ID: 925224559

View in Genome Browser
Species Human (GRCh38)
Location 2:2172170-2172192
Sequence GCTGCCAGGCAGCAGCCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 422}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925224555_925224559 -5 Left 925224555 2:2172152-2172174 CCAGCCCTAAAAATATGTGCTGC 0: 1
1: 0
2: 2
3: 13
4: 136
Right 925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG 0: 1
1: 0
2: 3
3: 35
4: 422
925224554_925224559 -2 Left 925224554 2:2172149-2172171 CCTCCAGCCCTAAAAATATGTGC 0: 1
1: 0
2: 0
3: 7
4: 184
Right 925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG 0: 1
1: 0
2: 3
3: 35
4: 422
925224558_925224559 -10 Left 925224558 2:2172157-2172179 CCTAAAAATATGTGCTGCCAGGC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG 0: 1
1: 0
2: 3
3: 35
4: 422
925224553_925224559 18 Left 925224553 2:2172129-2172151 CCATATTTCAGTCTTGTCGACCT 0: 1
1: 0
2: 0
3: 3
4: 90
Right 925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG 0: 1
1: 0
2: 3
3: 35
4: 422
925224556_925224559 -9 Left 925224556 2:2172156-2172178 CCCTAAAAATATGTGCTGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 178
Right 925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG 0: 1
1: 0
2: 3
3: 35
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925224559 Original CRISPR GCTGCCAGGCAGCAGCCACT AGG Intronic
900362760 1:2297881-2297903 CCTGCCAGGCTGCAGCCACGGGG - Intronic
900367217 1:2316170-2316192 GTTTCCAGGGAGCAGCCACTGGG + Intergenic
900602807 1:3510231-3510253 CCGGCCAGGCAGCAGCCAGGGGG + Intronic
901081469 1:6586416-6586438 GAGGCCTGTCAGCAGCCACTAGG + Intronic
902696253 1:18142884-18142906 GCTGCCAGGCAATGGCCACTGGG - Intronic
902778586 1:18690393-18690415 GCTGCCCCTCAGCAGCCCCTGGG - Intronic
903115942 1:21177961-21177983 GGTGGCAGGCACCAGCTACTCGG + Intergenic
903778249 1:25806670-25806692 GCTGCCCAGCAGCAGCCCCTTGG + Intronic
904672919 1:32179702-32179724 GCTGGCCGGCAGCAGTTACTCGG + Intronic
904807594 1:33142725-33142747 AGTGACAGGCAGCAGCCACCAGG - Intergenic
905176254 1:36137352-36137374 GCTGCCTGGCCACAGCCTCTAGG + Intronic
905266009 1:36754935-36754957 GCTGCCTGTCAGCAGCTGCTTGG + Intergenic
905866126 1:41377679-41377701 TCTGCCAGGCAGCAGTAACCAGG - Intronic
906213492 1:44025306-44025328 GCTGGGGGGCAGCAGCCACGTGG + Intronic
906332800 1:44901521-44901543 GATGACAGGCATGAGCCACTGGG + Intronic
906435427 1:45791898-45791920 GATTCCAGGCATGAGCCACTGGG + Intronic
906725566 1:48041745-48041767 GTTGTCAGGCAGCAGACTCTTGG + Intergenic
906820698 1:48927114-48927136 GCTTACAGACAGCAGCCACAAGG + Intronic
908258744 1:62322878-62322900 ACTGCCAGGCTGCAGCCATGTGG + Intergenic
909566647 1:77060171-77060193 CATGGCAGGCTGCAGCCACTTGG + Intronic
910005888 1:82396862-82396884 GATGCAAGGCAGAAGCCACAAGG - Intergenic
912797634 1:112702531-112702553 GCTGCCAGGCTGGAGCCCCTGGG - Intronic
915215110 1:154335100-154335122 GCGGGCAGGCAGCAGACAGTCGG - Intronic
917854982 1:179092450-179092472 GATGACAGGCATGAGCCACTAGG - Intronic
918251222 1:182705173-182705195 GCTTCCAGACAGCAGACTCTGGG - Intergenic
919572164 1:199262518-199262540 GAAGCCAGGCAGCAGACAGTGGG - Intergenic
919835663 1:201571454-201571476 ACTGCCAGGCTCCAGGCACTGGG + Intergenic
920167305 1:204045015-204045037 GCTCCCAGGCTCCAGCCACAGGG + Intergenic
920300983 1:204988810-204988832 GGTGCATGGCAGCAGCCCCTGGG + Intronic
920504778 1:206507979-206508001 GCCGCCCGGCAGCACCAACTCGG - Exonic
922374376 1:224946140-224946162 GCAGCCAGGAAGCTCCCACTAGG - Intronic
923160675 1:231312063-231312085 CCTGGCAGGCAGCAAACACTCGG - Intergenic
924775927 1:247114488-247114510 GCTGAGAAGCAGCAGGCACTGGG + Intergenic
1063376413 10:5557245-5557267 GCAGCCAGGCAGAAGCCTGTGGG - Intergenic
1063697628 10:8352218-8352240 GTTGCCATGCATAAGCCACTGGG + Intergenic
1065971814 10:30811730-30811752 GCTTCCAGGCTGCAGCCAAGCGG + Intergenic
1066953663 10:42145643-42145665 GCAGCCAGGCAGCTGGAACTGGG - Intergenic
1067105816 10:43365647-43365669 GATGACAGGCACGAGCCACTGGG - Intergenic
1067181042 10:43986207-43986229 GCACCCAGGCAGCAGCCAGAGGG - Intergenic
1067794565 10:49311381-49311403 GCTGCCAGCCAGGAGCCCCGAGG + Intronic
1067801130 10:49360490-49360512 GCTGCCTGGCAGCTGCCAAGGGG - Intergenic
1069778853 10:70942372-70942394 AGTAGCAGGCAGCAGCCACTGGG - Intergenic
1070551185 10:77491939-77491961 GGGCCCAGGCAGCAGCCCCTTGG + Intronic
1070596212 10:77834796-77834818 GCAGACAGGAAGCAGCCCCTGGG + Intronic
1070596897 10:77838757-77838779 CCTGACAGGCAGCAGCCAGTGGG + Intronic
1072196570 10:93121411-93121433 GCTGCCAGGCAAGAGGCATTTGG + Intergenic
1072202539 10:93173968-93173990 GCTGGCAGGCTGCAGCCATTTGG + Intergenic
1072781156 10:98252731-98252753 GCTGTCAGGCACCAGCCTCCTGG - Intronic
1074327867 10:112470523-112470545 CCTGGCAGGCAGCAGCCCCCTGG + Intronic
1074888192 10:117711489-117711511 ACTGCCAGCCAGCAGCCCATGGG - Intergenic
1074915203 10:117948636-117948658 GCTGCCAGCCAGCAGAAGCTGGG + Intergenic
1075001362 10:118801105-118801127 GCTGGCAGGCAGCACCACCTGGG + Intergenic
1075875581 10:125803363-125803385 GCTGGCAGGCAGCTTCCACGGGG - Intronic
1075901184 10:126043787-126043809 GGAGCCAGGGAACAGCCACTGGG - Intronic
1076711310 10:132336385-132336407 GCTGCCAGCAAGCAGTGACTCGG + Intronic
1076842835 10:133054918-133054940 GTTCCCAGGCAACAGCCACACGG + Intergenic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1078442378 11:11378469-11378491 CCTGGCTGGCTGCAGCCACTTGG + Intronic
1079869636 11:25781173-25781195 GCTCCCAGGGAGGAGACACTAGG - Intergenic
1081709266 11:45206445-45206467 GGAGCCAGGCTGCAGCCACAGGG - Intronic
1082001500 11:47395698-47395720 CCTGCCAGGCAGCAGCCCCCGGG + Intergenic
1082665995 11:55976961-55976983 GATTACAGGCATCAGCCACTGGG - Intergenic
1082821014 11:57544719-57544741 CCTGCCAGGGACCAGGCACTGGG - Intronic
1083332644 11:61906106-61906128 GAGGCCAAGCAGCAGCCACTGGG - Intronic
1084265452 11:68003336-68003358 TCTGCCAGCCCGCGGCCACTTGG + Intronic
1084483638 11:69435847-69435869 TCTGCCAGACAAAAGCCACTTGG + Intergenic
1086818685 11:91406583-91406605 GGTGCCAGGCAGCTGCCCCATGG - Intergenic
1087077269 11:94136900-94136922 GAAGCCAAGCAGAAGCCACTAGG - Intronic
1087093000 11:94294231-94294253 CCTGCCATGTGGCAGCCACTGGG - Intergenic
1090386437 11:126359988-126360010 CCTGCCAGGCAGAAGCACCTTGG + Intronic
1090628399 11:128625503-128625525 ACTGCCAGGCAGCATTCTCTGGG - Intergenic
1091004841 11:131943381-131943403 GCTGCCCTGCAGCACCCAGTTGG + Intronic
1091139137 11:133220449-133220471 GCTGCCAGACAGCAGCCTCTGGG + Intronic
1091251918 11:134151303-134151325 GATGCCATGCAGCAGACACCAGG - Exonic
1091778733 12:3200743-3200765 TCCGACAGGCAGCAGCCCCTGGG + Intronic
1092160724 12:6313881-6313903 ACTGGCAGGCAGCAGCCTCCTGG - Intronic
1092782113 12:11996746-11996768 GCTGCCAGCCACCAGTCAATCGG + Intergenic
1095261510 12:40104964-40104986 GCTGAGAGGCAACAACCACTTGG + Intronic
1098150296 12:67539483-67539505 GATGCCAGACAACAGCCACGGGG + Intergenic
1098330044 12:69343721-69343743 CCTCCCAGGCAGGAGCCAATAGG - Intergenic
1099806954 12:87531688-87531710 GCTGTCAGTCAGCCCCCACTGGG - Intergenic
1100194535 12:92229385-92229407 TCTGAGAGGCAGCAGCCACTTGG + Intergenic
1101041271 12:100758303-100758325 GCTCCCAGGCACCAGTCACATGG - Intronic
1102368188 12:112357928-112357950 GATGACAGGCATGAGCCACTGGG - Intronic
1102492798 12:113298994-113299016 GCTGCCAGGCAGGAGTCGGTAGG - Exonic
1102589628 12:113947489-113947511 TCTGGTAGGCCGCAGCCACTTGG + Intronic
1102648039 12:114416290-114416312 TCTGCCAGCCATCAGCCACATGG + Intergenic
1102690035 12:114753330-114753352 TCTACCAGACAGCAGCAACTGGG + Intergenic
1103912931 12:124362165-124362187 GCAGCCTGGCAGCAGCCCCCGGG - Exonic
1104915207 12:132260857-132260879 GCGGCCAGGCTGCAGCCGCACGG + Intronic
1105369774 13:19792319-19792341 GATTACAGGCAGGAGCCACTGGG - Intergenic
1105519411 13:21118127-21118149 GCTGCTAGGGAGCAGCCGCTGGG - Intergenic
1106099916 13:26685383-26685405 CATCCCAGACAGCAGCCACTAGG - Intronic
1106411454 13:29514252-29514274 GCTGCCTGGCCGGGGCCACTAGG - Exonic
1107862986 13:44678479-44678501 GCAGCCAGGCAGGAGCCGATTGG + Intergenic
1108048250 13:46403794-46403816 GGTGGCAGGCACCAGCTACTTGG - Intronic
1108797657 13:54051306-54051328 GCTGCCAGCCAGCAACCTATGGG - Intergenic
1108858251 13:54822181-54822203 GCTGCCAGGAAGTTGACACTGGG + Intergenic
1110610799 13:77485715-77485737 GATGCCAGGCCAAAGCCACTGGG + Intergenic
1111985189 13:95058850-95058872 GCTGCCAGGCAGCAGGAGCCCGG + Intronic
1112067533 13:95809702-95809724 GCTGCCTGGCTGCTGCCTCTTGG + Intronic
1112276780 13:98028598-98028620 GATGACAGGCATTAGCCACTGGG - Intergenic
1112816307 13:103277936-103277958 GATGGCAGGCAGAAGGCACTGGG - Intergenic
1113165631 13:107438529-107438551 GATGACAGGCATGAGCCACTGGG - Intronic
1113817870 13:113187506-113187528 GCTGCCAGGCCACACCCAGTGGG - Intronic
1115643325 14:35349524-35349546 GATTACAGGCAGCAGGCACTAGG - Intergenic
1115944717 14:38646551-38646573 GCAGCCTGGCTGAAGCCACTAGG - Intergenic
1118410136 14:65470056-65470078 GCTGGCAGGCAGGTGCCCCTTGG - Intronic
1119559679 14:75579955-75579977 TCTGTCTGGCAGCAGCCCCTGGG + Intronic
1120977285 14:90260190-90260212 GCTGCCAGCAAACTGCCACTGGG + Exonic
1121775375 14:96587288-96587310 GCAGCCAGGCTGCAGCCATGCGG - Intergenic
1121813960 14:96914886-96914908 GCTGCCAGCCACCAGGAACTAGG - Intronic
1122603550 14:102932914-102932936 GGCGCCACGAAGCAGCCACTGGG - Exonic
1122835655 14:104429631-104429653 GCGGCCAGGGAGCACCCACGGGG - Intergenic
1123797424 15:23786040-23786062 GCTCCAAGGCAGCAGACACTGGG - Intergenic
1124253365 15:28122031-28122053 CCTGCCATACAGCAGCCACGGGG + Intronic
1124564038 15:30798823-30798845 GGAGGCAGGCAGCAGCCTCTGGG + Intergenic
1125340778 15:38673231-38673253 CCTCCCAGGGGGCAGCCACTGGG + Intergenic
1125374412 15:39013444-39013466 GCCGGCCGGCAGCAGCCACCTGG + Intergenic
1125466981 15:39963046-39963068 GTTGCCAGGAAGCAGCCAGCAGG + Intronic
1125534437 15:40435355-40435377 GTTGGCAGGCAGGAGCCGCTGGG + Intronic
1125591231 15:40855804-40855826 GGTGCTGGGCAGCAGCCACGTGG + Intronic
1126796119 15:52261599-52261621 GCTGCCAGGCAGAAGCTGGTGGG + Intronic
1127551542 15:60043594-60043616 GCTCCTTGGCGGCAGCCACTGGG - Intronic
1128392136 15:67189504-67189526 GCTGCCAGGCAGCGGTGACGCGG - Intronic
1129014209 15:72451386-72451408 CATGCCAGCCAGAAGCCACTGGG + Intergenic
1129162723 15:73755685-73755707 CCTACCAGGCACCAGGCACTGGG + Intergenic
1129223845 15:74153900-74153922 GAAGACAGGCAGCAGCCATTTGG - Intergenic
1129330464 15:74824400-74824422 GATGCCAGGCTGCAGGCACGAGG - Exonic
1129661455 15:77555166-77555188 GCTGCGAGGAAGTAGCCAGTAGG - Intergenic
1129679125 15:77648039-77648061 GCAGTCAGACAGCAGCCACAGGG + Intronic
1132864594 16:2087183-2087205 GCAGCCTGACAGCTGCCACTGGG - Intronic
1132932712 16:2467167-2467189 GCAGCCTGGCAGCAGCCCCAGGG + Intergenic
1133295490 16:4749989-4750011 GGGGCCAAGCAGCAGCCAGTGGG + Exonic
1133895846 16:9928179-9928201 GCAGGCAGGCAGCATCCACATGG + Intronic
1133920454 16:10148059-10148081 GCTGACAGGGAGCAACCAGTAGG - Intronic
1134011873 16:10859853-10859875 GCAGACAGGCAGCAGCCACAGGG + Intergenic
1134278756 16:12800023-12800045 GCTGCCAGGGGGCCACCACTGGG - Intronic
1134429794 16:14192859-14192881 GGTTCCTGGCAGGAGCCACTGGG - Intronic
1135378598 16:21973227-21973249 GCTTCCAGGCTGCATCCACAGGG + Intronic
1135415818 16:22267233-22267255 AGTGCCAGGCCCCAGCCACTAGG - Intronic
1135421033 16:22305669-22305691 GCTGCCATGGAGCTGCCCCTTGG - Intronic
1135620759 16:23953370-23953392 GCTGCTCGGGAGCAGCCACTAGG - Intronic
1136297057 16:29309621-29309643 GCTACCAGGCAGCTGCCGCAGGG + Intergenic
1136771138 16:32842330-32842352 GCAGCCAGGCAGCTGGAACTGGG - Intergenic
1136899440 16:34019152-34019174 GCAGCCAGGCAGCTGGAACTGGG + Intergenic
1137394241 16:48105772-48105794 GCTGTGTGGCAGCAGCCACCAGG + Intronic
1138478610 16:57286656-57286678 GATTACAGGCATCAGCCACTGGG + Intergenic
1139369945 16:66460751-66460773 GCTACCAGGCACCATGCACTGGG - Intronic
1139421607 16:66852743-66852765 GCTGGCAGGCAGGAGGCACTTGG - Exonic
1139650140 16:68358114-68358136 GCTGCGAGCCAGAGGCCACTGGG - Exonic
1140122189 16:72093494-72093516 GTTGCTAGGCAACAGCCCCTGGG - Exonic
1140863599 16:79040546-79040568 GCTTACAGGTATCAGCCACTGGG + Intronic
1141466080 16:84206635-84206657 GGTGCCAGGCTGTGGCCACTGGG - Intergenic
1141483951 16:84326372-84326394 GCTGCATGACAGCAGCGACTGGG - Intronic
1141838130 16:86555975-86555997 GATGTCAGGGACCAGCCACTAGG + Intergenic
1142058607 16:88015725-88015747 GCTACCAGGCAGCTGCCGCAGGG + Intronic
1142144638 16:88487761-88487783 TCTGGCAGGCAGCAGGCCCTGGG + Intronic
1203073561 16_KI270728v1_random:1104443-1104465 GCAGCCAGGCAGCTGGAACTGGG - Intergenic
1142808445 17:2384044-2384066 GCTGCCAGCCTGCAGCATCTGGG - Exonic
1143584637 17:7845048-7845070 GCTTCCAGTCCGGAGCCACTGGG - Intronic
1143984247 17:10897673-10897695 GCTGGCAGGCACCAGGCAGTTGG - Intergenic
1145221842 17:21095983-21096005 GATTACAGGCATCAGCCACTGGG - Intergenic
1145690697 17:26736195-26736217 GCAGCCAGGCAGCTGGAACTGGG + Intergenic
1145892259 17:28425458-28425480 CCTGCAAGGCTGCAGCCAGTGGG + Intergenic
1146922266 17:36721598-36721620 ACTGCCTGTCAGCAGCCTCTGGG - Intergenic
1147214878 17:38893320-38893342 GCTGCCAAGCAGAAGTCCCTTGG - Intronic
1148725725 17:49788697-49788719 GCTGAGAGGCAGGAGGCACTAGG + Exonic
1148786806 17:50149649-50149671 GCGGCCGGGCAGGGGCCACTCGG + Exonic
1150641842 17:66954539-66954561 GCTGCCCATCAGCAACCACTGGG + Intergenic
1151134456 17:71932114-71932136 GCAGCCAGGAAGCTGCCAGTTGG - Intergenic
1151505025 17:74522020-74522042 GCTCCCAAGCTGCAGCCCCTCGG + Exonic
1151568778 17:74915692-74915714 GGTGACAGGCAGCAGCCTCCTGG + Intergenic
1151872171 17:76843894-76843916 CCTCCCAGACAGCAGCCACATGG - Intergenic
1151911127 17:77083981-77084003 GATGCCAGGCAGCAGCCCCGTGG + Intergenic
1152312214 17:79558362-79558384 TCTGCCAGTCACCAGACACTGGG - Intergenic
1152411239 17:80124374-80124396 GCTGTCTGGCAGCAGCCTCCAGG + Intergenic
1152566894 17:81104339-81104361 TCATGCAGGCAGCAGCCACTTGG + Intronic
1152598615 17:81250363-81250385 GAAGCCAGGCCGCAGCGACTGGG + Intronic
1152657967 17:81528705-81528727 GCTGCTCCGCAGCAGCCACCTGG + Exonic
1152734719 17:81991751-81991773 GCTGCAGGCCAGGAGCCACTGGG - Intronic
1152768607 17:82154199-82154221 GCTCCCAGGCAGGTCCCACTGGG - Intronic
1153532014 18:6056410-6056432 CCTGCTAGGCAGGAGGCACTGGG + Intronic
1153998770 18:10465218-10465240 GCCTCCAGGCAGCAGCCATGAGG + Intronic
1154154376 18:11932497-11932519 TCAGCCAGGCTGCAGCCACCTGG + Intergenic
1154344199 18:13528783-13528805 GCTGCTATGCAGGAGCCAGTGGG - Intronic
1156578515 18:38348596-38348618 GCTGCCAGGCTGCAGTCAGCAGG - Intergenic
1156735513 18:40253747-40253769 GCTGCCAGGCAGCACCCCTTTGG + Intergenic
1158152729 18:54390558-54390580 GATTTCAGGCATCAGCCACTGGG + Intergenic
1158488960 18:57893086-57893108 GCTGCCATCCAGGAGCCACCAGG - Intergenic
1158878046 18:61751866-61751888 GCTGCCAAGCAGCTTCCACCTGG + Intergenic
1159638368 18:70833582-70833604 GCTTACAGGCATGAGCCACTGGG + Intergenic
1160277196 18:77448048-77448070 GCTGCCAGGTCTGAGCCACTTGG - Intergenic
1160570913 18:79817123-79817145 GCTGTCACGCAGCTGCCACATGG + Intergenic
1161654861 19:5507948-5507970 GATTCCAGGCATGAGCCACTGGG - Intergenic
1162391930 19:10395171-10395193 GCTGCCATGAGGCCGCCACTTGG - Intronic
1162905029 19:13818165-13818187 GCTGGCTGGCAGCACGCACTAGG - Intronic
1163010807 19:14424822-14424844 GATTACAGGCAGGAGCCACTGGG - Intergenic
1163262114 19:16197710-16197732 TCAGCCTGGCAGCGGCCACTGGG + Intronic
1163314884 19:16535153-16535175 GCTGCCTGGCCACAGCCATTAGG + Intronic
1163323798 19:16590157-16590179 GCAGGCAGGCAGCACCCACTGGG + Intronic
1163372667 19:16910440-16910462 GATTACAGGCAGGAGCCACTGGG + Intronic
1163375599 19:16928263-16928285 GCTGGCAGGAAGCAGGCAGTAGG + Intronic
1163500684 19:17674437-17674459 GCTGGCGGGCAGCAGGGACTTGG + Intronic
1163572500 19:18090745-18090767 GCTGCCAGGCAGAGGCCACTGGG - Intronic
1163608761 19:18290505-18290527 GGTGGCAGGCAGCTGCCTCTTGG + Intergenic
1165749914 19:38253378-38253400 GCTGGCAGCCAGCAGCCAGCTGG + Intronic
1165815913 19:38642179-38642201 GCTGCCAGGAAGTAGCCTCAAGG + Intergenic
1166044757 19:40223387-40223409 GCTGGCAGGGAGCAGCCCCCAGG - Exonic
1166546563 19:43637605-43637627 GGTGCCAGGAAGCAGTGACTTGG + Intronic
1166743836 19:45130476-45130498 CGTGGCAGGCAGCAACCACTGGG - Intronic
1167232055 19:48291039-48291061 GCTGTCAGGCACCAGAGACTCGG + Intergenic
1168082582 19:54021104-54021126 GATGACAGGCATGAGCCACTGGG + Intergenic
1168199321 19:54803617-54803639 GCTGCCAGGACGCAGTGACTCGG - Intronic
1168466487 19:56606218-56606240 CCTGCCATGCACCAGGCACTGGG - Intronic
1168696589 19:58407347-58407369 GCTCCCAGGCAGGACCCAGTGGG + Intronic
1202670351 1_KI270709v1_random:44302-44324 GCAGCCAGGCAGCTGGAACTGGG + Intergenic
925168969 2:1739269-1739291 GCTGCCAATCATCAGCAACTAGG + Intronic
925178357 2:1800453-1800475 ACACCCAGGCAGCAGCCACATGG + Intronic
925179261 2:1806420-1806442 GCTGCCCAGCAGCAGCAGCTGGG + Intronic
925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG + Intronic
926593067 2:14760076-14760098 GCAGCCAGGCAGCTCCCACTTGG + Intergenic
927338676 2:21954537-21954559 GCAGTCAAGCAGCAGCCCCTGGG + Intergenic
927641393 2:24847869-24847891 GGTGGGAGGCAGCACCCACTGGG + Intronic
927757316 2:25719382-25719404 GCTGCCAGGCAGCACAGACCAGG - Intergenic
928245071 2:29619852-29619874 GGTGCCAGGAGGCAGCCCCTGGG + Intronic
928268552 2:29833322-29833344 GCCTCCAGGCAGCAGCCTCCGGG + Intronic
928280577 2:29942879-29942901 GCTCCCAGACAGTTGCCACTAGG - Intergenic
929565814 2:42984024-42984046 GATGACAGGCAGCAGGCAGTGGG - Intergenic
929800938 2:45101756-45101778 GATGACAGGCATGAGCCACTGGG + Intergenic
932468131 2:71936531-71936553 GCTCCCAGGCAGGAACCTCTGGG + Intergenic
932481425 2:72041794-72041816 GCTGCCTGGCAGCTGCTCCTCGG - Intergenic
932591549 2:73070872-73070894 GTTCCCAGGCGGCAGCCCCTCGG + Intronic
934251078 2:90355983-90356005 GCAGCCAGGCAGCTGGAACTGGG - Intergenic
934258484 2:91447427-91447449 GCAGCCAGGCAGCTGGAACTGGG + Intergenic
934490440 2:94758919-94758941 GGTGCCACGCAGCAGGCATTTGG - Intergenic
934501244 2:94861787-94861809 GCTCCCAGGCTGCTGCCTCTAGG - Intergenic
934614402 2:95762380-95762402 GCTGCCTGGCACCAGCACCTGGG - Intergenic
935594552 2:104868657-104868679 GCCCCAAGGCAGCAGCCATTTGG - Intergenic
937013903 2:118586206-118586228 ACTGACAGGCAGCAGGCACTTGG + Intergenic
937816263 2:126254011-126254033 CCTTGCAGGCAGCAGCCATTTGG - Intergenic
939524857 2:143280272-143280294 TCTGCCAGGCATCAGGAACTGGG + Intronic
940212449 2:151269353-151269375 GATGCCAGGCAGCATTCAATAGG + Intergenic
942887732 2:180948403-180948425 GCTTCCAGGCAGCAGCAACATGG - Intergenic
944264328 2:197706902-197706924 CCAGCCAGGGAGCATCCACTGGG - Exonic
944457682 2:199911840-199911862 GGAACCAGGCAGCAGCCACGAGG - Intronic
944471952 2:200063338-200063360 GTGGCCAGGGAGCAGCCATTAGG - Intergenic
945202244 2:207294075-207294097 GCTGCCAAGAAGCAGCCCCGTGG - Intergenic
947196623 2:227574155-227574177 CCTGGCAAGCAGCAGCTACTAGG - Intergenic
947927534 2:233934751-233934773 GCTTTCAGGCAGCAGAAACTTGG + Intronic
948059878 2:235034885-235034907 GCTGCGCGGCGGCATCCACTCGG - Exonic
948601037 2:239107662-239107684 GCTGCCAGGAAGGAGCCACGGGG - Intronic
948764653 2:240213159-240213181 GCTGCTAGGCAGCTGCACCTGGG + Intergenic
948782430 2:240329934-240329956 GCTGCCTGGCAGGTGCCACCTGG - Intergenic
949035352 2:241813579-241813601 GCTCCCAGGCAACACCCACCAGG - Intronic
1170626033 20:18030875-18030897 ACTGCCATGCGGCAGCCCCTTGG + Intronic
1170865183 20:20149355-20149377 GCTGACATGCAGCTCCCACTTGG + Intronic
1171403039 20:24891880-24891902 GCTTCCAGGCAGCCGGTACTCGG + Intergenic
1171404341 20:24899967-24899989 GCTGCCTGTGAGAAGCCACTGGG - Intergenic
1172003631 20:31801666-31801688 GCAGCCACGCAGCAGGCTCTGGG + Exonic
1172906787 20:38376386-38376408 CCTGCCGGGCAGCAGCAGCTCGG + Intronic
1174109592 20:48189378-48189400 GCAGCCACCTAGCAGCCACTTGG - Intergenic
1176179855 20:63744702-63744724 TCTGCCACGCAGCAAACACTTGG + Exonic
1176303602 21:5111850-5111872 GATGCCAGGTGGGAGCCACTGGG - Intergenic
1176515086 21:7777822-7777844 GGTGCCAGGCAGAAGCAATTGGG - Intergenic
1178649114 21:34407834-34407856 GGTGCCAGGCAGAAGCAATTGGG - Intronic
1178960391 21:37059618-37059640 GCTCCCAGACACTAGCCACTTGG - Intronic
1179853429 21:44150100-44150122 GATGCCAGGTGGGAGCCACTGGG + Intergenic
1180002049 21:44999603-44999625 GCTCTCAGTCAGCAGACACTTGG + Intergenic
1180938173 22:19639600-19639622 AGGGCCAGGCAGCAGGCACTAGG + Intergenic
1181029410 22:20142683-20142705 GCCGCCAGTCAGCACCCACGGGG - Intronic
1181111504 22:20605509-20605531 GCCACCAGGCACCAGGCACTGGG - Intergenic
1181513831 22:23400634-23400656 GCTGCCAGTCAGCACCCACGGGG + Intergenic
1181572208 22:23773747-23773769 GCTTCCAGGCACCAGTCACAGGG + Intronic
1182105591 22:27686756-27686778 AGTGCCAGGCAGCAGACAGTGGG + Intergenic
1182798098 22:33006184-33006206 CCTAGCATGCAGCAGCCACTTGG + Intronic
1183018522 22:35008957-35008979 ACTGCCAGGCACCAGCCCATTGG + Intergenic
1183022718 22:35040120-35040142 GAACCCAGGCAGCAGCCAATGGG + Intergenic
1183241304 22:36659961-36659983 GCTGGAAGCCACCAGCCACTGGG - Intronic
1183472492 22:38017014-38017036 GGTGCCAGGCAGCAGAGGCTGGG - Intronic
1183489135 22:38107510-38107532 CCTCCCAGGGAGCAGCCACATGG - Intronic
1183505868 22:38208608-38208630 CCTGGCAGGGAGCAGGCACTGGG - Intronic
1183586528 22:38756033-38756055 GCTGACAGGCCGCAGCCCATTGG + Intronic
1184159543 22:42689772-42689794 GCTGCCATGCTCCAGCCAGTGGG + Intergenic
1184201926 22:42975710-42975732 CCTGGCAGGGAGCACCCACTAGG + Intronic
1184333571 22:43840609-43840631 CCAGCCTGGCAGCACCCACTGGG - Intronic
1184384275 22:44165472-44165494 GCTGCAGGGCAGCAGCAACGAGG - Intronic
1184717750 22:46291467-46291489 GCTACCAGGCAGCATCCATGGGG + Intronic
1184767677 22:46580033-46580055 GAGGCCAGGCAGCAGCCTCTTGG - Intronic
1184901425 22:47448764-47448786 GGTGCCCTGCAGCAGCCACAGGG - Intergenic
1185344381 22:50304967-50304989 GCGGCCAGGCTGCAGCCAGAGGG + Intronic
1185400400 22:50612761-50612783 GTTTCCAGGCAGCAGCTACAGGG - Intronic
1203236034 22_KI270732v1_random:2213-2235 GCAGCCAGGCAGCTGGAACTGGG + Intergenic
1203324496 22_KI270738v1_random:974-996 GCAGCCAGGCAGCTGGAACTGGG - Intergenic
949557897 3:5173665-5173687 GCTGGAGTGCAGCAGCCACTGGG - Intronic
950135141 3:10575713-10575735 GCTGCCAGCCAGCAGCCCAGGGG - Intronic
950550990 3:13665789-13665811 GATTCCAGGCATCAGGCACTGGG + Intergenic
951531808 3:23705059-23705081 GAGCCCAGGCAACAGCCACTGGG - Intergenic
951830480 3:26920749-26920771 GAGGGCAGGAAGCAGCCACTTGG + Intergenic
952804286 3:37332367-37332389 GATGACAGGCATAAGCCACTGGG - Intronic
952830867 3:37563763-37563785 CCTGGTAGGCAGCAGACACTGGG + Intronic
953411529 3:42693025-42693047 GGTGCCAGGCATCAGCCTCAAGG - Intronic
953637598 3:44676172-44676194 GCTCCCAGGTACCAGGCACTAGG - Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
953932107 3:47010576-47010598 GCTACCAGGTCGCACCCACTTGG + Intergenic
954505056 3:51062283-51062305 GCAGACAGGCAGCAGGCACCAGG - Intronic
954993923 3:54864852-54864874 GCTGACAGGCAGCAGCATCGTGG - Intronic
955321685 3:57979026-57979048 ACTGCCAGGCACCAGGCACAGGG - Intergenic
955652699 3:61211493-61211515 GCTGCCAGGAAGCATGAACTGGG + Intronic
957708799 3:83826152-83826174 CCTACAAGGCAGCAGACACTTGG - Intergenic
958091310 3:88880114-88880136 ACTGCCTGGCAGCAGTCCCTGGG + Intergenic
960588894 3:119346421-119346443 GCTGTCAGGCAGGAGTCACTGGG - Intronic
961142173 3:124564839-124564861 GCTGCAAGGCCTCTGCCACTTGG - Intronic
961339956 3:126211509-126211531 GCTGCCAGCCTGCAGCCTCCAGG - Intergenic
963409845 3:144913115-144913137 GCGGCCCTGCAGCAGCCTCTAGG - Intergenic
964203805 3:154148158-154148180 GCTGCCAGGCCGCTGCTCCTGGG - Intronic
964746911 3:160020983-160021005 CCTGGCAGGCAGCAAGCACTCGG + Intronic
968764483 4:2461180-2461202 GCTGCCAGGGGCCAGCCACAAGG - Intronic
968771369 4:2509661-2509683 GCTGCTTGCCAGCAGCCCCTGGG + Intronic
968929911 4:3573361-3573383 GAGGCCAGGCGGCAGCCCCTGGG - Intergenic
969176107 4:5400235-5400257 GCTCCCAGGCAGCCTCCCCTAGG + Intronic
969203848 4:5626945-5626967 GCTTGCAGGCAGCAGACAATGGG + Intronic
969689349 4:8695717-8695739 GCTGCCAGGGACCAGCGACAGGG - Intergenic
973648164 4:52970511-52970533 GCTGCCAGGAAGCTGGAACTGGG + Intronic
974740586 4:66001663-66001685 GAGGCCAGGCAGCAGCCAACTGG + Intergenic
976505591 4:85842762-85842784 TCTGCCAGCCAGCTGGCACTAGG + Intronic
979432487 4:120648055-120648077 ACTGCAAGGCAGCAGCGACTGGG - Intergenic
979532082 4:121779687-121779709 GGTGGCAGGCACCAGCTACTCGG - Intergenic
981357086 4:143801810-143801832 GTTGACAGGCAACAGCCAGTAGG - Intergenic
981368621 4:143932404-143932426 GTTGACAGGCACCAGCCAGTAGG - Intergenic
982836514 4:160125736-160125758 GCAGCCAGGAAGCAGGAACTGGG - Intergenic
984127418 4:175829202-175829224 GCCACCAGGCATGAGCCACTGGG + Intronic
984296573 4:177861736-177861758 TCCGCCCGGGAGCAGCCACTGGG - Intronic
984704629 4:182838807-182838829 GAAGCCAGGAAGCAGCCAGTGGG + Intergenic
985655917 5:1131286-1131308 GGTGCCAGGCCCCAGCCTCTGGG - Intergenic
986344617 5:6823055-6823077 GCTCCCAGTCAGCCGCCTCTGGG + Intergenic
990203155 5:53400179-53400201 GCTTCCAGGAAGCAGACTCTAGG - Intergenic
996631850 5:125642505-125642527 GCCGCCAAGCAGCTCCCACTTGG + Intergenic
997346261 5:133194660-133194682 GCAGCCATGCAGCAGACCCTGGG - Intergenic
997468537 5:134103989-134104011 GATGCCAGGCACCAGCCCCAGGG + Intergenic
998576883 5:143326200-143326222 CCTGCCAGGCAACAGTCACAAGG - Intronic
999097743 5:148995717-148995739 CCTGCCATGCATCAGACACTGGG + Intronic
999257604 5:150218382-150218404 GGGGCCAGGCAGGAGCCACTGGG + Intronic
1002283338 5:178146181-178146203 CCTGCTGGACAGCAGCCACTGGG + Exonic
1002921084 6:1574042-1574064 GCTGCCAGGTTGCAACCTCTGGG + Intergenic
1003504787 6:6731526-6731548 GATTCCAGGCATGAGCCACTGGG - Intergenic
1005080804 6:21954483-21954505 GCAGGCAGGCAGCAGCAGCTGGG + Intergenic
1005506530 6:26473892-26473914 GTTGCTGGGCAGAAGCCACTGGG - Intronic
1006075189 6:31528080-31528102 TCTGTCTGGCAGCAGCCACTGGG + Intergenic
1006263427 6:32895431-32895453 TCTGCCAGGCACCACCCTCTGGG + Intergenic
1006300530 6:33191613-33191635 GCTGCCACGCAGCTGGCTCTGGG - Intronic
1006401464 6:33820425-33820447 GCCGGCTGACAGCAGCCACTGGG + Intergenic
1006761533 6:36466333-36466355 GATGACAGGCATGAGCCACTGGG + Intronic
1007236542 6:40394561-40394583 GGAGGGAGGCAGCAGCCACTGGG - Intronic
1007512240 6:42382432-42382454 GCTGCCAAGCAGAAGGCAGTAGG + Intronic
1008358571 6:50586677-50586699 GCAGCCAGGTAGCAACCACTGGG + Intergenic
1009472492 6:64045112-64045134 GCTTTCAGCCAGCAGCTACTGGG + Intronic
1009489767 6:64274896-64274918 GCTGCCAGATAGTCGCCACTAGG - Intronic
1009670568 6:66743784-66743806 GTTGACATACAGCAGCCACTGGG + Intergenic
1012133944 6:95532348-95532370 GCTGCTAGTCAGGATCCACTAGG - Intergenic
1013514607 6:110874645-110874667 TCGGCCAGCCAGCCGCCACTCGG + Intronic
1013564847 6:111347916-111347938 GTAGCCAGGCAACAGCTACTTGG - Intronic
1016684981 6:146870991-146871013 GCTGCCAGGCTGCACTGACTTGG + Intergenic
1017350554 6:153436532-153436554 GCTGAAGGGCAGCAGCCTCTTGG - Intergenic
1017382726 6:153848788-153848810 GCTGCCAGCCATCAGCAAGTGGG + Intergenic
1017710593 6:157163817-157163839 GCTGCCAGGAGCCAGGCACTTGG + Intronic
1018365666 6:163117342-163117364 GCCGCCTGGCTCCAGCCACTGGG + Intronic
1018884340 6:167920383-167920405 GCTTCCAAGCGGCAGGCACTCGG + Intronic
1019518923 7:1451952-1451974 GAGGCCAGGCAGCAGCCACACGG + Intronic
1019542197 7:1556436-1556458 ACGGCCAGGCAGCTGCCACCTGG + Intronic
1019600946 7:1883498-1883520 GCCTTCAGGCAGCAGCCAGTGGG - Intronic
1019937902 7:4268340-4268362 GCTGCCAGGCCACACCCCCTCGG + Exonic
1020093589 7:5355210-5355232 CCTGCCAGGCAGCAGGTTCTGGG + Intronic
1020948681 7:14648109-14648131 GCTGCCAGGAAGCTGGAACTGGG + Intronic
1021181260 7:17508550-17508572 GCTTACAGACAGCTGCCACTAGG + Intergenic
1022923381 7:35037561-35037583 CCAGCCAGGCAGCAGCCGCCCGG - Intronic
1024993727 7:55255206-55255228 GTGGCCAGGCCGCAGCCACCCGG - Intronic
1025015434 7:55435489-55435511 GCTGACAGGCACCAGGGACTTGG - Intergenic
1025320868 7:58091935-58091957 GCAGCCAGGCAGCTGGAACTGGG + Intergenic
1025912876 7:65841652-65841674 GATGCCAGGAGGCAGCAACTGGG - Intergenic
1026046104 7:66906158-66906180 GCTGCCAGGAAGCAGGAGCTGGG - Intergenic
1026473019 7:70710280-70710302 GCTGCCTGGCAGTTGCCCCTGGG - Intronic
1027674312 7:81141043-81141065 ACTCCCTGGCAGCAGCCACATGG + Intergenic
1028819598 7:95190836-95190858 GCTGACATGCAGCTCCCACTTGG - Intronic
1029202306 7:98847291-98847313 CCTGCCAGCCAGCAGGGACTAGG + Exonic
1029253133 7:99251040-99251062 GCTCCCAGGCAGCAGCCAACTGG + Intergenic
1029304327 7:99607583-99607605 GCCTCCAGGCAGGAGCCACAGGG + Intronic
1029951651 7:104592751-104592773 GCTGCCAGGAAGCTGGAACTGGG - Intronic
1030266879 7:107630199-107630221 GCAGCCAGCCAGAGGCCACTGGG - Intergenic
1030269951 7:107660602-107660624 GCTGCCACGCAGGGGCCACCCGG - Intergenic
1030738785 7:113083993-113084015 GTGGCCAGGCAGCTGCCAATTGG - Exonic
1031220540 7:118959109-118959131 GCTGGCATGCAGCTCCCACTTGG - Intergenic
1031356842 7:120797416-120797438 GCTGCCTGGCAGCATAGACTAGG + Intronic
1031955370 7:127937275-127937297 TCTAGAAGGCAGCAGCCACTTGG + Intronic
1032508953 7:132456624-132456646 GCTGCGAACCGGCAGCCACTGGG + Intronic
1035760409 8:2064577-2064599 GCTCAGAGGCAGGAGCCACTGGG - Intronic
1036101323 8:5789024-5789046 GATTCCAGGCATCAGCCACTAGG - Intergenic
1036457960 8:8926081-8926103 AGTTCCAGGCTGCAGCCACTAGG + Intergenic
1036484098 8:9164108-9164130 CCTGCCCTGCAGCAGCCATTCGG - Intronic
1037590992 8:20311944-20311966 GATTACAGGCAGGAGCCACTGGG + Intergenic
1038144495 8:24882492-24882514 GCTGCTAGGAAGCAGAGACTGGG - Intergenic
1038694859 8:29797500-29797522 GCAGCCAGGAAGCACCTACTGGG - Intergenic
1039482259 8:37883012-37883034 GTAGCCAGGCACCAGCCACGGGG + Intronic
1039893736 8:41701761-41701783 GCTGCCGGGCAGGAACCACGGGG + Intronic
1039910080 8:41819561-41819583 GATGCCAGGCAGGACCTACTGGG + Intronic
1040385328 8:46911469-46911491 GCTGCCAGGCAGGGAACACTTGG - Intergenic
1040945087 8:52875700-52875722 GCTGACAGGCAGACGCCAATGGG + Intergenic
1041299057 8:56391832-56391854 ACTGCATGACAGCAGCCACTGGG - Intergenic
1042598009 8:70470360-70470382 TTTGCCAGCCAGCAGCCAGTAGG + Intergenic
1042961171 8:74305274-74305296 GCTGCCTGGCAGCTGCTGCTTGG + Intronic
1043453942 8:80395280-80395302 GATTACAGGCAGGAGCCACTGGG - Intergenic
1043492738 8:80765270-80765292 GCTGGCAGGCACCATCCAGTTGG - Intronic
1044674502 8:94716018-94716040 GATTACAGGCAGGAGCCACTTGG + Intergenic
1045059283 8:98398225-98398247 GAGGCCATGCAGCAGCTACTTGG + Intergenic
1045950760 8:107849209-107849231 GCTCCCAGCCAACTGCCACTAGG + Intergenic
1046033880 8:108817543-108817565 GCTGACATGCAGCTCCCACTTGG - Intergenic
1046700136 8:117391425-117391447 GCTGCAAGGTATCAGCCATTGGG + Intergenic
1047562095 8:125997926-125997948 GCTTCCAAGGAGCAGCCAGTAGG + Intergenic
1048286683 8:133147152-133147174 TCTGCCCGACAGCAGCCCCTTGG - Intergenic
1048574709 8:135681434-135681456 GTGGCCAGGCAGCAGGCACAGGG + Intergenic
1048718748 8:137298552-137298574 GCTGCCAGGCATCCCCTACTAGG - Intergenic
1049220187 8:141425512-141425534 GTTGCCAGGCAGCAGGCTCCTGG + Intronic
1049513807 8:143043180-143043202 CCTGGCAGCCAGCAGCCCCTGGG - Exonic
1049573099 8:143378674-143378696 CCTGCAGGGCAGGAGCCACTGGG - Exonic
1050546268 9:6711930-6711952 GGTGGCAGGCACCAGCTACTTGG + Intergenic
1052988006 9:34502078-34502100 CCTGCCAGCCAGCAGCAGCTTGG - Intronic
1055394195 9:75856318-75856340 GCTGCCTGGCAGTGGCCATTTGG - Intergenic
1055554656 9:77462345-77462367 CCTCCCAGGCAAGAGCCACTGGG - Intronic
1055580417 9:77702667-77702689 TCTGCCCGGCAGCACCGACTGGG - Intergenic
1055826903 9:80338457-80338479 GTTCCCTGGCAGCAGCCACATGG + Intergenic
1056026665 9:82504628-82504650 GCTGACATGCAGCTCCCACTTGG + Intergenic
1056128488 9:83561416-83561438 GCTGCTATGCACCAGACACTGGG + Intergenic
1056194966 9:84220222-84220244 GCTGCCAAGCAAGGGCCACTGGG - Intergenic
1057224812 9:93287326-93287348 CCTGCCAGGCACACGCCACTGGG - Intronic
1057552106 9:96059029-96059051 GCTGCCAAGCAGCAGCTCCTAGG - Intergenic
1057586103 9:96330218-96330240 GTTGGCAGGCACCAGCCAATTGG - Intronic
1059224605 9:112660059-112660081 GCTGCCAGTGAGCCCCCACTGGG + Exonic
1060304373 9:122397734-122397756 GATCCCTGGCAGCAGCCACATGG + Intergenic
1060585450 9:124782672-124782694 GGTGCCTGGCAGCTGGCACTGGG + Intronic
1060789447 9:126476158-126476180 GATGCCGCACAGCAGCCACTGGG - Intronic
1061007483 9:127936391-127936413 GCTGCCAGTCAGTAACCTCTGGG - Intronic
1061158218 9:128878014-128878036 CATGCCAGGCCGCAGCCTCTTGG + Intronic
1061163761 9:128910909-128910931 TCTGCCATGCAGCAGCCCCACGG + Intronic
1061409664 9:130412845-130412867 GATTACAGGCAGGAGCCACTGGG + Intronic
1061973404 9:134056558-134056580 GCAGCCTGGCACCAGCCAGTGGG + Intronic
1062043894 9:134416434-134416456 TGTCCCAGGAAGCAGCCACTCGG - Intronic
1062049390 9:134439268-134439290 GTCCCCAGGAAGCAGCCACTGGG - Intronic
1062310337 9:135932001-135932023 GCTGCCAGGCCACAGGCCCTCGG - Intergenic
1062453731 9:136626295-136626317 GCTGACACACAGCAGGCACTTGG - Intergenic
1203655235 Un_KI270752v1:17515-17537 GCTACCAGGCACCAGCCACTTGG - Intergenic
1185445464 X:255594-255616 GATGACAGGCATGAGCCACTGGG - Intergenic
1185673952 X:1833456-1833478 GATGACAGGCAGGAGCCACTGGG + Intergenic
1186407016 X:9313184-9313206 GCTGCAAGGAAGCACCCACCCGG + Intergenic
1186893824 X:13986633-13986655 GGTGCCTGGCAGCAGCCACAGGG + Intergenic
1188451211 X:30309392-30309414 GGTCCCAGGAGGCAGCCACTGGG - Exonic
1189797169 X:44656248-44656270 TCTGCCAGGCACCAGAGACTAGG - Intergenic
1192656941 X:73002822-73002844 GCAGCCCCGCAGCAGCCACAGGG + Intergenic
1192665179 X:73080179-73080201 GCAGCCCCGCAGCAGCCACAGGG - Intergenic
1194624851 X:96215216-96215238 TCTCCCAGTCAGTAGCCACTGGG - Intergenic
1199694887 X:150336926-150336948 GCTGACAGGCAGCAGAACCTGGG + Intergenic
1201980861 Y:19909003-19909025 GCTGCAAGGCAGCGCCCACACGG - Intergenic