ID: 925222745

View in Genome Browser
Species Human (GRCh38)
Location 2:2155277-2155299
Sequence GTGCTATCCAGGAGCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925222745_925222750 -8 Left 925222745 2:2155277-2155299 CCAAAGTGGCTCCTGGATAGCAC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 925222750 2:2155292-2155314 GATAGCACAGATGGGACTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 139
925222745_925222749 -9 Left 925222745 2:2155277-2155299 CCAAAGTGGCTCCTGGATAGCAC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 925222749 2:2155291-2155313 GGATAGCACAGATGGGACTCAGG 0: 1
1: 1
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925222745 Original CRISPR GTGCTATCCAGGAGCCACTT TGG (reversed) Intronic
901881450 1:12196363-12196385 GTGCTATTCAGCAGCATCTTTGG + Intronic
904675349 1:32195797-32195819 GTGCTGGTCAGGAGCCCCTTGGG + Exonic
915735397 1:158081357-158081379 GTCATATACAGGAGGCACTTTGG + Intronic
922785221 1:228279276-228279298 GTCTTCCCCAGGAGCCACTTAGG - Exonic
924178774 1:241420023-241420045 ATGCTCTCCTGGAGCCACTGGGG + Intergenic
1065951779 10:30658973-30658995 GGGCTATCCAGGACCCACACAGG - Intergenic
1067209721 10:44249932-44249954 TTGCGATCCAGGTGCCACTGGGG + Intergenic
1075795539 10:125117028-125117050 GTGTGAACCAGGAGCCACTGTGG - Intronic
1076940412 10:133602943-133602965 GTGGTTTGCAGGAGCCTCTTGGG + Intergenic
1078787376 11:14508145-14508167 GTGGGATCCAGGAACCACTAAGG - Intronic
1079141209 11:17810966-17810988 GTTCTAGCCCGGAGCCTCTTGGG + Intronic
1081754052 11:45532131-45532153 ATACTGTCCAGGAGCCTCTTGGG - Intergenic
1089613260 11:119681342-119681364 GTGGGATCCAGGAGCCATTTTGG + Intronic
1090948259 11:131450319-131450341 GTGGAAGCCACGAGCCACTTCGG - Intronic
1091085086 11:132713754-132713776 GAGTTATCCAGGTGCCATTTTGG + Intronic
1092256772 12:6930257-6930279 TTGTTATCTAGGAGTCACTTTGG + Intronic
1093708055 12:22297032-22297054 GTGCTATTCAGGAGCACCGTGGG - Intronic
1095899571 12:47314076-47314098 GTGCTGTCCTGAAACCACTTTGG + Intergenic
1096122466 12:49097227-49097249 GTGCTATCCTGGAGGGGCTTTGG - Exonic
1097051997 12:56229247-56229269 TTGCTCTCCAGGGGACACTTGGG - Exonic
1105405928 13:20132621-20132643 GTGCTACCTTGGAGGCACTTAGG - Intergenic
1105899214 13:24741792-24741814 CTGGTATCCTGGAGCCACTGAGG + Intergenic
1107629952 13:42333418-42333440 GTGCTTTTCAGGAGGCATTTCGG - Intergenic
1112092115 13:96092050-96092072 CTGCCATCCAAAAGCCACTTAGG - Intronic
1116786967 14:49298143-49298165 ATGTGATCCAGGAGCCACATTGG - Intergenic
1117630393 14:57684654-57684676 GAGCTCTTCAGGAGCCACTAGGG - Intronic
1122179388 14:99944331-99944353 GTGCTTGCCAGGAGCCAGTGTGG + Intergenic
1124373246 15:29115296-29115318 GAGGTCTCCAGGAGCCACATCGG + Intronic
1136072107 16:27793761-27793783 TGGCTACCCAGGAGGCACTTGGG + Intronic
1136922919 16:34346386-34346408 CTGGTATCCTGGAGCCACTGGGG - Intergenic
1136981654 16:35065420-35065442 CTGGTATCCTGGAGCCACTGGGG + Intergenic
1137778846 16:51079457-51079479 TGGATATCCAGGAGACACTTAGG + Intergenic
1141593350 16:85082939-85082961 GTGCTCTCCACCAGCCACTCCGG + Intronic
1144849034 17:18234798-18234820 GTGCGAGCCATGAACCACTTGGG - Intronic
1147438316 17:40431489-40431511 GTGCTAATCAGGAGCCACAGAGG + Intergenic
1152560533 17:81076458-81076480 GTGCTTGCCAGGAGACATTTCGG + Intronic
1153743319 18:8151665-8151687 TTGCGTTCCAGGAGCCACTGGGG + Intronic
1154344198 18:13528782-13528804 CTGCTATGCAGGAGCCAGTGGGG - Intronic
1155173191 18:23282315-23282337 GTTCTATCCAGGATCAACTGGGG - Intronic
1159541856 18:69788044-69788066 GTGCCCTTCTGGAGCCACTTGGG + Intronic
1159865926 18:73705125-73705147 AAGATATCCAGGACCCACTTTGG + Intergenic
1161552320 19:4920800-4920822 GTGTGATCCATGAGCCACTGGGG - Intronic
1166535542 19:43571985-43572007 GTGGCATCCAGGAGGCAGTTGGG - Intronic
1167291288 19:48626381-48626403 GCTCTATCCTGGAGCCACCTTGG + Intronic
925222745 2:2155277-2155299 GTGCTATCCAGGAGCCACTTTGG - Intronic
926198816 2:10778984-10779006 GCGCCTTCCAGGAGCCACTCGGG - Intronic
930065684 2:47325757-47325779 CTGCCATCCAGGAACCACTGTGG - Intergenic
933857118 2:86426514-86426536 GTGTTGTCCAGGATCCATTTCGG - Intergenic
934581818 2:95448132-95448154 GTTCTATTCAGGAGCTACTGGGG - Intergenic
934597632 2:95628582-95628604 GTTCTATTCAGGAGCTACTGGGG + Intergenic
934842262 2:97634410-97634432 GTTCTATTCAGGAGCTACTGGGG - Intergenic
938711040 2:133976452-133976474 CTGCTGTGCAGGAGCCTCTTGGG - Intergenic
942380931 2:175389638-175389660 GTTCTATTCAGAAGCCATTTAGG + Intergenic
947757856 2:232581220-232581242 GTGCTGTCCAGATGCCTCTTGGG + Intronic
948783972 2:240341289-240341311 TAGCCTTCCAGGAGCCACTTGGG + Intergenic
1169636873 20:7702139-7702161 TGGCTATCCAGGAGCTACTATGG + Intergenic
1170569221 20:17623472-17623494 GGGCTGTCCAGGAGCCAGTGAGG - Intronic
1172126524 20:32627899-32627921 GAGCATTTCAGGAGCCACTTAGG + Intergenic
1172701777 20:36857763-36857785 CTGGTACCCAGGAGCCACTGGGG + Intronic
1174046331 20:47736596-47736618 GGGCTATCCAGAATCAACTTGGG + Intronic
1176059475 20:63166097-63166119 GTGCGACCCAGGATACACTTTGG - Intergenic
1180833389 22:18917834-18917856 GAGCCAACCAGGAGACACTTGGG + Intronic
1181039657 22:20185842-20185864 GTTCTGTCCAAGAGCCTCTTTGG + Intergenic
1181066436 22:20308421-20308443 GAGCCAACCAGGAGGCACTTGGG - Intergenic
1181568031 22:23751445-23751467 GTGCAAGCCAGAAGCCACTGAGG + Intergenic
1184190019 22:42888148-42888170 CTGCTGACCAGGAGCCACTCAGG - Intronic
1185182025 22:49369147-49369169 GTGCTGTCCAGGAGCCACGTGGG - Intergenic
1203283473 22_KI270734v1_random:143132-143154 GAGCCAACCAGGAGACACTTGGG + Intergenic
950475911 3:13214657-13214679 GTGCCATCAAGGGGCCACTGTGG + Intergenic
950548569 3:13653288-13653310 GTGCTATCCAAGAGCCCCAAAGG - Intergenic
950764899 3:15266371-15266393 GTCCTCTCCAGCAGCCACCTGGG + Intronic
954425489 3:50440823-50440845 GAGCTGTGCAGGAGACACTTGGG + Intronic
954718646 3:52540664-52540686 GTGCTGTCCAGCAGTGACTTGGG - Exonic
959944052 3:112109193-112109215 CTGCTGTCCAGCAGCCATTTTGG + Intronic
970407232 4:15775424-15775446 GAGGCATCAAGGAGCCACTTGGG - Intergenic
970981175 4:22099048-22099070 GAGTTATCCAAGAGCCACTCAGG + Intergenic
971096693 4:23413794-23413816 GTGCTTTTAATGAGCCACTTGGG - Intergenic
971858374 4:32072205-32072227 CTGTTCTCCAGGAGCCATTTGGG + Intergenic
974756481 4:66215370-66215392 GTGGTAACCAGAAGCCAGTTTGG + Intergenic
982451710 4:155560598-155560620 TTGCTTTCCAGCAGCCACTCAGG + Intergenic
985898151 5:2762913-2762935 CTGCTCTCCAGGGGCCACTGGGG - Intergenic
986605267 5:9516781-9516803 GGGCCATCCTGGAGCCACATGGG + Intronic
987372704 5:17207788-17207810 GTGTTCCCCAGGAGCCACTTAGG + Intronic
990033229 5:51287547-51287569 GTGCTTCCCAGTATCCACTTTGG - Intergenic
993506712 5:88717363-88717385 GTGCTATGAGGGAGCCACTTTGG - Intergenic
994098416 5:95868599-95868621 ATTCTATCCAAGAGCCCCTTGGG + Intergenic
997261706 5:132470360-132470382 GTGCTATACAGGGGCCAACTGGG - Intronic
997395827 5:133559213-133559235 GTGCTATCCACCAGCCTCTGGGG - Intronic
997614788 5:135238982-135239004 TTGCTATCCAGGAGGCCCTATGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1000406452 5:160893165-160893187 GGGCATTCCAGGTGCCACTTGGG - Intergenic
1003071526 6:2948866-2948888 GTGCTAGCAAGGAGCCACTCGGG - Intronic
1004728485 6:18334291-18334313 AGGCCATCCAGGAACCACTTAGG + Intergenic
1004932208 6:20473714-20473736 GTGCGAGCCTGGAGCTACTTGGG - Intronic
1005034408 6:21542544-21542566 GTTATATCCAGGAGCAATTTGGG + Intergenic
1005169292 6:22963963-22963985 GTGCAATCCACAACCCACTTGGG + Intergenic
1006231443 6:32590598-32590620 GTGCTATACAAAAGCAACTTCGG - Intergenic
1016826058 6:148389695-148389717 GTGCAGTCCAGGGGCCACATTGG + Intronic
1017452850 6:154570607-154570629 ATGTTATCCAGGGGCCAGTTTGG - Intergenic
1019071932 6:169353877-169353899 TGGCTTTCCAGGAGCCACTGGGG + Intergenic
1024945324 7:54802301-54802323 GTGCCAGCCAGGAGCTGCTTGGG - Intergenic
1026247661 7:68635504-68635526 GTTATCTCCAGGAGCAACTTGGG + Intergenic
1034244727 7:149635780-149635802 ATGTGATCCAGGACCCACTTTGG - Intergenic
1037451775 8:19022640-19022662 GTGTTTTCCAGGAACCATTTGGG + Intronic
1038834657 8:31106016-31106038 GTGCTATGCAGAAGTCAATTAGG - Intronic
1038897628 8:31803827-31803849 GTGCTATGCTGCAGCCACTTTGG + Intronic
1046999781 8:120562423-120562445 CTGCTAACCAGGAGCCCCTCAGG - Intronic
1048177086 8:132162612-132162634 GTTCTTTCCTGGACCCACTTAGG - Intronic
1057876650 9:98760448-98760470 TTGCCATCCTGGAGCTACTTAGG + Intronic
1057877409 9:98768364-98768386 GTCCTGTCCTGGAGCCACATGGG - Intronic
1059276351 9:113100514-113100536 GTGGTACTCAGGAACCACTTAGG + Intergenic
1060233101 9:121840192-121840214 GTGCTATCTGGGGGCCAGTTAGG + Intronic
1061364847 9:130167169-130167191 GTGGTGTCCAGGAGCCCCTGAGG - Intergenic
1062269905 9:135703634-135703656 GGGCAATCCAGGACCCCCTTGGG - Intronic
1189570411 X:42290034-42290056 GTGCCATACATGTGCCACTTTGG + Intergenic
1194752032 X:97695755-97695777 GTGCTATCCTCGAGACACTTTGG - Intergenic