ID: 925232166

View in Genome Browser
Species Human (GRCh38)
Location 2:2243081-2243103
Sequence AATGAAGGAAGGGCCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925232158_925232166 8 Left 925232158 2:2243050-2243072 CCAAGGGGCAATGTCAATGGGAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG 0: 1
1: 0
2: 6
3: 23
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925232166 Original CRISPR AATGAAGGAAGGGCCCCAGG TGG Intronic
900089175 1:912124-912146 AAGAAAGGAGGGGACCCAGGAGG - Intergenic
902341192 1:15784696-15784718 AGTCAGGGAAGGGCCCCAGCCGG - Intronic
902543019 1:17167637-17167659 AATCAAGGAAGGCCCCCTGGAGG + Intergenic
902613198 1:17609122-17609144 CATGCAGGAATGGCCCCAGGTGG - Intronic
903992588 1:27284208-27284230 AATGTAGAATGGGCCCCTGGAGG + Intronic
910001411 1:82346620-82346642 ACAGAAGGAAAGGCCACAGGAGG - Intergenic
911612347 1:99970501-99970523 AAGGAATGACGGGCCCCAGCCGG - Exonic
911783313 1:101911420-101911442 AATCAAGTAAGGGGCCCATGAGG - Intronic
912706515 1:111919067-111919089 AATGAATGAAGGCACCCCGGGGG - Intronic
912738042 1:112167609-112167631 ATTAAAGGAAGGGCCCCAGAGGG - Intergenic
912945775 1:114082859-114082881 AAGGAAGTAAGGGCCAGAGGGGG - Intergenic
913211717 1:116588191-116588213 GATCAAGGAAGGGCCAGAGGAGG + Intronic
914194550 1:145438786-145438808 AATGAAGAATGGGCCCCAAGTGG + Intergenic
914313767 1:146489456-146489478 AATGAAGGATGGGCCCCAAGTGG + Intergenic
914475881 1:148021668-148021690 AATGAAGAATGGGCCCCCAGTGG + Intergenic
914500582 1:148243925-148243947 AATGAAGGATGGGCCCCAAGTGG - Intergenic
914504200 1:148274723-148274745 AATGAAGGATGGGCCCCAAGTGG - Intergenic
915459299 1:156060312-156060334 AAGGAATGAGGAGCCCCAGGAGG - Intergenic
915459540 1:156061546-156061568 AAGGAATGAGGAGCCCCAGGAGG - Intronic
916055658 1:161067653-161067675 AAGGAAGGAAGAGACCCATGTGG + Intronic
916276971 1:163004921-163004943 AATGCAGGAAAGGCTCGAGGAGG + Intergenic
916680969 1:167104804-167104826 AATGGAGGTAGAGGCCCAGGAGG - Intronic
917132523 1:171757211-171757233 AATGAGGAAGGGGCCTCAGGTGG - Intergenic
917211151 1:172633172-172633194 AAGGAAGAAGGGGCCCCAGGTGG - Intergenic
917531182 1:175836539-175836561 AATGAGGAAGGGACCCCAGGTGG + Intergenic
918121732 1:181546480-181546502 ACAGAAGGCAGGGCCCCAGCAGG - Intronic
919588228 1:199465550-199465572 AATGAAGGAAGAGAGACAGGAGG + Intergenic
919700921 1:200630115-200630137 ACTGAAGAAAGGGCCCCTTGGGG + Intronic
920012789 1:202881708-202881730 AATGAAAGAGGGGCACCAGCTGG + Intronic
920377415 1:205516656-205516678 ATTGAAGGAGGGGCACCTGGTGG + Intronic
920444433 1:206005215-206005237 GATGAAGAATGGGCCCAAGGAGG - Intergenic
920873139 1:209810624-209810646 AATGAAGGGAGGGCCCCAAGGGG - Intergenic
922349054 1:224721006-224721028 AATGAAGGAGGGCCCCTTGGAGG - Intronic
922542914 1:226432822-226432844 AATGAAGGCGGGGCCCCTGCTGG + Intergenic
922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG + Intronic
923359047 1:233189519-233189541 AATGAAGGAATTGCACTAGGAGG + Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1063683774 10:8216111-8216133 AATAAAGAAAGGGCCCGAGCTGG - Intergenic
1064895357 10:20229186-20229208 AATGAGGGAAGGGAGACAGGAGG + Intronic
1068874303 10:61980188-61980210 TATGGAGGAAGGGGCTCAGGAGG + Intronic
1069901086 10:71707082-71707104 GGTGGAGGCAGGGCCCCAGGAGG - Intronic
1070252599 10:74786023-74786045 ACAGAAGGAAGTGCCCCAGCAGG - Intergenic
1070858586 10:79629719-79629741 AAAGAAAGAGAGGCCCCAGGTGG - Intergenic
1072070357 10:91909285-91909307 AATGAAGGAAGGGGTAGAGGGGG - Intronic
1072650837 10:97293927-97293949 AGTGCAGGGAGAGCCCCAGGTGG - Intergenic
1074364725 10:112848816-112848838 TATTCAGGAAGGCCCCCAGGAGG + Intergenic
1074419190 10:113294045-113294067 ACTGAAGGAGGGGACCTAGGCGG + Intergenic
1074514523 10:114153491-114153513 AAAGAAGAAAGGGGGCCAGGCGG + Intronic
1074684616 10:115949434-115949456 AAAGAAGGCTGGGCCCCAGATGG - Intergenic
1076124156 10:127961491-127961513 AGGGAAGGAGGGCCCCCAGGAGG + Intronic
1076810491 10:132884126-132884148 AAAGCAGGAAGGGCCTGAGGAGG - Intronic
1077162845 11:1121492-1121514 AAAGAGGGCGGGGCCCCAGGAGG + Intergenic
1077444951 11:2586554-2586576 ACTGGAGTAGGGGCCCCAGGTGG + Intronic
1077536981 11:3129178-3129200 AAGGAAGGAGGGGCAGCAGGAGG + Intronic
1080601215 11:33821946-33821968 GATGAAGGCAGGGCGTCAGGAGG - Intergenic
1081652383 11:44833051-44833073 AGTGAAGGGAGGGCTCCTGGAGG - Intronic
1081690154 11:45072628-45072650 CATGAACAAAGGTCCCCAGGTGG + Intergenic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1083936860 11:65873742-65873764 AAGGAAGGGCGGGCCCCAGGCGG - Intergenic
1084496317 11:69505684-69505706 AATGAAGGTGGGGCACAAGGTGG + Intergenic
1084615893 11:70235672-70235694 AATTCAGGAAGGGCCCCACTGGG + Intergenic
1085707363 11:78798762-78798784 ACTGAAGGGAGGCCCCCTGGTGG - Intronic
1085927353 11:81037983-81038005 AATGAAGGAATTGACCCTGGAGG + Intergenic
1088142427 11:106633507-106633529 AAGGAAGAAAGGGCCTTAGGGGG + Intergenic
1088272880 11:108053230-108053252 AATTAAGAAAGGCCTCCAGGAGG - Intronic
1089197643 11:116704003-116704025 AATGAAGGAAGGGTCATAGTTGG + Intergenic
1089422044 11:118339273-118339295 CTTCAAGGAAGGGCCCCAGCAGG + Intronic
1090353116 11:126120473-126120495 AATCAGGGAAGGCCTCCAGGAGG + Intergenic
1091217927 11:133914907-133914929 CATGACCAAAGGGCCCCAGGTGG - Intronic
1091815501 12:3434830-3434852 ATTGATCGAAGGGCCTCAGGAGG + Intronic
1095988241 12:48015068-48015090 AAAAAAGGCAGGGCTCCAGGTGG - Intergenic
1097870789 12:64600356-64600378 AATGAAAGAAAGCCCACAGGGGG - Intergenic
1098312380 12:69160561-69160583 AATGAAGGAAGCATTCCAGGAGG - Intergenic
1100153087 12:91765100-91765122 AATGGAGGAAAATCCCCAGGTGG - Intergenic
1100734160 12:97508441-97508463 AAAGAATAAAGGACCCCAGGAGG - Intergenic
1101414740 12:104499355-104499377 CATGAAGGCAGGGGACCAGGAGG - Intronic
1101856702 12:108449637-108449659 AATGCAGGAGGGGTTCCAGGTGG + Intergenic
1102168564 12:110824848-110824870 AGGGAAGGCAGGGACCCAGGAGG - Intergenic
1102528094 12:113526256-113526278 AATGAAAGCAGAGCCCCGGGAGG - Intergenic
1105634583 13:22204760-22204782 AATGAAGGCAGGGACCAAGCTGG + Intergenic
1105705127 13:22963634-22963656 AGGGAAGGAAGGGTCACAGGAGG + Intergenic
1106218665 13:27725916-27725938 AAAGAAGGAAGTACTCCAGGTGG - Intergenic
1108581629 13:51833019-51833041 AATCAAGGAAGGCCTCAAGGAGG + Intergenic
1111309105 13:86458093-86458115 AATAAAGGAATGACCCCAGATGG + Intergenic
1112626710 13:101113233-101113255 AATGAGGGAAGGACCGCAGATGG + Intronic
1113463660 13:110498830-110498852 AATGCAAGGAGGGCCACAGGAGG - Intronic
1114650134 14:24279492-24279514 AAAGACAGAAGGGCCCCAGAGGG + Intergenic
1117462145 14:55955771-55955793 AAAGAAGGTAGGGTCACAGGAGG + Intergenic
1117480913 14:56143774-56143796 AATCAAGGAAGTGCCCAATGGGG - Intronic
1119410873 14:74429383-74429405 TATGAAGGGAAGTCCCCAGGTGG - Intergenic
1119609027 14:76046157-76046179 AATGAAGAAAGGGAACCAAGAGG + Intronic
1121457408 14:94047177-94047199 AATTAAGGAAGGACCCCAAAGGG - Exonic
1121991085 14:98558091-98558113 TATGGAGGAAGGGACCCATGGGG + Intergenic
1122159838 14:99774789-99774811 AAGGAAGGAAGGGCAGAAGGAGG + Intronic
1122163447 14:99802970-99802992 GACGAAGGAAGGGCACCTGGGGG - Intronic
1122505753 14:102230755-102230777 GATGAAGGAAGGGTCCACGGGGG + Intronic
1122718348 14:103708277-103708299 CATGGAGCAAGGTCCCCAGGAGG + Intronic
1123149949 14:106171068-106171090 AATGGAAGAACGGCCCCATGTGG + Intergenic
1123196245 14:106619231-106619253 AATGGAAGAACGGCCCCATGTGG + Intergenic
1124883514 15:33662831-33662853 AAAGGAGGAAGTGACCCAGGTGG + Exonic
1126686250 15:51251239-51251261 AAAGACGGAAGGTCCCCAAGTGG + Intronic
1127243927 15:57150863-57150885 AAGGAAGGAAGGGACAGAGGGGG - Intronic
1127310398 15:57747028-57747050 AAGGGAGGATGGGACCCAGGGGG + Intronic
1127533218 15:59865262-59865284 AATGGGGGAAGGGCTCCAGAGGG - Intergenic
1128801968 15:70502655-70502677 ACTGCAGGAGGGGACCCAGGGGG - Intergenic
1128869222 15:71139844-71139866 AATGAAGCAAGGTTCCAAGGTGG - Intronic
1129112476 15:73345543-73345565 AATGAGTCATGGGCCCCAGGAGG + Intronic
1129994653 15:79994136-79994158 AGTGGAGGAAAGGCCACAGGTGG + Intergenic
1130756712 15:86771968-86771990 AATGAAGTAAGGGCCTGAGAGGG + Intronic
1131665562 15:94567915-94567937 CACTAAGGAAGAGCCCCAGGAGG - Intergenic
1132908850 16:2298284-2298306 ACTGGAGGAAGGGAGCCAGGAGG - Intronic
1133081934 16:3328734-3328756 ACTGAAGGCAGGGTCCCTGGTGG + Intergenic
1133924349 16:10181731-10181753 AGTGCAGGAGGGGCACCAGGGGG - Intronic
1134837273 16:17371676-17371698 AAGGAAGGAAGGACCTCATGTGG + Intronic
1135199438 16:20424221-20424243 AATGATTGAAGGGAACCAGGTGG - Intronic
1136244114 16:28963574-28963596 AATAAAGTCAGGGCCCCATGCGG - Intronic
1136680106 16:31955723-31955745 AATGGAAGAACGGCCCCATGTGG - Intergenic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1136889959 16:33962381-33962403 AATGGAAGAACGGCCCCATGTGG + Intergenic
1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG + Intronic
1138229495 16:55326915-55326937 AAAGCAGGAAGTGCCCCAGCTGG + Intronic
1138379008 16:56587548-56587570 AATGAAGGCAGGGACAGAGGAGG - Intergenic
1138537454 16:57667517-57667539 AATGATGTAATGGCCACAGGCGG + Intergenic
1138620462 16:58206864-58206886 ACTGTAGGAAAGGCCCCCGGGGG - Intergenic
1139961902 16:70722704-70722726 GATGCAGGCAGGGCCCAAGGAGG + Intronic
1141413573 16:83853149-83853171 AGTGAAGAGAGGGCCCCATGGGG + Intergenic
1141733632 16:85838588-85838610 AATGAGGAAATGGCCCCTGGTGG + Intergenic
1141845897 16:86608778-86608800 AAGGAAGGCAGGGCTCAAGGAGG - Intergenic
1203083075 16_KI270728v1_random:1161233-1161255 AATGGAAGAACGGCCCCATGTGG - Intergenic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1142674980 17:1508086-1508108 AGTGAGGGGAGGGTCCCAGGGGG - Intronic
1145263904 17:21370308-21370330 AATGAGGAAAAGGTCCCAGGAGG + Intergenic
1145267193 17:21385565-21385587 ACTGGAGGCAGTGCCCCAGGAGG + Intronic
1146683630 17:34825930-34825952 AATTTAGGAAGGGCAGCAGGTGG - Intergenic
1146817029 17:35950526-35950548 AGTGAAGGAGGGGACCCAAGGGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147610203 17:41797532-41797554 AATGAATGAAGGGAGGCAGGGGG - Intergenic
1147673699 17:42191103-42191125 AGTCAAGGAAGGCACCCAGGAGG - Exonic
1148106800 17:45123275-45123297 AATCAAGGAAGGGTTCCTGGAGG - Intronic
1148359259 17:46998370-46998392 AGTGAAGGAGGGGACCCAAGGGG + Intronic
1149290081 17:55209443-55209465 CATGAAGGAAGGGCCAGAGCTGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150376058 17:64682642-64682664 AATAAAGGAATGGCCACTGGGGG - Intergenic
1150484902 17:65536971-65536993 AGGGAAGGAGGGGCCCCCGGCGG - Exonic
1150706078 17:67488525-67488547 AACGAAGGAAGGGCCACATGTGG + Intronic
1150787435 17:68174369-68174391 AATGAAGGAAGGGACCCAAGGGG - Intergenic
1151191184 17:72399334-72399356 GAGGATGGAAGGGACCCAGGAGG + Intergenic
1151477082 17:74350315-74350337 AAGGAGGGGAGGGGCCCAGGTGG + Intronic
1152696542 17:81800512-81800534 AATGCAGGAAGGGAAACAGGAGG - Intergenic
1152933462 17:83122380-83122402 ACTGAAGCCAGGGCCACAGGAGG + Intergenic
1153234037 18:2968666-2968688 AAGGAAGGAAGGTTCCCAGTGGG + Intronic
1154141305 18:11826663-11826685 AATGAGGAAAGGGATCCAGGAGG + Intronic
1155298270 18:24405468-24405490 AATGGTGGAAGGGCACCATGTGG - Intergenic
1156578670 18:38349869-38349891 AAAGAAGGATGTGCCCCAGATGG - Intergenic
1158235165 18:55304188-55304210 AAGGAAGGAAGTGGCCAAGGTGG + Intronic
1161636316 19:5391455-5391477 TATGAATGGAGGGACCCAGGAGG - Intergenic
1161923070 19:7280916-7280938 AAAGAAAGAGGGGCTCCAGGGGG + Intronic
1161961797 19:7527485-7527507 AGTCAGGGAAGGGCCTCAGGGGG - Intronic
1162697075 19:12484723-12484745 GGTGGAGGAAGGGCCTCAGGTGG - Exonic
1163378124 19:16946900-16946922 ACAGAAGGAATGGGCCCAGGAGG - Intronic
1163557918 19:18002698-18002720 AGGGCAGGAAGGGGCCCAGGAGG + Intronic
1164856321 19:31527453-31527475 AATGAAGGAAGGGAAACAGAAGG + Intergenic
1164862729 19:31575401-31575423 CGTGAAGGAAGGGCTCCTGGTGG + Intergenic
1165896803 19:39146332-39146354 AATCAAGGAAGGCCTCCTGGAGG + Intronic
1165997762 19:39856710-39856732 AATGAAGGAATGTCCACAGCAGG + Intergenic
1168133862 19:54337736-54337758 ACAGAAGGAAGGGGCGCAGGAGG - Intronic
1168444697 19:56401949-56401971 AATGAGGAAGGGGCCCCAGTGGG + Intronic
925041255 2:733169-733191 CATGGAGGGAGGGCGCCAGGCGG + Intergenic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
925247348 2:2395763-2395785 AATGGAGGTAGGCCCCCAGCAGG + Intergenic
925274552 2:2639486-2639508 GATGAAGCAAGGGGCCGAGGAGG - Intergenic
925971136 2:9107436-9107458 GAAGAAGGATGGGCCCAAGGAGG + Intergenic
926041788 2:9679527-9679549 AATGGATGAAGGACCCCACGAGG - Intergenic
928381389 2:30821702-30821724 CAGGAAAGAAGGGACCCAGGAGG - Intergenic
929079206 2:38105920-38105942 AATCAAGGCAGGGCCCAGGGAGG + Intronic
929559296 2:42945767-42945789 CATGAAGGAAGGGGCCCCGGAGG - Intergenic
930044217 2:47155004-47155026 CAGGAAGGAAGGTCCGCAGGTGG + Intronic
930277597 2:49331774-49331796 AATGAAGGAAGGGGCAAGGGAGG + Intergenic
930779287 2:55207349-55207371 AATGAATGTGGAGCCCCAGGCGG + Intronic
934567282 2:95347695-95347717 TACCATGGAAGGGCCCCAGGGGG - Intronic
935691082 2:105733114-105733136 AAGGAAGGAAGGTCACCAGTGGG + Intergenic
937662551 2:124446961-124446983 ATTGAAGCAAGGGGCCGAGGAGG - Intronic
938142815 2:128810825-128810847 ACTGTAGGAAGGGACCCAGTTGG - Intergenic
938261152 2:129895906-129895928 AAGGAAGGATGGGTCTCAGGTGG + Intergenic
939500394 2:142976293-142976315 AACAAAGAAAGGGCCCCAGGTGG - Intronic
939880108 2:147621603-147621625 AAGGAAGAGGGGGCCCCAGGAGG + Intergenic
943848072 2:192677107-192677129 GATGAAGGAAGGGCCCAAAATGG + Intergenic
945258411 2:207821885-207821907 AAAGAAGGAATGGCCAAAGGAGG - Intergenic
947531291 2:230910215-230910237 ACTGCAGGAAGAACCCCAGGTGG + Exonic
948936559 2:241168925-241168947 AACCAAGGAAGGGACTCAGGAGG + Intronic
1168964780 20:1892785-1892807 AAGGAGGGGAAGGCCCCAGGTGG - Intergenic
1169462487 20:5807846-5807868 TTTGGAGGAAGGTCCCCAGGTGG + Intronic
1170268748 20:14499751-14499773 AAAGAAGGAAGGGAGGCAGGAGG - Intronic
1171993933 20:31717880-31717902 AATGTGGGAAGGGACCCAGGTGG - Intronic
1172160711 20:32866200-32866222 AATGAATGAAAGGTCACAGGAGG + Intronic
1173443927 20:43100788-43100810 AAAGAGGGAAGGTGCCCAGGTGG + Intronic
1174344340 20:49918840-49918862 AATGAAGGATAGCCTCCAGGAGG + Intergenic
1174444238 20:50579837-50579859 GGTGAAGGAAGAGACCCAGGAGG + Exonic
1175415557 20:58798466-58798488 ATTGGAGGGAGGGGCCCAGGAGG + Intergenic
1175609074 20:60335069-60335091 AATAAAGGAAGAGCAGCAGGCGG + Intergenic
1175760702 20:61560746-61560768 CATGAAGGCAGTGCCCCAGAAGG + Intronic
1175838476 20:62011691-62011713 AATGGAGGCTGAGCCCCAGGGGG - Intronic
1176294634 21:5064831-5064853 CATGAAGGGAAGGTCCCAGGAGG + Intergenic
1177038311 21:16072866-16072888 ACTGAAAGAAGGCCCCCAGTAGG - Intergenic
1177322632 21:19543045-19543067 AATGAGGAAGGGGCCCCAGGTGG + Intergenic
1178183460 21:30191588-30191610 GATTAAGGAAGGGTCCGAGGTGG + Intergenic
1179280169 21:39927111-39927133 GATGATTGAAGGGTCCCAGGTGG + Intronic
1179605377 21:42512840-42512862 AAACAAAGCAGGGCCCCAGGGGG + Intronic
1179862416 21:44197295-44197317 CATGAAGGGAAGGTCCCAGGAGG - Intergenic
1180844934 22:18975773-18975795 AATCCAGGAAGGCTCCCAGGAGG - Intergenic
1180976708 22:19852599-19852621 AATGGAAGGAGGGGCCCAGGGGG + Intronic
1181056525 22:20262936-20262958 AATCCAGGAAGGCTCCCAGGAGG + Intronic
1183169152 22:36172239-36172261 AACGAGGAAGGGGCCCCAGGTGG - Intergenic
1184591984 22:45490994-45491016 AAGGAGGAAGGGGCCCCAGGTGG + Intergenic
1184653647 22:45930658-45930680 AAGGAAGGGATGCCCCCAGGAGG - Intronic
952041680 3:29268717-29268739 TATGAGGGAATGGCCCCAGCTGG + Intergenic
952726948 3:36596597-36596619 CATGAGGGGAGGGGCCCAGGAGG - Intergenic
952882004 3:37991205-37991227 AAAGAAGGAAGGGCTCCTGTAGG + Intronic
953093587 3:39753422-39753444 AAGGAAGGATTGACCCCAGGTGG - Intergenic
954139192 3:48596166-48596188 AAAGGAGGAAGGGGCCCAAGGGG - Intergenic
955252646 3:57299930-57299952 AATGAGGAAAGGGCCCCACGTGG + Intronic
955499814 3:59572629-59572651 GCTGAAGGAAGGCCTCCAGGAGG - Intergenic
956040114 3:65136886-65136908 CATGAAGGCAGGATCCCAGGAGG - Intergenic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
960872893 3:122267790-122267812 AATAACGGAAAGTCCCCAGGTGG + Intronic
961010593 3:123433200-123433222 AAGGCAGGCAGGGCCCCAGAGGG + Intronic
961210631 3:125122691-125122713 CATCAAGGTAGGGCCCCAGCAGG + Intronic
961625573 3:128261117-128261139 AATGAAAGAACAGGCCCAGGTGG + Intronic
961870163 3:129981651-129981673 AATGAAGGAAGCCTCCCTGGGGG + Intergenic
962848734 3:139291966-139291988 CATGGAGAAAGGGCCCCAGCTGG - Intronic
963275052 3:143321445-143321467 AATGTGGGAAGGACCTCAGGTGG - Intronic
963939107 3:151083098-151083120 AATGGAAGAAGGGGACCAGGAGG + Intergenic
964099230 3:152968762-152968784 AGTGAAGGAAGTGCTTCAGGAGG - Intergenic
967229501 3:187324137-187324159 AATGAGGAAGGGGCCCCAGGTGG + Intergenic
967284871 3:187859222-187859244 AATGATGGATGGGCCACAGGTGG + Intergenic
967983673 3:195080233-195080255 TAGGAAGGAAGGGGCCCAGATGG + Intronic
968565158 4:1308424-1308446 ACTGAAGGCAGGGTCCCAGGAGG - Intronic
969542994 4:7805371-7805393 GAGAAAGGAAAGGCCCCAGGGGG - Intronic
971481150 4:27116152-27116174 AATGAATGAAGGGACCCACGTGG - Intergenic
971877951 4:32328447-32328469 AACGAGGAAAGGGTCCCAGGTGG + Intergenic
975468393 4:74735468-74735490 GATGAAGAAAGGGCCTCACGTGG - Intergenic
976499816 4:85774712-85774734 AATGAGGAAAGAGCCCCAGCTGG - Intronic
977203041 4:94139672-94139694 AAGGAAGGAAGGGGCCAAGTCGG + Intergenic
978737557 4:112101172-112101194 AATGAAGGAAGGGGCTCTGAAGG - Intergenic
979880831 4:125957426-125957448 AATAAATGAAGAGCCCCATGTGG - Intergenic
986936218 5:12890823-12890845 GTTGAAGGAAGGCACCCAGGAGG - Intergenic
988536445 5:32073394-32073416 GATGAAGGAAGGACCTCAAGGGG + Intronic
990037974 5:51345911-51345933 TAAGAAGGAAGGCCCCTAGGAGG - Intergenic
991655736 5:68902169-68902191 TATTAAGGAAGGGCCCCCAGGGG - Intergenic
991974743 5:72174946-72174968 AAGGAAGGAAGGGCCAAAGAGGG - Intronic
992646415 5:78815903-78815925 AAGAAAGAAGGGGCCCCAGGAGG - Intronic
994254959 5:97581845-97581867 TATGAAGGAAGGACCAAAGGAGG + Intergenic
994411248 5:99409880-99409902 AATGAAGCCAGGGACCCTGGTGG + Intergenic
994482581 5:100355367-100355389 AATGAAGCCAGGGACCCTGGTGG - Intergenic
997331803 5:133068926-133068948 AATTTAGAAAGGGCACCAGGAGG + Intronic
999107285 5:149085075-149085097 ACTGAAGGAAGGGCTGCAGGTGG - Intergenic
999231768 5:150065886-150065908 AAGGCAGAAAGGGCCGCAGGGGG + Intronic
999393820 5:151213953-151213975 AGGGTTGGAAGGGCCCCAGGAGG + Intronic
1002104761 5:176874564-176874586 CAGGTAGGAAGGACCCCAGGGGG + Exonic
1002705836 5:181160496-181160518 GGCGAAGGAAGGGCCCCGGGCGG + Intergenic
1004068537 6:12275221-12275243 TATGAGGGAAGAGCCCCAAGCGG - Intergenic
1004406438 6:15337773-15337795 AACGAAGGAACGGCCCCTGCTGG + Intronic
1006350061 6:33514358-33514380 TGTGAAGGAAGGGTCTCAGGAGG - Intergenic
1007486254 6:42182821-42182843 AAGGAAGGAAGGAAGCCAGGAGG - Intergenic
1009667592 6:66704189-66704211 AATGAAGCCACGGCCCCTGGTGG + Intergenic
1010626143 6:78138325-78138347 AATGAAGGAAGTGACCCTGCAGG + Intergenic
1015209588 6:130682191-130682213 AATGAAGAAAGGGCCAGGGGAGG - Intergenic
1020263640 7:6545980-6546002 ACTGTAGCACGGGCCCCAGGAGG - Intronic
1022418161 7:30196007-30196029 AATGAGGAAGGGGCCCCAGGTGG - Intergenic
1023745035 7:43315294-43315316 TATGAAGGAAAGGCCACAGAAGG + Intronic
1023876433 7:44288809-44288831 AATGAAGGAGGTGCCCGAGCAGG - Intronic
1023904681 7:44513734-44513756 AGGGCAGGAAGGGTCCCAGGGGG + Intronic
1024242232 7:47444575-47444597 AAGGAGGGAAGGGTCCCAGAAGG + Intronic
1024620376 7:51151921-51151943 AGTTAAGGAATGGCCACAGGCGG - Intronic
1024715854 7:52078525-52078547 TATGAAGGCAGGGCCTCAGCTGG - Intergenic
1026006197 7:66602114-66602136 AAAGAAGGAGAGGCCACAGGTGG + Intergenic
1026832428 7:73618433-73618455 AATGTAGGAAAGACCCCTGGAGG - Intronic
1027416104 7:77976319-77976341 AATGAGGAAGGGGCCCCAGGTGG - Intergenic
1027756795 7:82223983-82224005 GATGTAGGAAGGGCCCAAGCTGG - Intronic
1028807312 7:95043448-95043470 CAAGGAGGAAGGGCCCCAGATGG + Intronic
1029539677 7:101175243-101175265 AATGAAGAAAGGGGCCAATGTGG - Intronic
1029680768 7:102107586-102107608 GATGCAGGGAGGGCCCCGGGTGG - Intronic
1029873456 7:103721214-103721236 AATGAAGGAAGGGTGGAAGGAGG - Intronic
1030533024 7:110733789-110733811 AATGGAGGAAGGGCCAGAGGGGG - Intronic
1032079176 7:128850104-128850126 AATGAAGGAAGGGGAGGAGGAGG - Intronic
1032239682 7:130150885-130150907 TTTTAAGGAAGGGCCACAGGTGG + Intergenic
1032248686 7:130234325-130234347 AGTGAGGAAGGGGCCCCAGGTGG + Intergenic
1032945378 7:136846022-136846044 AATAAAGGAAGGGACCTAAGTGG + Intergenic
1033044368 7:137947920-137947942 AATGAAGGTCGGGCCGGAGGAGG - Intronic
1038404159 8:27309512-27309534 AAAGAAGGCAGGGCCACAGAGGG + Intronic
1038416069 8:27397038-27397060 AAGGCAGGAAAGGGCCCAGGTGG - Intronic
1038537655 8:28365346-28365368 AATGGTGGAAGTGCACCAGGTGG - Intronic
1038614144 8:29077135-29077157 AATGAGGGAGGGTCCCCTGGTGG + Intronic
1038884310 8:31646720-31646742 AATGACTGAAGGACCCCAGCTGG + Intronic
1041714937 8:60924161-60924183 AATGAAAGATGGGGACCAGGTGG - Intergenic
1046808209 8:118503703-118503725 GATGGAGGAAGAGCCCAAGGAGG - Intronic
1047513652 8:125534750-125534772 AAGGAGGGAAGGGCCTGAGGAGG + Intergenic
1048519962 8:135144371-135144393 AGTGAAGGAAGAGACCCAGTTGG - Intergenic
1049382070 8:142321156-142321178 AGTCAAGGAAGGGCAGCAGGCGG + Intronic
1049476794 8:142800614-142800636 AATGAAGAAGGGTCCACAGGAGG + Intergenic
1049718687 8:144105579-144105601 GCTGAAGGCAGGGCCCCAAGGGG + Intronic
1050932739 9:11350070-11350092 TATGAAGGAAGGGCCCTATTAGG - Intergenic
1051630499 9:19136223-19136245 AATGAAGAAAGGGATGCAGGTGG - Intronic
1053091127 9:35277898-35277920 AAAGAAGGAAAGTCCCGAGGTGG + Intronic
1056065494 9:82929401-82929423 AAAGAAGGAAGAGCCAAAGGAGG + Intergenic
1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG + Intergenic
1057798575 9:98175365-98175387 GGTGAAGGAAGGGCCCCTTGAGG + Intronic
1058297724 9:103329462-103329484 AAGGAAGGAAGGAACCAAGGGGG - Intergenic
1058364283 9:104189184-104189206 AATGAATGAAGGTCACCAGGGGG - Intergenic
1059409222 9:114121699-114121721 AAAGAAGCCTGGGCCCCAGGAGG - Intergenic
1059414063 9:114152484-114152506 AACCGAGGAAGGCCCCCAGGAGG - Intergenic
1059437003 9:114283007-114283029 TCTGAAGGAAGGGGCCCAGAGGG + Intronic
1060301017 9:122374695-122374717 AATGAAACCAGGACCCCAGGGGG - Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062276211 9:135732674-135732696 GAAGAAGGAAGTTCCCCAGGAGG - Intronic
1062359944 9:136182941-136182963 TGAGAAGGAAGGGCCCCAGCTGG + Intergenic
1062552531 9:137096299-137096321 CCTGAAGGATGGGACCCAGGAGG + Exonic
1062683149 9:137794927-137794949 AATGAATGAGGGGCACCAGATGG + Intronic
1187427123 X:19188046-19188068 AATGAGGAAGGGGCCCCAGGTGG - Intergenic
1190908547 X:54751114-54751136 ACTCAAGGTAGGGCCCAAGGCGG + Exonic
1192330406 X:70170825-70170847 AGTGATGCGAGGGCCCCAGGAGG - Intergenic
1197062269 X:122195658-122195680 AATGAAGCAAGGGGTCCAAGGGG - Intergenic
1197759178 X:130015661-130015683 TAAGATGGAAGGCCCCCAGGGGG + Exonic
1198029064 X:132737479-132737501 GATAAAGGGAGGGCCCCAGTGGG - Intronic
1198243086 X:134803321-134803343 AATGAGAAAGGGGCCCCAGGTGG - Intronic
1200215358 X:154365852-154365874 AGAGGAGGAAGGGCCCCAGCAGG + Intronic