ID: 925232986

View in Genome Browser
Species Human (GRCh38)
Location 2:2252412-2252434
Sequence TAGGAAGAACAGCTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925232986_925232990 -10 Left 925232986 2:2252412-2252434 CCCACCACAAGCTGTTCTTCCTA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 925232990 2:2252425-2252447 GTTCTTCCTATTGAGCTGCAGGG 0: 1
1: 2
2: 0
3: 14
4: 164
925232986_925232997 27 Left 925232986 2:2252412-2252434 CCCACCACAAGCTGTTCTTCCTA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 925232997 2:2252462-2252484 CTCCATTCTGCAATCCAGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 232
925232986_925232993 1 Left 925232986 2:2252412-2252434 CCCACCACAAGCTGTTCTTCCTA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 925232993 2:2252436-2252458 TGAGCTGCAGGGACGGATGCTGG 0: 1
1: 0
2: 4
3: 20
4: 226
925232986_925232991 -6 Left 925232986 2:2252412-2252434 CCCACCACAAGCTGTTCTTCCTA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 925232991 2:2252429-2252451 TTCCTATTGAGCTGCAGGGACGG 0: 1
1: 0
2: 3
3: 4
4: 183
925232986_925232994 23 Left 925232986 2:2252412-2252434 CCCACCACAAGCTGTTCTTCCTA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 925232994 2:2252458-2252480 GCTCCTCCATTCTGCAATCCAGG 0: 1
1: 0
2: 1
3: 18
4: 148
925232986_925232996 26 Left 925232986 2:2252412-2252434 CCCACCACAAGCTGTTCTTCCTA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 925232996 2:2252461-2252483 CCTCCATTCTGCAATCCAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925232986 Original CRISPR TAGGAAGAACAGCTTGTGGT GGG (reversed) Intronic
901202241 1:7473337-7473359 TAGGAGGAACAGCTGGGGCTGGG + Intronic
901335172 1:8443164-8443186 AAGAAAGAAAAGCTTTTGGTTGG + Intronic
901705467 1:11069831-11069853 TAAGAAGAACAGTCAGTGGTGGG + Intronic
904038871 1:27572965-27572987 TAGGAATAAGAGCTTGTGTCAGG - Intronic
904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG + Intronic
905620626 1:39443053-39443075 TAGAAAGAGCAGCTTTTGATTGG + Intronic
906260839 1:44388482-44388504 TAGGATCTACAGCTTGTGGAAGG - Intergenic
906959087 1:50404706-50404728 CAGGAAGTAGAGGTTGTGGTGGG - Intergenic
907067027 1:51494275-51494297 CTGGAAGAAGAGGTTGTGGTTGG - Intronic
909687438 1:78366319-78366341 GAGGTGGAACAGCTTTTGGTAGG - Intronic
910652048 1:89580236-89580258 TAGAAACAACAGCTCCTGGTTGG + Intronic
913071109 1:115299363-115299385 TAGGAAGAAGTTGTTGTGGTTGG + Intronic
913320058 1:117581828-117581850 GAGGAAGAACAGCTAGCAGTGGG - Intergenic
913488878 1:119359670-119359692 TCAGAACAACATCTTGTGGTAGG - Intergenic
913512216 1:119572241-119572263 TAGGACAAAAAGCTTCTGGTTGG - Intergenic
916361901 1:163979532-163979554 TGGGGAGAACAGCTTGTGAAGGG + Intergenic
916853707 1:168728611-168728633 TAGGTAGAACAGCTTCTGGAAGG + Intronic
917154547 1:171982870-171982892 TAGGTAGAACTGATGGTGGTGGG - Intronic
917215358 1:172672561-172672583 TATGGAGAACAGACTGTGGTGGG + Intergenic
917987147 1:180332300-180332322 TCTGAAGAACAGATTGTAGTGGG - Intronic
918521135 1:185416066-185416088 TGGGGAGAACAGCTTCTGGAAGG + Intergenic
918802635 1:188991433-188991455 CTGGAAGACCAGCTGGTGGTTGG - Intergenic
918877361 1:190065345-190065367 CAGGAATATCAGCTTGTGGAAGG - Intergenic
920081503 1:203377403-203377425 TAGGAAGAACAGATTTTTCTAGG + Intergenic
920846642 1:209598944-209598966 TATGAAGAACAGCTTGAGACTGG + Intronic
1063545674 10:6978957-6978979 TAGTAAGAACATGTTGTGCTTGG - Intergenic
1063978119 10:11433171-11433193 TAGGAAGAAAAGTTTTTGTTTGG - Intergenic
1065722941 10:28643662-28643684 TAAGAAGAGGAGCTTGTGGCAGG - Intergenic
1070130869 10:73654518-73654540 TGGGAAGAACTGCATGGGGTAGG + Intronic
1072026193 10:91460515-91460537 TAGGAAGAATAGGTTCTGGAAGG - Exonic
1073208821 10:101782484-101782506 TTGGCAGGACAGCTTGAGGTTGG + Exonic
1076998080 11:308816-308838 TGGGGAGAACAGCCTGTGCTGGG + Intronic
1076999301 11:314735-314757 TGGGGAGAACAGCCTGTGCTGGG + Intronic
1077354475 11:2108850-2108872 GAGGCAGAACAGCTGGTGGAGGG + Intergenic
1078532524 11:12148208-12148230 TAGGGGGCACAGCTTGTAGTAGG + Intronic
1079198347 11:18351754-18351776 TAGGAAGAGAAGCTCATGGTGGG + Intronic
1079406480 11:20151446-20151468 TAGGAAGGAGATCTCGTGGTGGG + Intergenic
1080097455 11:28426060-28426082 TAGGAAGAATAGCTAATGTTGGG - Intergenic
1080573031 11:33574463-33574485 TGGAAAGAACAGTTTGTGGTTGG - Intronic
1082752049 11:57029952-57029974 TAGTAAGAACATGTTGTGGTAGG - Intergenic
1083303481 11:61750987-61751009 TAGGGAGAACTGCTTTAGGTAGG + Intergenic
1084978239 11:72814804-72814826 TCGGAAGCCCAGCTTGTGGGAGG - Intronic
1086679175 11:89647703-89647725 TAGTAAGAAAAGATGGTGGTTGG - Intergenic
1087198854 11:95325726-95325748 TGGGAAGAACAGATTGTGGGAGG - Intergenic
1087277657 11:96176518-96176540 TAGGAAGGACCGCTTTTGGATGG + Intronic
1087357820 11:97117106-97117128 TAGGTAGAACAGATGGGGGTGGG + Intergenic
1088437233 11:109827966-109827988 TATGAAGAACTGCCTGAGGTTGG - Intergenic
1088885691 11:114004671-114004693 TAGAAAGTACAGCTTGTAGGAGG - Intergenic
1090313190 11:125761296-125761318 TATGGAGAACAGATTGTGTTTGG - Intergenic
1091857908 12:3753755-3753777 CATGAAGAACAGCTGGTGTTTGG - Intronic
1093163842 12:15782262-15782284 TTGGAAGAACTGCTTGTGCCTGG + Intronic
1096328273 12:50685671-50685693 TTGGAAGAACACATTGTGATTGG + Intronic
1098088804 12:66878876-66878898 TTGGAACAACAGCTTGTAGGAGG + Intergenic
1098403374 12:70097825-70097847 TAGCAAGTACAGCATGTGATTGG + Intergenic
1098461106 12:70734079-70734101 TAGGAAGCAAAGCTTATGCTGGG + Intronic
1099687415 12:85907940-85907962 TATGGAGAAAAACTTGTGGTGGG + Intergenic
1101844316 12:108350103-108350125 TAGTAATAGCAGGTTGTGGTGGG + Intergenic
1104316675 12:127709631-127709653 TAGGAAGGAAAGCTTGAAGTAGG + Intergenic
1109451913 13:62526793-62526815 TAAAAAGAATAGTTTGTGGTTGG - Intergenic
1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG + Intergenic
1110851916 13:80256111-80256133 TAGGAGGAGCAGGTTTTGGTGGG - Intergenic
1113389729 13:109883943-109883965 TGTGAAGCACAGCTTGTGGGGGG - Intergenic
1115670147 14:35601564-35601586 TAGGAAGAGCAGGCTTTGGTTGG + Intronic
1116265828 14:42688243-42688265 TATGAAGAACTGCTTGAGGCTGG + Intergenic
1121676100 14:95754272-95754294 TAGGAAGAATGGATTGTGGAAGG - Intergenic
1126993783 15:54415965-54415987 GAGTAAGAAGAGCTTTTGGTAGG + Intronic
1128726815 15:69994049-69994071 TAGGAACAACAGCAGGAGGTGGG + Intergenic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1134331691 16:13257191-13257213 TAGAAAGAAAAGCTTGTCCTGGG - Intergenic
1135000052 16:18769352-18769374 TAGGAAGAACAGTCTTTGCTGGG - Intergenic
1135192041 16:20362314-20362336 TAGAAAGCGCAGCTGGTGGTAGG + Intronic
1135718792 16:24796470-24796492 TAGAAAGGACAGCTTGAGTTGGG + Intronic
1138079917 16:54080897-54080919 CTGGAAGAACAGCTCGTGCTTGG + Intronic
1138967246 16:62099365-62099387 TATGAAGAAAAGCTGGTTGTGGG - Intergenic
1139316817 16:66079297-66079319 TAGGAAAAACTGCTTGATGTTGG - Intergenic
1140817652 16:78635788-78635810 TTGGAAAAACAGCTAGTGGAAGG + Intronic
1141044695 16:80705534-80705556 TAGGAAGAACAGATTCTGCCAGG - Intronic
1143157934 17:4850526-4850548 TAGGAAGAACAGGTAGAGGGCGG - Intronic
1144647330 17:16984274-16984296 TAAGAAGAGCAGATTGGGGTGGG + Intergenic
1149630515 17:58118185-58118207 TAGGTATAAAGGCTTGTGGTAGG + Intergenic
1152600840 17:81261343-81261365 TGGGGAGAGCAGCTTGTGCTGGG - Intronic
1154013316 18:10594187-10594209 TAGGAAGAAGGGCTTTTGGGAGG + Intergenic
1154152489 18:11917450-11917472 TAGGAAGAAGGGCTTTTGGGAGG + Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1158391203 18:57046639-57046661 AAGGAAGGGCAGCTTGTGCTAGG + Intergenic
1159238032 18:65702929-65702951 GAGTAAGAACAGCTTTTGGATGG - Intergenic
1162288051 19:9755217-9755239 TAGTAAGAACAGCATGTGGGAGG - Intronic
1166154785 19:40902812-40902834 TAGGAAAAAGAGGCTGTGGTAGG + Intergenic
1166211076 19:41306811-41306833 TAGGAAGAACAGGAGGTGGAAGG - Exonic
925232986 2:2252412-2252434 TAGGAAGAACAGCTTGTGGTGGG - Intronic
925795226 2:7534029-7534051 TTTGAAGAACAGGTTGTGTTTGG + Intergenic
928048239 2:27961068-27961090 TAGGAGTAACAACTTGTGGTTGG + Intronic
929453754 2:42052450-42052472 TAGAAAAAACAGATTGTGGCCGG + Intronic
929523217 2:42674446-42674468 CAGAGAGAACAGCTTGTGCTGGG + Intronic
931291751 2:60880378-60880400 TGGAAAGAACAGTTTGGGGTTGG + Intergenic
932641439 2:73451217-73451239 TAGGAAGTAGAGGTTATGGTTGG - Exonic
932837935 2:75054766-75054788 TAGGAAGAACAGCTAATGTTTGG + Intronic
932902776 2:75718266-75718288 TTGCATGAATAGCTTGTGGTTGG - Intergenic
934060485 2:88287787-88287809 TAGCAAGAACAGCTGGAGGAAGG - Intergenic
935480096 2:103576111-103576133 TTGGAAGAACAGGTGGTGTTTGG - Intergenic
935654902 2:105413774-105413796 GAAGAAAAACAGCTTGGGGTTGG - Intronic
937416904 2:121722239-121722261 TTGGAAGCACAGTTTGAGGTTGG + Intergenic
938586543 2:132696224-132696246 TAAGCAGTACAGATTGTGGTTGG + Intronic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
938957045 2:136308374-136308396 TAGGAGGGACAGTTTGTGTTAGG + Intergenic
939019060 2:136937330-136937352 TAGGTAGAACAGCGGGTGGCGGG - Intronic
940254553 2:151714932-151714954 TAGGGAGAAATGCTTGTGATTGG - Intronic
940342350 2:152594719-152594741 TGGGCAGAACAGTTTGGGGTAGG - Intronic
940491743 2:154370622-154370644 AAGGAAGAACATTTTGGGGTTGG + Intronic
942849372 2:180465711-180465733 CAAGAAGAAGAGGTTGTGGTAGG + Intergenic
944259324 2:197658700-197658722 GAGAAAGAACTGCTGGTGGTTGG - Intronic
945142842 2:206705479-206705501 TAGGAAGAAGATCATGAGGTTGG + Intronic
947021546 2:225683012-225683034 TAGGAAGAACAGAATGGGGGGGG - Intergenic
947135065 2:226969090-226969112 TGGGAAGAGTAGCTTCTGGTTGG - Intronic
948883818 2:240873275-240873297 CAGGAGGGACAGCTTCTGGTGGG + Intronic
1170855686 20:20052147-20052169 GAGGAAGGGCAGCTGGTGGTGGG - Intronic
1171152002 20:22835486-22835508 GAGGAAGAGCAGCTTGAGCTAGG + Intergenic
1171349622 20:24492588-24492610 TAAGAAGAGCAGCTTCAGGTGGG + Intronic
1172180486 20:33000550-33000572 CAGGAAGAACAGCATGTGCTGGG + Intronic
1172947047 20:38697595-38697617 TCGGAAGAACAGATTCTGCTCGG - Intergenic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1173668629 20:44781738-44781760 GAGGAAAAACAGCTTTTTGTGGG - Intronic
1181726988 22:24818315-24818337 TAGGAGGAAGAGCTTCTGGGAGG - Intronic
1182371925 22:29817293-29817315 TAGGAAGAACAGAGTTTGGTGGG - Intronic
1183973861 22:41498703-41498725 TAAGAAGAACAGCTTCTGCCTGG - Intronic
949254651 3:2031085-2031107 TAGGATGAGGAGCTGGTGGTAGG + Intergenic
949690056 3:6626208-6626230 CAGGAAGCAGAGGTTGTGGTGGG + Intergenic
949722123 3:7001548-7001570 TATGAAGAACAGCTTGTTTCAGG + Intronic
950512261 3:13437990-13438012 TAGGAAAAATACCTTGTGGCTGG + Intergenic
953549224 3:43887845-43887867 GAGGAAGGACAGCTTCTGGAAGG - Intergenic
954715991 3:52527259-52527281 TGGGGAGAGCAGCATGTGGTGGG - Intronic
954750601 3:52811327-52811349 GAGCAAGAACAGCAGGTGGTGGG - Intergenic
955919144 3:63936701-63936723 TAGGAGGAACTGCCTGTGATAGG + Intronic
958664093 3:97111504-97111526 AAGGAAAAACAGCTTCTGGGTGG + Intronic
959659450 3:108849845-108849867 GAGGTTGAACAGATTGTGGTAGG - Intronic
960611991 3:119563095-119563117 TAGGAGGAAGAGTGTGTGGTGGG - Intergenic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
963157205 3:142111632-142111654 AAGGAAGAAAAGCATGTGGGAGG + Intronic
964040263 3:152252935-152252957 TAGGAAGAGAAATTTGTGGTTGG + Intronic
966871180 3:184291405-184291427 CACGAAGAAGAGCTGGTGGTTGG - Exonic
969725568 4:8916198-8916220 TGGGAAGAGCAGCTTCTGGGGGG + Intergenic
971300489 4:25438136-25438158 TAGCAGGAACAGCATGTGGCTGG - Intergenic
971532213 4:27703405-27703427 AAGGAAGAACAGTTTGCAGTGGG - Intergenic
972733390 4:41816836-41816858 TAGGCAGCACCGCTTGTGTTGGG + Intergenic
974255830 4:59453042-59453064 TAGAAAGGACAGATTGTGTTAGG + Intergenic
976174978 4:82342745-82342767 TAAGAGGAACAGCTTGCTGTGGG + Intergenic
977405408 4:96591423-96591445 TAGGAAGCACAGCTATTTGTAGG - Intergenic
977535834 4:98256224-98256246 TATGAAGAACAGATTGTGAGGGG - Intergenic
979514120 4:121587376-121587398 TTGGAATAACAACTTTTGGTGGG - Intergenic
980577128 4:134698204-134698226 TAGAAAGCAAAACTTGTGGTGGG + Intergenic
980907074 4:138958661-138958683 TAGGAAGATCAGTTTGAGGGTGG + Intergenic
981210548 4:142098728-142098750 TAGGAAGAACAGCTTTTTTAAGG + Intronic
981771434 4:148313863-148313885 TAGCAAGAAAAGCTTGCTGTGGG - Intronic
986094476 5:4541070-4541092 GAGGAAGAACAGCATGTAGAAGG - Intergenic
988350154 5:30094090-30094112 TAGGAAAAAATGCTTATGGTTGG - Intergenic
989552875 5:42756713-42756735 TGGTAAGAACTGCTGGTGGTAGG + Intergenic
990275560 5:54192298-54192320 TAGTTAGAACATGTTGTGGTGGG - Intronic
990889210 5:60630932-60630954 TACAAAGAACATTTTGTGGTGGG + Intronic
992466603 5:77012274-77012296 TTGAAAATACAGCTTGTGGTGGG - Intergenic
992961468 5:81960145-81960167 TTGGAAGAACAGGTGGTGTTTGG + Intergenic
993706518 5:91177825-91177847 TGGGAAGAATAGCTTTGGGTGGG - Intergenic
994205055 5:97025190-97025212 CAGGAAGAACAGGCAGTGGTGGG + Intronic
994894296 5:105682348-105682370 TAGTAAGAATAGCTTGTTGGTGG + Intergenic
995840798 5:116441514-116441536 TAGGAAGCCCAGCTTGTGAAGGG + Intergenic
996417806 5:123228876-123228898 TAGGAAGAAAAGCATCTGGAAGG + Intergenic
997524050 5:134541191-134541213 TGGGAGGAAAAGCTTGTGCTGGG - Intronic
1000415056 5:160975759-160975781 CAGGAAGAAGAGCTTGTGGGAGG - Intergenic
1005987352 6:30883395-30883417 GGGACAGAACAGCTTGTGGTGGG - Intronic
1006456544 6:34135105-34135127 TTGGAAGAGGAGCTTGTGTTGGG + Intronic
1007299898 6:40859650-40859672 TAGAAGGAAAAGCTGGTGGTGGG - Intergenic
1007944661 6:45815143-45815165 TAGAAAAAATAACTTGTGGTGGG + Intergenic
1008310969 6:49973161-49973183 AAGGAATAACAGCTAGTGTTTGG - Intergenic
1009906526 6:69875707-69875729 TGAGAAGAACAATTTGTGGTTGG + Intronic
1010166911 6:72925748-72925770 TAGAAAGAACAACTTGTGTGAGG + Intronic
1010781988 6:79954262-79954284 AAAGAAGAACAGATTGTGGGAGG - Intergenic
1011048265 6:83111622-83111644 AACGATGAACATCTTGTGGTTGG + Intronic
1011070681 6:83378813-83378835 TAGGAAGAATTCCTTGTGGTTGG - Intronic
1012526175 6:100180672-100180694 TTGGAATAACAGCCTATGGTAGG - Intergenic
1013737975 6:113249209-113249231 GAGGAAGCACAACTTGGGGTGGG - Intergenic
1014719913 6:124903797-124903819 TAGAGAGAACAGCTTTTTGTTGG - Intergenic
1020055458 7:5114786-5114808 TAGAAATAACAGCTTGAGCTTGG + Intergenic
1020250711 7:6466210-6466232 CAGGAAGAACAGGTAGTGGGTGG + Exonic
1020377199 7:7501656-7501678 TAGGAAGAATGGCTTATGATTGG - Intronic
1020541878 7:9469045-9469067 TAGGTTGAATAGGTTGTGGTGGG - Intergenic
1020673345 7:11147815-11147837 TTGGAAGAAGAGTTTGTGGATGG - Intronic
1021525780 7:21585875-21585897 TAGAAAGAGAAGCATGTGGTGGG + Intronic
1024353751 7:48394003-48394025 TGGGGAGAACAGCTGGGGGTTGG - Intronic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1025923501 7:65937326-65937348 CAGGAAGAGCAGCTTGTAGTGGG + Intronic
1031136207 7:117886839-117886861 TTGGAAGAACAGGTGGTGTTTGG - Intergenic
1032541298 7:132705340-132705362 TAGGAAGTGCACTTTGTGGTTGG - Intronic
1037297762 8:17419167-17419189 TTGGAAGAACTGCATCTGGTGGG - Intergenic
1039109220 8:34023067-34023089 GCGGACGAACAGCCTGTGGTGGG + Intergenic
1039374438 8:37019115-37019137 GAGGAAGAATAGCTGATGGTTGG + Intergenic
1039950166 8:42164700-42164722 TAGGGAGAACAGTTTCTGATAGG + Intronic
1041045729 8:53884037-53884059 TAGTAATAACAGCTTTTGCTTGG - Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1043023980 8:75044041-75044063 TATGAAGAACAGCTGGGGATAGG + Intergenic
1043752515 8:83956889-83956911 TAGGCAGACAAGATTGTGGTGGG + Intergenic
1045924784 8:107571334-107571356 TAGGAAGAACATCACGGGGTGGG - Intergenic
1047219680 8:122909607-122909629 CAGGAGGAACAGGTTGTGGGGGG - Intronic
1049205621 8:141362170-141362192 GAGCAGGAACAGCTTGGGGTTGG - Intronic
1049499952 8:142956898-142956920 TACGAAGAACAGCTTTTCCTGGG - Intergenic
1050150973 9:2619252-2619274 TAGGAAGCTCAGCATCTGGTAGG - Intergenic
1050434031 9:5590510-5590532 CAGGAACAACAGTTTGTGGATGG + Intergenic
1052450099 9:28618204-28618226 AAGGAAGACCAGGTTGGGGTTGG - Intronic
1053618383 9:39792480-39792502 TGGCAGGAACAGCTTGTGGATGG - Intergenic
1057324075 9:94044419-94044441 CAGGAAGAACAGCTAATGCTGGG - Intronic
1059289845 9:113212966-113212988 AAGGAAGAACAGGTTTTGCTGGG - Intronic
1059469544 9:114494256-114494278 CAGGAAGAGCAGCATCTGGTAGG + Intronic
1061380390 9:130253138-130253160 TAGGAGGAACGACTTGGGGTGGG + Intergenic
1185940668 X:4315495-4315517 TAGGAACATCAGCTTGTGCTGGG - Intergenic
1186113343 X:6278528-6278550 CACGAAGACCTGCTTGTGGTTGG - Intergenic
1186156910 X:6735035-6735057 GATGTAGAACAGATTGTGGTTGG - Intergenic
1187728383 X:22227577-22227599 CAGGAAGAAGAGCTGGTTGTTGG - Exonic
1188521761 X:31045693-31045715 TAGGAAAAAAAGCTGTTGGTGGG - Intergenic
1192069036 X:67917938-67917960 TATGGAGAAGAGCTGGTGGTGGG + Intergenic
1192948000 X:75986388-75986410 CAGGAAGAAAAGCTCTTGGTAGG + Intergenic
1195044191 X:101041312-101041334 TATGAAGAACAGCTCAAGGTAGG - Exonic
1195905437 X:109840067-109840089 TATGAAGAACAGCGGGTGGGAGG + Intergenic
1197547273 X:127840356-127840378 TAGGAAGGACAGTTGGTGGAGGG + Intergenic
1199229054 X:145413846-145413868 TAATAGGAACAGCTTGTGGAAGG - Intergenic
1200560681 Y:4698775-4698797 CAGGAAAAACAGCTTTTGATAGG - Intergenic
1201483607 Y:14468535-14468557 CATGAAGACCTGCTTGTGGTTGG + Intergenic