACCACAGGCAGGGG + Intergenic
981443418 4:144808865-144808887 TCTCTGTGTTGCAAAGACTGTGG - Intergenic
982093748 4:151901633-151901655 TTTCTGGGCAGCATAGAGTTGGG + Intergenic
982185234 4:152789533-152789555 TCTCTGTGAAGCACACAATTGGG + Intronic
984133131 4:175902743-175902765 TCTCTCTGCTGCAGAGAGAGGGG - Intronic
984648654 4:182245971-182245993 TCACTGTTAACCACAGAGTGAGG - Intronic
984849169 4:184138875-184138897 TCTATGTGCAGAGCAGAGAGAGG + Intronic
985468413 5:20316-20338 CCTTTGTCCCGCACAGAGTGGGG - Intergenic
989174955 5:38515254-38515276 TATTTGTATAGCACAGAGTGTGG - Intronic
990285060 5:54292911-54292933 TCTCTTTGCAACACCGTGTGAGG - Intronic
992614248 5:78534256-78534278 TCTCTGTGGAGCACACTGCGGGG - Intronic
993825540 5:92681397-92681419 TCACTGTTTAGCACAGAGTCTGG - Intergenic
994050298 5:95355160-95355182 TCTCTGTGAAGCAGATAGTGTGG + Intergenic
994313255 5:98301726-98301748 TCTCTGTGGAGAAGAAAGTGGGG + Intergenic
995581315 5:113606066-113606088 TCTCTATTCTGCACAGAGAGAGG - Intergenic
997170517 5:131714573-131714595 TATGTGTGGAGCACAGAGTAGGG - Intronic
997837231 5:137205171-137205193 TCACTGTGTAGCACAGAATTTGG + Intronic
998517015 5:142765618-142765640 TCACTGTGCAGCACAAAATATGG + Intergenic
998958546 5:147461445-147461467 TCTCTCTGCTGCAGAGAGAGGGG - Intronic
999810901 5:155126382-155126404 TCTCTGTGTGGCACAGAGGTTGG + Intergenic
999926494 5:156384513-156384535 TCACTGTCCAGCACAGTGTCTGG - Intronic
1000257401 5:159553064-159553086 CCTCAGTGCAGCAGAGGGTGAGG - Intergenic
1000731740 5:164843170-164843192 TCTCAGTCCAGGACAAAGTGAGG - Intergenic
1000758418 5:165189813-165189835 TCTCTGTCCTGCCCAAAGTGAGG + Intergenic
1001256175 5:170185072-170185094 TCTCAGTGCAGTACAGACTCTGG + Intergenic
1003194759 6:3904610-3904632 TCTCTTTGCAGCCTAGAGTGTGG + Intergenic
1003783492 6:9456418-9456440 TCATTGTGGAGCACAGTGTGTGG - Intergenic
1004617749 6:17306493-17306515 TCTCTGCACAGCAGAGAGGGGGG + Intergenic
1005341219 6:24845471-24845493 TCTCATGGCAGCACAGAGGGAGG + Intronic
1005813280 6:29531895-29531917 TGTGTGTGCAGCCTAGAGTGGGG - Intergenic
1006373862 6:33660988-33661010 TCTATGTAGACCACAGAGTGAGG - Intronic
1006840381 6:37024908-37024930 TGTGTGCCCAGCACAGAGTGTGG - Intronic
1007817455 6:44534641-44534663 TCCCTGGGGAGGACAGAGTGAGG + Intergenic
1010914207 6:81595637-81595659 TCTCGTTGCAGTACAGAGAGTGG - Intronic
1010927043 6:81755456-81755478 TCTCAGTGCAGCGCAAAGTGTGG - Intergenic
1011659835 6:89584898-89584920 TCTCTGTGTGGCAGAGAGAGGGG + Intronic
1012356879 6:98325200-98325222 TCTCTGTTCATCACAAAGAGGGG - Intergenic
1013409336 6:109870243-109870265 TGTCTGTGGAGCACAGAGCTGGG - Intergenic
1014710108 6:124796492-124796514 TATCTGTGGGGCACAGATTGAGG + Intronic
1015487930 6:133792571-133792593 TTTCTGTGCAGAACACAGTCAGG - Intergenic
1015549283 6:134395194-134395216 TCTAGGTGCAACACAGAGAGTGG - Intergenic
1016899322 6:149086032-149086054 GCCCTGTGCAGGACAGAGGGAGG - Intergenic
1017654909 6:156618444-156618466 TCTCTGAGCAGCCCAGAGCAAGG - Intergenic
1019133349 6:169893247-169893269 TCTCTGTGGGGCTCACAGTGAGG - Intergenic
1019684476 7:2373332-2373354 TCTCTGCTCAGCACAGAGCCCGG + Intronic
1022042077 7:26590824-26590846 ACTCTGTGCAGGGCAGATTGGGG - Intergenic
1023423727 7:40012191-40012213 TCTCTCTGTAGCAAAGAGTAAGG - Intronic
1024054362 7:45650495-45650517 TCTGTGCTCAGCACCGAGTGGGG - Intronic
1024358306 7:48441609-48441631 TGTCTCTGCACCGCAGAGTGTGG + Intronic
1025813948 7:64892634-64892656 TCCCTGTGCTGCAGAGAGAGGGG + Intronic
1028331911 7:89605269-89605291 TCCAGCTGCAGCACAGAGTGGGG + Intergenic
1028919015 7:96290089-96290111 TCTCTGGCCAGAAGAGAGTGGGG + Intronic
1028993711 7:97076766-97076788 GCTCTGGGCAGAGCAGAGTGTGG - Intergenic
1029585763 7:101470054-101470076 TCTCTCTGCTGCAGAGAGAGGGG + Intronic
1032585263 7:133140570-133140592 CCTCTGTTTAGCACAGAGCGTGG + Intergenic
1035232127 7:157471553-157471575 TGAGGGTGCAGCACAGAGTGTGG + Intergenic
1035793144 8:2326014-2326036 TCTCTGTGCTGGGCACAGTGTGG + Intergenic
1035799660 8:2395691-2395713 TCTCTGTGCTGGGCACAGTGTGG - Intergenic
1036382438 8:8245782-8245804 TCTCTCTGCTGCAGAGAGAGGGG - Intergenic
1036444387 8:8808903-8808925 TCCATGGGCAGCACAGAGGGAGG + Intronic
1036587528 8:10138183-10138205 TCCCTGTGCAGTACAGATAGAGG + Intronic
1038005788 8:23428951-23428973 TTTCTGAGCTGCAGAGAGTGTGG + Intronic
1038271224 8:26077802-26077824 TCTCTGTGCAGCCCTAAGGGAGG + Intergenic
1038646304 8:29365301-29365323 GCTCTGTGCTGCTGAGAGTGGGG + Intergenic
1039060150 8:33566533-33566555 GCGCTGTGCAGAGCAGAGTGGGG + Intronic
1039117477 8:34108361-34108383 TCTCTCTGCTGCAGAGAGGGGGG + Intergenic
1039444649 8:37621440-37621462 TCTCTGAGAAGGACAGAGTGGGG - Intergenic
1045682590 8:104678799-104678821 CATCTGTGAAGCACAGAGTTCGG - Intronic
1048319465 8:133387122-133387144 TCTCTCTGCTGCAGAGAGAGGGG + Intergenic
1048610349 8:136015490-136015512 TCTCTGAGTAGCCCAGAATGTGG - Intergenic
1048842063 8:138575224-138575246 TTTCTGCTCAGCACTGAGTGAGG - Intergenic
1050458700 9:5858492-5858514 ACTGTGTGCAGCACAGAGGCTGG - Intergenic
1051950315 9:22622961-22622983 TCTGTCTGAGGCACAGAGTGGGG - Intergenic
1052034960 9:23670032-23670054 TCTCTGTGCAGCACTAATTTTGG + Intergenic
1052383480 9:27797448-27797470 CCTCTGGGCTGCACAGTGTGAGG + Intergenic
1053588471 9:39485318-39485340 TCACTCTGCAGCCCAGGGTGGGG - Intergenic
1053918231 9:42961442-42961464 CCTCAGTGCAGTACACAGTGGGG - Intergenic
1054455478 9:65428102-65428124 TGTGTGTGGAGCATAGAGTGAGG - Intergenic
1054577835 9:66879976-66879998 TCGCTCTGCAGCCCAGGGTGGGG + Intronic
1056121666 9:83494235-83494257 TCTCTGTTCTCCACAGTGTGTGG + Intronic
1057911085 9:99021194-99021216 CCTCTGTGCAGCCCAGAGGGAGG - Intronic
1057948790 9:99353181-99353203 TCCCTGAGCATCACTGAGTGGGG - Intergenic
1058562969 9:106249337-106249359 GCTCTGGGCATCACATAGTGAGG - Intergenic
1058700494 9:107596244-107596266 TCTATGTCCAGCACAGAGCCAGG + Intergenic
1058803143 9:108564347-108564369 TCTCTTTGGAGCAAAGAATGAGG - Intergenic
1061050132 9:128190529-128190551 CCTCTGTCTACCACAGAGTGGGG - Intronic
1061839309 9:133348359-133348381 TCTCCGTGCCACACCGAGTGGGG - Intronic
1062393247 9:136342437-136342459 CCTCTGTGCCGCCCCGAGTGCGG + Intronic
1062464916 9:136676669-136676691 TCTCCCTGCAGCTCAAAGTGTGG - Exonic
1062527822 9:136985386-136985408 TCTCTCTGCAGACCAGTGTGCGG + Exonic
1062730329 9:138104874-138104896 TCTCTGGGCAGCACTGGCTGGGG + Intronic
1203445933 Un_GL000219v1:56435-56457 TCACTCTGGAGCACAGGGTGCGG + Intergenic
1186165458 X:6822072-6822094 TCTTTCTGCTGCAGAGAGTGGGG - Intergenic
1186212974 X:7269514-7269536 ATTCTCTGCAGCACTGAGTGGGG + Intronic
1186576356 X:10770355-10770377 TCCCTCTGAAACACAGAGTGAGG - Intronic
1188914856 X:35897795-35897817 TCTCTGAGAAGCTTAGAGTGAGG - Intergenic
1190503863 X:51106121-51106143 TCTCTGTTCAGCACTAAGTGGGG + Intergenic
1191192948 X:57686050-57686072 TCTCTCTGCAGAAGAGAGTGGGG + Intergenic
1191783387 X:64892489-64892511 TCTCTGGGCAGCATAGAGGAAGG + Intergenic
1194535489 X:95101823-95101845 GCTCTCTGCAGTAAAGAGTGGGG + Intergenic
1194906867 X:99588159-99588181 TCTTTTTGCACCAAAGAGTGAGG - Intergenic
1198633689 X:138672261-138672283 TAACTGTGGAGCACAAAGTGGGG + Intronic
1199084262 X:143610586-143610608 TCTGTGTGCAAGACAGAGAGAGG - Intergenic
1201159852 Y:11158269-11158291 TCTCTGGGGAGCACAGGGTCAGG + Intergenic
1201772239 Y:17626005-17626027 TGTGTGTGCAGAACAGAGTCTGG + Intergenic
1201829316 Y:18279981-18280003 TGTGTGTGCAGAACAGAGTCTGG - Intergenic
1201886648 Y:18891273-18891295 TCTCTGTGTAGGACAGTGTCGGG - Intergenic