ID: 925228960

View in Genome Browser
Species Human (GRCh38)
Location 2:2213453-2213475
Sequence GTCTCCTCATAGACTTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925228960_925228965 19 Left 925228960 2:2213453-2213475 CCAGCACAAGTCTATGAGGAGAC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 925228965 2:2213495-2213517 AACCACCTGAAAATCCTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 118
925228960_925228967 22 Left 925228960 2:2213453-2213475 CCAGCACAAGTCTATGAGGAGAC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 925228967 2:2213498-2213520 CACCTGAAAATCCTTGCAGGAGG 0: 1
1: 0
2: 0
3: 19
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925228960 Original CRISPR GTCTCCTCATAGACTTGTGC TGG (reversed) Intronic
904871606 1:33622540-33622562 GTCTCCTCATAGCCATCTTCAGG + Intronic
907185639 1:52607089-52607111 CTCTCCTCAAAGATTAGTGCTGG - Intronic
909244833 1:73268617-73268639 GTCTCTCCCTAGACATGTGCCGG - Intergenic
910588598 1:88904871-88904893 GTCTCCTCACAGATTTGGGGAGG + Intergenic
912748998 1:112269973-112269995 GTGTCCTCACAGACTTCTGCTGG - Intergenic
913611549 1:120514172-120514194 ATCTCCTCAGAGACCAGTGCAGG - Intergenic
913983245 1:143542635-143542657 ATCTCCTCAGAGACCAGTGCAGG + Intergenic
914579643 1:149008067-149008089 ATCTCCTCAGAGACCAGTGCAGG + Intronic
914797842 1:150936599-150936621 GTCTCCTGATGCACATGTGCAGG + Intronic
915529171 1:156493593-156493615 GTATCTGCATAGCCTTGTGCAGG - Intronic
916005676 1:160657867-160657889 GTCTCCACAGAAACTTTTGCTGG - Intergenic
916824932 1:168434213-168434235 GCTTCTTCATAGACTTGTGTTGG + Intergenic
919543851 1:198886706-198886728 GTCTCCACGTACAGTTGTGCAGG - Intergenic
922569072 1:226622556-226622578 GTTTTCTCATAGACCTGAGCAGG + Intergenic
923390414 1:233509691-233509713 AGCACCCCATAGACTTGTGCTGG + Intergenic
924179323 1:241424658-241424680 GTCTCCTCACAGCCTGGGGCAGG - Intergenic
924530535 1:244890015-244890037 GTGTCCTCATAGATTTGAACTGG - Intergenic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1074619503 10:115104778-115104800 GTCTCCTCAATAAATTGTGCTGG - Intronic
1075918646 10:126191282-126191304 GGCTCCTCATAGACTGGGCCCGG - Intronic
1078455313 11:11470305-11470327 GTCTCTACATAGTCCTGTGCAGG + Intronic
1081651260 11:44825601-44825623 GTCTCCTGACAGACTCGAGCTGG + Intronic
1087310003 11:96530168-96530190 GTCTCCTACTATACTTGTGTGGG - Intergenic
1088720758 11:112590072-112590094 GACACATTATAGACTTGTGCAGG + Intergenic
1091353606 11:134916743-134916765 GTCTCCAAATAGACTTGGGAAGG + Intergenic
1091437270 12:482346-482368 GGCTAATCATAGACCTGTGCTGG + Intronic
1092277263 12:7070806-7070828 GTTTGATCATAGAATTGTGCTGG + Exonic
1095501518 12:42845195-42845217 ATCTGCTCATAGTCTTGTGAAGG + Intergenic
1096388361 12:51210491-51210513 GTCTGCTCATAGTCTTGTTGTGG + Intronic
1107092086 13:36492780-36492802 GTTTCTTCATAGAGTTATGCAGG + Intergenic
1107101914 13:36602326-36602348 ATCTCTTCATAAATTTGTGCCGG + Intergenic
1112993453 13:105542748-105542770 CTCTCCTCATAAACTTGAGATGG - Intergenic
1122939918 14:104976694-104976716 GCCTCCACAGAGGCTTGTGCTGG - Intronic
1127780294 15:62307023-62307045 GTCTCCTAAGGGCCTTGTGCAGG - Intergenic
1131234107 15:90681560-90681582 CTCACCTCCCAGACTTGTGCAGG + Intergenic
1135173313 16:20206004-20206026 CTCACCTCATTGACTTGTTCAGG - Intergenic
1137543885 16:49384826-49384848 GTCTACTCATAGTCTTGTGGGGG - Intronic
1140834339 16:78779571-78779593 CTCTATTCATAGACTTGTGAGGG - Intronic
1140888349 16:79263917-79263939 GTCTCCTGAAAGACTGGTTCTGG + Intergenic
1141315755 16:82961217-82961239 ATCTCCTCATTGACTTGTGGTGG - Intronic
1142213726 16:88820955-88820977 GGCTCCTCAGTGACTTCTGCGGG + Intronic
1145013226 17:19381655-19381677 GGCTCCTCAAAGACTTGAGCAGG - Exonic
1146244756 17:31270130-31270152 GTCTACACATACACATGTGCAGG - Intronic
1147329034 17:39685678-39685700 GTCTCCCCAGAGAGTGGTGCTGG - Intronic
1151212016 17:72551510-72551532 GTGTCCTCATAGATTTGAACTGG + Intergenic
1155461313 18:26087338-26087360 GTATATTCATAGAGTTGTGCTGG - Intronic
1157085347 18:44574787-44574809 GTTTGCTCATAAACTTGTGAAGG - Intergenic
1165021570 19:32928656-32928678 GTCTCATCCTACACATGTGCAGG + Intronic
925228960 2:2213453-2213475 GTCTCCTCATAGACTTGTGCTGG - Intronic
929026295 2:37606305-37606327 ATCTACTCATAGCCTTGTGGAGG - Intergenic
930652117 2:53972989-53973011 GGCTCCTCAGAGATTTGTGAAGG - Intronic
934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG + Intronic
938815340 2:134897518-134897540 TTCCACTCATACACTTGTGCTGG - Intronic
944281299 2:197901181-197901203 GTCTCCTCATATACTGATTCTGG - Intronic
947735514 2:232452601-232452623 GTCCACTCATAAACTTATGCCGG + Intergenic
1170147329 20:13190489-13190511 GTCTCCTCAGTGAGTGGTGCTGG + Intergenic
1171304803 20:24096111-24096133 GGCTTCTCAGAGACATGTGCCGG - Intergenic
1173846817 20:46193540-46193562 TTCTGCTCAAAGACCTGTGCTGG + Intronic
1175959495 20:62628217-62628239 GTCCCCCCATACGCTTGTGCTGG - Intergenic
1178131915 21:29582969-29582991 GTCTGCTCATTTCCTTGTGCTGG - Intronic
1179421349 21:41239162-41239184 ATCTGCTCATAAACTTGAGCTGG - Intronic
1182736516 22:32535061-32535083 CCTTCCTCATAGAGTTGTGCTGG - Intronic
1183865613 22:40701906-40701928 GTATCCTCACAGAAGTGTGCAGG - Intergenic
1184010252 22:41742543-41742565 CTCTCCTCATAGACTTATTATGG - Intronic
953508730 3:43513106-43513128 GTTTCCTCACATACGTGTGCTGG - Intronic
967327516 3:188256833-188256855 GGCTCTTCATACATTTGTGCAGG + Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
979322849 4:119344206-119344228 TTCTGCTCATAGAGTGGTGCTGG + Intergenic
983240689 4:165228855-165228877 TTCTGCTCATAGAGTGGTGCTGG + Exonic
989998202 5:50860860-50860882 GTCTCCATAGAGACTTGAGCAGG + Intergenic
1001100793 5:168812364-168812386 GTCACCTCATACATTTGTGTTGG - Intronic
1002978542 6:2110639-2110661 ATTTCCTCACAGAGTTGTGCGGG - Intronic
1003568215 6:7238644-7238666 GTCTCCTCATATCATTCTGCAGG - Intronic
1005290330 6:24373258-24373280 GTCTCCTGATGCACATGTGCAGG - Intergenic
1010985365 6:82417307-82417329 TTCTCATCTTAGCCTTGTGCTGG + Intergenic
1015750410 6:136552948-136552970 GTATCTTGATAGAATTGTGCAGG - Intergenic
1016367312 6:143333487-143333509 GTCTCTGCATAGACTGTTGCCGG - Intronic
1017715383 6:157207369-157207391 GTCGCCTCAGAGACTTGTGCTGG + Exonic
1019752001 7:2736638-2736660 GTCTCCTCATGGGCGTGTGTCGG - Intronic
1023624666 7:42104071-42104093 GTATGCTCATATACTTGTACAGG - Intronic
1024934134 7:54695880-54695902 GCCTACTCATAGAGTTGTGAAGG - Intergenic
1029879576 7:103793610-103793632 GTTTCTTATTAGACTTGTGCTGG - Intronic
1038280224 8:26157642-26157664 GTCTACACAAAGACTTGTACAGG - Intergenic
1038552151 8:28479565-28479587 GTCTTCCCATAGAATTGTGAAGG - Intronic
1039017165 8:33163361-33163383 GTTTCTTCATAAACTTGTACTGG - Intergenic
1041913686 8:63117648-63117670 GTCTTCTTATTGACTTGTGAGGG - Intergenic
1051908314 9:22122629-22122651 GTCTCCTCAACGAATGGTGCTGG - Intergenic
1053693441 9:40612510-40612532 GTCTCCTATTCTACTTGTGCAGG + Intergenic
1054271389 9:63027575-63027597 GTCTCCTATTCTACTTGTGCAGG - Intergenic
1054304684 9:63411738-63411760 GTCTCCTATTCTACTTGTGCAGG + Intergenic
1054403431 9:64735759-64735781 GTCTCCTATTCTACTTGTGCAGG + Intergenic
1054437053 9:65221247-65221269 GTCTCCTATTCTACTTGTGCAGG + Intergenic
1054493345 9:65800745-65800767 GTCTCCTATTCTACTTGTGCAGG - Intergenic
1060247517 9:121958819-121958841 ATCTCCCCATACACCTGTGCAGG - Intronic
1189926034 X:45956468-45956490 GCCTTGTCATAGAATTGTGCTGG + Intergenic
1194861696 X:99006514-99006536 CTCTCCTTATAGACTTGTATAGG + Intergenic
1198570678 X:137952491-137952513 GTCTCTTCAATGAATTGTGCTGG - Intergenic
1199570752 X:149264683-149264705 CTCTCCTCTTAGGCTTGGGCTGG + Intergenic