ID: 925220057

View in Genome Browser
Species Human (GRCh38)
Location 2:2131844-2131866
Sequence CGTTCTCTGCAGGAGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925220053_925220057 18 Left 925220053 2:2131803-2131825 CCTCACTCTGTGCTGCACAGAGA 0: 1
1: 0
2: 4
3: 28
4: 349
Right 925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG 0: 1
1: 0
2: 1
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925220057 Original CRISPR CGTTCTCTGCAGGAGGTACA TGG Intronic
900821762 1:4895223-4895245 CTTTTTCTGCAGGAGGTAGCAGG + Intergenic
915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG + Exonic
919771986 1:201167513-201167535 CGTTATCTGCAGGAGTCACTGGG + Intronic
922564055 1:226589753-226589775 GGTCCTCTGCAGCAGGGACAGGG - Intronic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1067531138 10:47074466-47074488 TGTCCTCTGCAAGATGTACAAGG + Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG + Intronic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1075048985 10:119168001-119168023 CATTCATTGCAGGAGTTACACGG + Exonic
1075779271 10:125006335-125006357 CGTGCCCTGCATGAGGTGCAGGG + Intronic
1076462795 10:130657791-130657813 CGTTCACTGCAGGAGCCACGGGG - Intergenic
1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG + Exonic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1083881824 11:65552748-65552770 GGTTGACTGCAGGAGGAACAAGG - Intronic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1085682894 11:78594840-78594862 CGTTATCTGCAGGAGCAACTGGG - Intergenic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1089921509 11:122213497-122213519 CGTTCTCTGATGGTGGTCCAGGG + Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG + Exonic
1133491079 16:6268814-6268836 TGTTCTCTGTTGGAGGAACAGGG - Intronic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1140767059 16:78169750-78169772 CGTTGTTTGCAGGAGGAAAAGGG + Intronic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1146602718 17:34232732-34232754 TGTTATCTGCAGGAGTTACTGGG - Intergenic
1146984691 17:37204121-37204143 CTTTCTCTGCAAGAAGTCCATGG + Intronic
1147562031 17:41515189-41515211 CATTCTCTGCATGAGATAGATGG - Intronic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156772162 18:40741779-40741801 CTTTGGCTGCAGGTGGTACAAGG - Intergenic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1160207775 18:76850292-76850314 TGTTCTCTAAAGGAGGTCCATGG - Intronic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
934572844 2:95383321-95383343 AGTTCTCTGCAGGCTCTACACGG + Intronic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
942746435 2:179239371-179239393 AGTCATCTGCAGGAAGTACAAGG + Intronic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
945440154 2:209868736-209868758 TGTTCTCTGCATGGGTTACAGGG - Intronic
947750557 2:232529922-232529944 CGTTCTCTGAGGGCGGCACATGG - Exonic
948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG + Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173729394 20:45317959-45317981 CGTTTTCTAGAGGAGGAACAGGG + Intergenic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1180157648 21:45985876-45985898 CGCTGTCTGCAGGGGGTGCATGG + Intronic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG + Exonic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
963602646 3:147391395-147391417 CGCTCTCTGCACGAGGGAAAGGG - Intronic
981055554 4:140357507-140357529 CATTCACTGCAGGAGGTGCCAGG - Intronic
981507414 4:145518072-145518094 GTTTCTCTTCAGAAGGTACAGGG - Intronic
986082742 5:4411005-4411027 AGTTCTCTCCTGGAGGCACATGG - Intergenic
989363518 5:40630267-40630289 AGGTCTCTGCAGGGAGTACAGGG + Intergenic
994699179 5:103111823-103111845 TGGTCTCTCCAGGAGGTAAATGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG + Intergenic
1002053213 5:176583729-176583751 AGTTGTGTGCAGGAGGGACAGGG + Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1003706246 6:8534303-8534325 AGTTCTATGCAAGAGGTAGAGGG - Intergenic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG + Intergenic
1024731219 7:52255935-52255957 GGTTCTCTGCAGCAGGTGAATGG + Intergenic
1025067694 7:55872048-55872070 CTTTCTCTCCAGGAGGTATGCGG - Intergenic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1029546447 7:101212781-101212803 CGTGCTGAGCAGGAGGTACAAGG - Intronic
1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG + Intronic
1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG + Intergenic
1034278435 7:149834879-149834901 GGCTCTTTGCAGGAGGAACAGGG - Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG + Intergenic
1037313125 8:17577119-17577141 CGGTTTCTTCAGGAGGAACAAGG - Exonic
1042294099 8:67201516-67201538 CATTCTCTTCCGGATGTACATGG - Exonic
1043345321 8:79291433-79291455 CGTTCCCTTCTGGAGGTACTAGG - Intergenic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1193875404 X:86856350-86856372 CGAACTCTACAAGAGGTACAAGG + Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic