ID: 925224928

View in Genome Browser
Species Human (GRCh38)
Location 2:2175561-2175583
Sequence GTCTGAGGTGGGCTTTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925224928_925224938 28 Left 925224928 2:2175561-2175583 CCTGACAAAAGCCCACCTCAGAC 0: 1
1: 0
2: 0
3: 7
4: 149
Right 925224938 2:2175612-2175634 CTCTGTGAACTGAGTTTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 208
925224928_925224933 -5 Left 925224928 2:2175561-2175583 CCTGACAAAAGCCCACCTCAGAC 0: 1
1: 0
2: 0
3: 7
4: 149
Right 925224933 2:2175579-2175601 CAGACACCACCGTAAGGAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925224928 Original CRISPR GTCTGAGGTGGGCTTTTGTC AGG (reversed) Intronic
901698119 1:11025937-11025959 GTGTGATGTGTGCTTTTGTTAGG + Exonic
902106627 1:14042030-14042052 GTGTGGGTTGGGCTTATGTCTGG + Intergenic
908666025 1:66492126-66492148 GTGTGACGTGGGCTGTTTTCAGG - Intergenic
909050935 1:70767143-70767165 GTATGAGGAGGGATTTTGTGTGG + Intergenic
916563046 1:165949607-165949629 GTTTGTGGTGAGCTTTGGTCAGG + Intergenic
917443109 1:175084086-175084108 CTCCCAGGTGGGCTTATGTCTGG - Intronic
920933448 1:210409644-210409666 CTCTGGGGAGGGCTTTTGTTTGG + Intronic
1065132654 10:22637717-22637739 GTCTGAGTTGTGGTTTCGTCTGG - Intronic
1067669978 10:48310665-48310687 ATGTGAAGTGGGCTTTTGTTTGG - Intronic
1074917712 10:117973559-117973581 ATCTGAGATGTGCTTTTGCCAGG + Intergenic
1077786958 11:5394932-5394954 GTCTCAAGGGGACTTTTGTCTGG + Intronic
1078221544 11:9355613-9355635 GGCTGAGGTGGGCTTGAGCCTGG - Intergenic
1078749960 11:14152099-14152121 GTCTGAGCTGGGGTGTAGTCTGG + Intronic
1080954883 11:37081827-37081849 CTCTAAGGTGGGATTGTGTCTGG + Intergenic
1085402384 11:76242588-76242610 GCGTGAGGTGGGCTTTAGTTGGG + Intergenic
1089042287 11:115463312-115463334 GTCTGAGCTGTTCTTTTTTCTGG - Intronic
1092123870 12:6062695-6062717 GACTGGGGTGGGCTCTTGTGGGG - Intronic
1094820088 12:34217798-34217820 GGCTGCGGTGGGCCTTGGTCAGG + Intergenic
1095094655 12:38139682-38139704 GGCTGTGGTGGGCCTTGGTCAGG - Intergenic
1096134744 12:49189993-49190015 ATCTGAATTGGACTTTTGTCTGG + Intronic
1097019447 12:56009343-56009365 GTCTGATTTGGCCTTTTATCTGG - Intronic
1099189069 12:79544554-79544576 GTCTAAGTTGGTCTGTTGTCTGG - Intergenic
1106342883 13:28847922-28847944 GTCACAGGTGGGCTTTTACCAGG + Intronic
1107161281 13:37231512-37231534 GACTGAGGAGGGTTTTTATCTGG - Intergenic
1107737571 13:43415946-43415968 GTGTGAGGAGCGCTTCTGTCCGG - Intronic
1108968970 13:56348159-56348181 TTCTCAGCTGGGCTTTTGTCTGG + Intergenic
1110495977 13:76168392-76168414 TTCTGAGGTGGGCTTTTGGAAGG - Intergenic
1114934342 14:27514969-27514991 GTCTGATGTTGGTTTTTCTCTGG + Intergenic
1117388742 14:55243089-55243111 TTCTGAGGTGGCCATTTGTCTGG - Intergenic
1121749479 14:96337749-96337771 GGCTGTGGTGGGCTCTTCTCTGG + Intronic
1121982045 14:98462964-98462986 ATCTGAGTTGGGCTTTTGATGGG + Intergenic
1123910999 15:24966928-24966950 GTATGTCGAGGGCTTTTGTCTGG + Intronic
1125202249 15:37110484-37110506 GTGGGAGGTGGGTTATTGTCTGG - Intergenic
1128112622 15:65086176-65086198 GCCTCAGGTGGGCATCTGTCAGG + Intergenic
1128305315 15:66594459-66594481 GTCTGAGGTGGCTGTTTGTCAGG + Intronic
1130855458 15:87835951-87835973 GTCTAAGTTGGTCTGTTGTCTGG - Intergenic
1131249657 15:90821953-90821975 GTGTGAGGAAGGCTTTTGTGGGG + Intergenic
1134188907 16:12106250-12106272 GTGTCAGGCGGGCTGTTGTCTGG + Intronic
1134631506 16:15759514-15759536 GTCTGAGATGGGCTTTTTCTTGG - Intronic
1135435801 16:22425848-22425870 GTTTGAGGTGGGGTTCTGCCAGG + Intronic
1136497522 16:30653177-30653199 GTCTTAGGTGGGTTTTTCTTGGG + Intronic
1138458310 16:57133611-57133633 GCAGGAGGAGGGCTTTTGTCTGG - Intronic
1139224653 16:65222482-65222504 GTCTGAGCTGGGCTTCATTCAGG + Intergenic
1141411416 16:83836096-83836118 ATCTGAACTGGGCTTTTGACTGG - Intergenic
1148966817 17:51442660-51442682 GTCTGGGGTGGGCCTCTCTCTGG + Intergenic
1151104337 17:71594987-71595009 GTCTGAGGTGTGCTGTTTTAAGG - Intergenic
1152484365 17:80580392-80580414 GTCTGAGGGAGGCTTTTTCCTGG + Intronic
1203170634 17_GL000205v2_random:145528-145550 GTCTGACTGGGGCTTCTGTCTGG - Intergenic
1154091953 18:11373274-11373296 GTCTGAGGAGGTCTTATCTCAGG - Intergenic
1156040363 18:32814052-32814074 GTCTGAAGTGGGCTTGTTTTGGG + Intergenic
1156402602 18:36753296-36753318 CTCTGAGGTGGGCTTTTTCAGGG + Intronic
1161478880 19:4500922-4500944 GGCTGCTGTGGGCTTTTCTCAGG + Intronic
1163552889 19:17975239-17975261 GTCTAAGGTGGGCTGGTGTGGGG - Intronic
1164218479 19:23172413-23172435 GTCTGAGAGGGGCTTCTGGCTGG - Intergenic
1166469286 19:43064063-43064085 GTCTGAAGTGGGCCTTGGTTTGG - Intronic
1166480416 19:43167597-43167619 GTCTGAAGTGGGCCTTGGTTTGG - Intronic
1166490237 19:43253140-43253162 GTCTGAAGTGGGCCTTGGTTTGG - Intronic
925224928 2:2175561-2175583 GTCTGAGGTGGGCTTTTGTCAGG - Intronic
925267924 2:2580211-2580233 GTCTGTGGAGGGCGTATGTCTGG + Intergenic
926456155 2:13070763-13070785 GTATGAGGAGGGATTTTGTGTGG + Intergenic
926651670 2:15353146-15353168 GATTGAGGTGGGCTTTGGTTGGG - Intronic
931938895 2:67230585-67230607 CTCGAAGGTGGGGTTTTGTCGGG - Intergenic
933655424 2:84882560-84882582 CTCTGAGCTGGGCTTCTCTCTGG + Intronic
934130716 2:88946225-88946247 ATCTGAGGAGTTCTTTTGTCAGG + Intergenic
934527462 2:95060374-95060396 TTCTGAGGTGGGCAGTTTTCTGG + Intergenic
935788922 2:106573270-106573292 ATCTGAGGGGGGCTTATCTCTGG - Intergenic
938001233 2:127740449-127740471 GGCTGAGGTGGGCTTGAGCCCGG + Intronic
939203080 2:139063227-139063249 GTCTTAGGAGTGCTTGTGTCAGG + Intergenic
939532804 2:143385897-143385919 GTCTGAGATGGCCTTTTAACTGG - Intronic
940544074 2:155061193-155061215 GTTTGAGCTGGCCTTTTGACTGG - Intergenic
944394496 2:199251621-199251643 GTCTAAGTTGGTCTGTTGTCTGG - Intergenic
944828738 2:203511536-203511558 GTTTGAGTTGGGTTTCTGTCAGG - Intronic
948559165 2:238839277-238839299 GTTTCAGGTAGGCTTTTGTGTGG + Intergenic
949008987 2:241667898-241667920 GTCAGAGGTGGGCTTTGGGGAGG - Intronic
1170044735 20:12072973-12072995 GTCTTAGGTCTGCTTTTGGCTGG - Intergenic
1171308872 20:24129832-24129854 ATCTGAGGGGGTCTTTTCTCTGG - Intergenic
1172816513 20:37691462-37691484 GGCTGAGGTGGGCTTCAGCCCGG + Intergenic
1174186331 20:48708783-48708805 GTCTGAGGCGGGCACATGTCTGG + Intronic
1177727110 21:24983974-24983996 GCCTGAGCTGGGCTTTTCTAAGG + Intergenic
1179632931 21:42689715-42689737 GGCTCAGGAGGGCTTTTGTCTGG - Intronic
1181184922 22:21096424-21096446 GTCTCAGGAGGGCTTTTACCTGG - Intergenic
1181758012 22:25039083-25039105 GCCTGAGATGGGCTCTTGGCTGG + Exonic
1181765362 22:25087684-25087706 CTCTGAGGTGGGGATTTGTGTGG + Intronic
1183341617 22:37284777-37284799 TCCTGAGGTGGGCCTGTGTCGGG + Intronic
1184122475 22:42461194-42461216 TTCTGAGGAGGGTTTTTGACAGG + Intergenic
1184982951 22:48107133-48107155 GCCTCAGGTGGGCTCTTGCCTGG - Intergenic
1185099157 22:48828366-48828388 GTATGAGGTGAGCTGTTGGCTGG + Intronic
950258154 3:11522757-11522779 GCCTGGGGTGGGCATTTGACAGG - Intronic
951992752 3:28694047-28694069 GGCTGAGGTGGGCTTGAGCCCGG + Intergenic
952280442 3:31918140-31918162 AACTGAGGAGGGCTTTTGTTTGG - Intronic
952606203 3:35149848-35149870 GTCTTAGTTGGGCTTTTCTCTGG - Intergenic
952686886 3:36160361-36160383 GCATGAGGAGGGCTTTAGTCAGG - Intergenic
954932574 3:54296902-54296924 GGCAGAGCTGGGCTTGTGTCTGG + Intronic
957654935 3:83061841-83061863 GGCTGAGGTGGTCTTTTATTGGG - Intergenic
957813963 3:85267261-85267283 GTCTGAAATGTGGTTTTGTCTGG + Intronic
960050587 3:113235378-113235400 GTCAGAGGTGGGCTCCTCTCTGG + Intronic
960128477 3:114026737-114026759 GTTTGAGGTGGACTTTTGGAAGG + Intronic
963061447 3:141230397-141230419 GGCTGCGGTGGGCTTCTGTGGGG + Intronic
964920601 3:161891137-161891159 CTCAAAGGTGGGGTTTTGTCAGG + Intergenic
966293511 3:178388676-178388698 GACTGAGTTCCGCTTTTGTCTGG + Intergenic
966917706 3:184594059-184594081 GTCTGAGTTCGGCTTCTGTCTGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968928988 4:3566114-3566136 CCCTGAGGTGGGCTTGTGACTGG + Intergenic
975133406 4:70850560-70850582 GTCTGAGGTATGCTTTGGTTTGG + Intergenic
975658158 4:76662162-76662184 GACTGAGCTGGGCTCTTATCTGG + Intronic
976846741 4:89497181-89497203 GTCCCATGAGGGCTTTTGTCAGG + Intergenic
979464333 4:121018950-121018972 GACTGTGATGGGGTTTTGTCAGG + Intergenic
979741677 4:124159124-124159146 GTGTGATCTGGGCTTCTGTCTGG + Intergenic
982211445 4:153039813-153039835 GTCTGAGGTAGCCTCTTGTTTGG + Intergenic
986279050 5:6307657-6307679 CTCTGAGGCTGGCTTTAGTCTGG + Intergenic
988739733 5:34058551-34058573 GTCTGACTCAGGCTTTTGTCTGG - Intronic
989107248 5:37875078-37875100 GTCTGATGTGGGATTGTTTCTGG - Intergenic
994407269 5:99360182-99360204 CTCTAAGGTGGGGTTTTGCCAGG + Intergenic
996898038 5:128509378-128509400 GTCTGAGGTGAACATTTTTCTGG - Intronic
997855443 5:137368681-137368703 GTCTTGGGCTGGCTTTTGTCTGG + Intronic
1006325263 6:33348895-33348917 GTCCGAGTTGGGCTGGTGTCTGG - Intergenic
1006593701 6:35177288-35177310 GGCTGGGGTGGGCTGTTGTGTGG - Intergenic
1008732166 6:54495536-54495558 GTCTGAGCAAGGCTTTTGTGGGG - Intergenic
1009733148 6:67635926-67635948 TTCTGAGGTTGACTTTTTTCAGG - Intergenic
1013193089 6:107820412-107820434 GTCTGAGAAGGGCTGTTGTGGGG + Intronic
1013597447 6:111672872-111672894 TTCTGAGGGAGTCTTTTGTCAGG - Intronic
1013843354 6:114423500-114423522 GTCTAAGTTGGTCTTGTGTCTGG + Intergenic
1014396426 6:120929860-120929882 GTCTAAGGTGGTCTGGTGTCTGG - Intergenic
1016084444 6:139895187-139895209 GTCAAAGGTGGGGTTTTGCCAGG + Intergenic
1023402120 7:39798041-39798063 GTGGGAGGTGGGCTTTTACCAGG + Intergenic
1023489177 7:40719588-40719610 TTCTGTTGTGGGCTTTTGCCTGG - Intronic
1024076100 7:45818671-45818693 GTGGGAGGTGGGCTTTTACCAGG + Intergenic
1024647504 7:51382619-51382641 GTGAGAGGTGGGCTTTTACCAGG - Intergenic
1025051337 7:55737114-55737136 GTAGGAGGTGGGCTTTTACCAGG - Intergenic
1025128303 7:56362781-56362803 GTGGGAGGTGGGCTTTTACCAGG - Intergenic
1031574277 7:123397019-123397041 GTCTAAGGTGGGATAGTGTCTGG + Intergenic
1032986250 7:137340784-137340806 GTTTGAGATGTGCTTTTCTCTGG - Intronic
1034968874 7:155407367-155407389 GTTTGAGGTGTGCGTGTGTCGGG + Intergenic
1034968892 7:155407449-155407471 GTTTGAGGTGTGCGTGTGTCGGG + Intergenic
1035246593 7:157566444-157566466 GGCTGAGGTGGGCCTTTCCCAGG - Intronic
1040058055 8:43078206-43078228 CTCTGCTCTGGGCTTTTGTCTGG + Intronic
1040280352 8:46038366-46038388 GGCTGTGGTGGGCCTTGGTCAGG + Intergenic
1041589056 8:59555539-59555561 GTCTGAGGTGTGGTCTTGTTTGG + Intergenic
1043362310 8:79489035-79489057 GACTGAGGTGGTTATTTGTCAGG - Intergenic
1044792528 8:95862860-95862882 CTCTGAGGTGGGTGTTTGGCAGG + Intergenic
1049610349 8:143552402-143552424 GTCTGAGGTGGGCTTGAGGGAGG - Intergenic
1053803696 9:41779698-41779720 CCCTGAGGTGGGCTTGTGACTGG + Intergenic
1054141574 9:61535425-61535447 CCCTGAGGTGGGCTTGTGACTGG - Intergenic
1054191995 9:61991090-61991112 CCCTGAGGTGGGCTTGTGACTGG + Intergenic
1054461271 9:65466148-65466170 CCCTGAGGTGGGCTTGTGACTGG - Intergenic
1054646384 9:67596700-67596722 CCCTGAGGTGGGCTTGTGACTGG - Intergenic
1055474097 9:76644198-76644220 GACTGGGGTTGGCTGTTGTCAGG + Intronic
1059764999 9:117375781-117375803 GTCCAAAGTGGGCTTTTGTGGGG + Intronic
1061597887 9:131644121-131644143 CTCTCAGGTGGGCTTCTCTCAGG - Intronic
1062635989 9:137492148-137492170 TTCTGAGGTGTACTTTTTTCTGG - Intronic
1062696738 9:137879540-137879562 GGCTGAGATGGGCTTTGGCCTGG + Intronic
1203435498 Un_GL000195v1:133148-133170 GTCTGACTGGGGCTTCTGTCTGG + Intergenic
1195681921 X:107553627-107553649 GTCTGATTTGGGGTTTTGTTTGG - Intronic
1197557488 X:127974568-127974590 GTCAGAGATGGGGTTTTGCCTGG + Intergenic
1200979346 Y:9247904-9247926 GCCTCAGGTGGGCATTTGTGTGG + Intergenic
1201771370 Y:17620238-17620260 GTCTGACTGGGGCTTCTGTCTGG - Intergenic
1201830185 Y:18285748-18285770 GTCTGACTGGGGCTTCTGTCTGG + Intergenic