ID: 925234902

View in Genome Browser
Species Human (GRCh38)
Location 2:2269537-2269559
Sequence AATGCAAGGCAGAAGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925234902 Original CRISPR AATGCAAGGCAGAAGTAGGA TGG (reversed) Intronic
900315058 1:2052268-2052290 AAAGCAAGGCAGAGGGAGGACGG - Intronic
901679763 1:10906235-10906257 AAACCAAGGCAGAAGGAGGTGGG + Intergenic
903106999 1:21089864-21089886 AATGGCAGGCAGAATTAGGAAGG - Intronic
903359648 1:22768868-22768890 ACAGCAAGGCAAAAGGAGGAGGG - Intronic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
907099135 1:51811985-51812007 AATACAAGCCAGAAGTAAGGAGG - Exonic
907698987 1:56765102-56765124 ACTGCTGGGCAGAAGTAGGAAGG + Intronic
908716173 1:67072045-67072067 ATTGCAAGCCAGAAGGAGGGGGG - Intergenic
909894270 1:81046847-81046869 AATGCAAAGAAGAAGCGGGAGGG + Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
913945941 1:125165531-125165553 AATCAAAGGCAGAAATAGAATGG - Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914510213 1:148325581-148325603 ACTGCAGGGCAAAAGAAGGAAGG + Intergenic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
918897960 1:190372206-190372228 AATGCAAGGCAACAGAATGAAGG - Intronic
920435868 1:205946734-205946756 ACTCCCAGGAAGAAGTAGGATGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920616040 1:207493736-207493758 AATGTCAGGCAGAAGTATAATGG + Intergenic
921559377 1:216639131-216639153 AATGGGAGGCAGGAGTAGGGAGG + Intronic
922323291 1:224506395-224506417 AAGCCAAGGCTGAAGGAGGAAGG - Intronic
922537362 1:226391107-226391129 CAGGCAAGGCCGAGGTAGGAGGG - Intronic
922555555 1:226529710-226529732 GATGAGTGGCAGAAGTAGGATGG + Intergenic
923487405 1:234447202-234447224 AATGCCAGGCACCAGCAGGAAGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
1064426594 10:15234987-15235009 ACTGCCAGGCAGAAAAAGGAGGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065870551 10:29952688-29952710 ATGGCAAGGCAGGAGCAGGAGGG + Intergenic
1066084841 10:31966051-31966073 ATGGCAAGGAAGAAGAAGGATGG + Intergenic
1067741090 10:48896687-48896709 AATGCAAACCAGAGTTAGGAGGG - Intronic
1067894148 10:50161604-50161626 AGTGAAAAACAGAAGTAGGATGG - Intergenic
1067923437 10:50482876-50482898 AATGGAAGGCAGAAAAAGGCAGG + Intronic
1067954697 10:50778657-50778679 AGTGAAAAACAGAAGTAGGATGG + Intronic
1072332183 10:94364555-94364577 AGAGCAAGGAAGAAGTTGGAAGG - Intergenic
1073190561 10:101647782-101647804 AATGAAAGCCTGAAGTAAGATGG - Intronic
1073470962 10:103721795-103721817 AAGGCAAGGATGAAGAAGGAAGG + Intronic
1074398019 10:113115639-113115661 AATGGAAGGCTGAAGTAGAAGGG + Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075663187 10:124212470-124212492 AAAGAAAGGCAGAGGAAGGAAGG - Intergenic
1075863497 10:125697573-125697595 AAAGCAAGAAAGAAGAAGGAAGG + Intergenic
1078032163 11:7763926-7763948 AAAGCAGGGCAGAAGGGGGAAGG + Intergenic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1080249707 11:30219231-30219253 ACTGGAAGGAAGAAGAAGGAAGG + Intergenic
1080365576 11:31570346-31570368 AATACAAGGCAGGAGAGGGAAGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080457856 11:32431729-32431751 GATGCAAGGCTTAAGGAGGAGGG - Intronic
1080718888 11:34830303-34830325 AATGTAAGGCAGAAGCTGGGGGG + Intergenic
1081083585 11:38772772-38772794 CATGTAAGGCAGTAGTAAGAGGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1085930661 11:81079092-81079114 GATAAATGGCAGAAGTAGGATGG - Intergenic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086934557 11:92730492-92730514 AATCCAAGGCTGATGTAGCAAGG + Intronic
1087878936 11:103392214-103392236 ACTGCAAGGCAGCAGGAGGCTGG - Intronic
1088827541 11:113508239-113508261 AAAGCAAGGAAGGAGTAAGATGG + Intergenic
1089660661 11:119983105-119983127 AATGCAAGCCAGGAACAGGAGGG - Intergenic
1092225906 12:6748271-6748293 AATGCATGGCAGGAGTAGGATGG + Exonic
1093167923 12:15826828-15826850 AATGCAAGCCAAAATTGGGAAGG - Intronic
1093416995 12:18931084-18931106 GAAGCCAGGCAAAAGTAGGATGG - Intergenic
1093673928 12:21911779-21911801 TATGCAAGGGAGAAGGATGATGG + Intronic
1094757455 12:33489187-33489209 AATACAGGGCAGAATTTGGATGG + Intergenic
1094771721 12:33670541-33670563 AATGCAGAGCAGAAGTACAAGGG + Intergenic
1095126416 12:38483573-38483595 AATGCCAGCCAGAAGCAAGAAGG + Intergenic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1095872249 12:47042143-47042165 AATCCAAGGAAGAAGGGGGAAGG - Intergenic
1096539785 12:52300476-52300498 ACTCTAAGGCAGTAGTAGGAGGG + Intronic
1097599579 12:61673999-61674021 AATGGAGGGCTGAAGGAGGAAGG + Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1099877168 12:88421679-88421701 TATGCATGGCAACAGTAGGATGG + Intergenic
1100492238 12:95092473-95092495 AATGTAACTCTGAAGTAGGAGGG + Intronic
1100909341 12:99339756-99339778 GGGGCAAGGCAGAAGTAGGGAGG - Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1104044048 12:125149235-125149257 AAAGAAAGAAAGAAGTAGGAGGG - Intergenic
1104834838 12:131782340-131782362 AATGCAAGTTAGAAATGGGAGGG + Intronic
1106323839 13:28668962-28668984 AATCCAAAGCACAGGTAGGAGGG - Intronic
1106673810 13:31935684-31935706 AATGGAAGGCAGAAGCAAAAAGG + Intergenic
1108741470 13:53343182-53343204 AATGGATGGCAAAAGCAGGATGG + Intergenic
1109045843 13:57409660-57409682 AATGAAAGGGACAAGTGGGAAGG + Intergenic
1109143194 13:58743048-58743070 AAGGCTAGGCAGGTGTAGGAAGG - Intergenic
1111297249 13:86296381-86296403 AAGGCAAGGAAGAAGTTGGTTGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111727964 13:92036952-92036974 AAGGTAAGGAAGGAGTAGGAAGG - Intronic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1114858445 14:26483844-26483866 AATGTAAGGCAGAATTTGGTTGG + Intronic
1116693562 14:48142730-48142752 AATGGATGGCAGAAGCTGGAAGG - Intergenic
1118195203 14:63619063-63619085 AAGGCTTGGCAGAAGTAGGGAGG - Intronic
1118416696 14:65545148-65545170 AATGTAAGAAAGAAGTAGAAAGG - Intronic
1118896373 14:69949185-69949207 CGTGCAATGCAGAAGTGGGATGG + Intronic
1119913560 14:78373702-78373724 AATGCAAGGCAGAAAGGGAATGG + Intronic
1121658045 14:95612767-95612789 AATGGAAGGAAGAAGAAAGAAGG + Intergenic
1121780203 14:96617435-96617457 AATGTGAGGCAAAAGAAGGAAGG + Intergenic
1122865899 14:104603846-104603868 AATGCAGGCCAGGAGGAGGAAGG + Intronic
1124353357 15:28976780-28976802 AATGAAAGGCAGAATAAGAAAGG - Intronic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125489668 15:40137175-40137197 AATGCCTGGAAGAAGTGGGAGGG + Intergenic
1127612888 15:60654435-60654457 ATAGCAAGGGAGAAGTGGGATGG - Intronic
1129180209 15:73869463-73869485 AAAGCTAGGCAGAGCTAGGAAGG + Intergenic
1130365650 15:83235954-83235976 AAAACAAGGGAGAAGTAGGGAGG - Intergenic
1131328697 15:91474326-91474348 ACAGAAAGGCAGAAGAAGGAAGG - Intergenic
1132160462 15:99536795-99536817 TATTCAAGGCAGAAATGGGAAGG - Intergenic
1134349476 16:13423285-13423307 AATACAAGGCAGATGTCAGATGG - Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1138140529 16:54564577-54564599 AATGCAAGGCACAGTTGGGAGGG - Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139962795 16:70727677-70727699 AGTGCAATGGAGAAGCAGGAGGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140188052 16:72791979-72792001 AAGGCAAGGTAGCATTAGGAGGG + Intronic
1141119591 16:81341951-81341973 AATGGAAAGCAGAAGAAGCAGGG + Intronic
1142520103 17:498547-498569 AAGGCAAGGCAGAGGAGGGAGGG + Intergenic
1143131661 17:4682214-4682236 AAGGCAAGGCAGAAAAAGGAAGG + Intronic
1143137660 17:4720704-4720726 AAAGCAAGGAAGAGGTATGAGGG - Intronic
1143974235 17:10818384-10818406 AATGAAAGACAGAGGCAGGAGGG + Intergenic
1145830595 17:27913210-27913232 AATGTGAGGCAGCAGTAGGAGGG - Intergenic
1146287732 17:31585531-31585553 AATGCAACCCAGAAGTGGGGTGG + Intergenic
1146833781 17:36093373-36093395 AATATAAGGGAGATGTAGGACGG + Intergenic
1146848373 17:36200215-36200237 AATGTAAGGGAGATGTAGGACGG + Intronic
1147123499 17:38350603-38350625 GATGCAAGGGAAAAGGAGGAAGG - Intergenic
1147799169 17:43070445-43070467 ATTGCAGGGCAGAAGTGGCAGGG + Intronic
1149413966 17:56438956-56438978 AATGCAAAAGAGAAGTAGAAAGG + Intronic
1149954357 17:61031406-61031428 AAAGCTTGGCAGAAGTAGAAGGG - Intronic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152995465 18:402351-402373 AATGCCACGCAGAAAAAGGAGGG + Intronic
1153018209 18:603373-603395 AAAACAGGGCAGAAGTAGGGAGG + Intronic
1153578792 18:6550371-6550393 AATGCAAGCCTGAAGGAGGCTGG - Intronic
1153645644 18:7193800-7193822 AATGCAAGGCTGAAGTTAGGCGG + Intergenic
1155933007 18:31726102-31726124 TATGCAAGGGAGCAGCAGGAGGG - Intergenic
1155972993 18:32099244-32099266 AAAACAAAGCAGAAGTAGGAAGG - Intronic
1156611935 18:38735081-38735103 AAAGCAAGGCTGAAGTGGAAAGG - Intergenic
1157604849 18:48919633-48919655 AATTCAAGACACAAGAAGGAGGG + Intergenic
1158175808 18:54654606-54654628 AATACAAGCAGGAAGTAGGAAGG - Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1160470584 18:79129214-79129236 AATGCCAGGCAGAAGAAGCTAGG + Intronic
1162126328 19:8501410-8501432 AATGCAGGGCAGTAGTGGGATGG - Intronic
1162201305 19:9022557-9022579 AAAGCAGGTCAGAAGAAGGAAGG - Intergenic
1164783236 19:30910160-30910182 AAGGCAAGGAATAAGAAGGATGG + Intergenic
1165133971 19:33653582-33653604 AATGCAAGTCACATGTATGAAGG + Intronic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925542636 2:4982167-4982189 CATGCTTGACAGAAGTAGGAAGG - Intergenic
926604768 2:14886428-14886450 TATGCAAGGCAGATGAGGGAAGG - Intergenic
927228871 2:20799991-20800013 ATTGCAAGGCAGTAGGAGAAAGG + Intronic
928854274 2:35785368-35785390 AATGCAAGTTAGAAGGAAGAAGG - Intergenic
930425222 2:51204564-51204586 AATGCAAGACTGAATCAGGAAGG - Intergenic
930743365 2:54856616-54856638 GATGCAGTGCAGAAGCAGGAAGG + Intronic
930853915 2:55991959-55991981 AATTCAAGGCTGAAGTTTGAGGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
932198115 2:69801760-69801782 CTTGCAAAGCAGAAGTAGGCTGG + Intronic
932946566 2:76239475-76239497 AAAGCAAGCCAGAAGAAGAAAGG - Intergenic
933014268 2:77104431-77104453 AATACAAGGCAGAAATTTGAAGG + Intronic
933534561 2:83556128-83556150 AATGGAAAGCAGAAGTAAGCAGG - Intergenic
934115066 2:88781049-88781071 AATGGAAAGCAGAAGTTAGAAGG + Intergenic
934662796 2:96152247-96152269 AATGCAAGGCCACAGAAGGATGG + Intergenic
934993090 2:98935299-98935321 AATGCAAGTCAGAAGCAGTGCGG - Intronic
936233519 2:110724754-110724776 AATGAAAGAAAGAAGAAGGAAGG + Intergenic
936607697 2:113974692-113974714 AAAGGAAGGCTGAAGTTGGAAGG - Intergenic
938695606 2:133832722-133832744 TATGTAAGGCAGAAGCAAGATGG - Intergenic
939181201 2:138804288-138804310 ATTGCAAGGCAGAAGGAGTTTGG + Intergenic
939297814 2:140292463-140292485 TATGCAAAGCGGAAGTAGCAAGG - Intronic
941837900 2:170046370-170046392 AATGCAAGGAGGTAGGAGGAGGG - Intronic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
942572138 2:177325301-177325323 AATCAAAGTCAGAGGTAGGAGGG + Intronic
943501379 2:188693553-188693575 AAACCAAGGCAGAAGTCGAAGGG + Intergenic
943971844 2:194419794-194419816 CATCAAGGGCAGAAGTAGGAAGG + Intergenic
945614746 2:212053681-212053703 AATGCAAGACATAAGCTGGAAGG - Intronic
946247216 2:218394723-218394745 GCTGCAAGGCCGAAGTAGGCAGG - Exonic
947984416 2:234436678-234436700 TATGCAAGGGAGAAGGAGCAGGG - Intergenic
948075471 2:235162331-235162353 ACTGCCAGGCAGAAAAAGGAGGG + Intergenic
1168955303 20:1830303-1830325 AATGCAAGGCACAAGGAGCCTGG + Intergenic
1170322004 20:15110474-15110496 GATGAAAGACAGAAGCAGGAAGG + Intronic
1170409531 20:16073736-16073758 CATTCAAGGCAGATGTAGAATGG + Intergenic
1170764887 20:19281369-19281391 AAACCAAGGCAGGAGCAGGATGG + Intronic
1171240546 20:23564094-23564116 GATGCATGGGAGAGGTAGGAAGG - Intergenic
1172867590 20:38112109-38112131 AAAGAAAGGCAGAGGAAGGAAGG - Intronic
1173102898 20:40104196-40104218 AATGGAAGGAAGAAGGAGGTGGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173337869 20:42127438-42127460 AATGCAAGGCAGAACAGGGAAGG + Intronic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1174018216 20:47506428-47506450 AATACACAGCAGGAGTAGGATGG + Intronic
1174199278 20:48795686-48795708 AATGGTAGGCAGAAGTCAGAAGG + Intronic
1175121384 20:56718601-56718623 AATGCAAGAAAGAAAAAGGAAGG + Intergenic
1175142168 20:56869018-56869040 AATGCCAAGCAGAACCAGGAAGG + Intergenic
1175958035 20:62621349-62621371 AATGCCAGGGGGTAGTAGGAGGG - Intergenic
1176123687 20:63465651-63465673 GATGCAAGGTCGAAGGAGGAGGG - Intronic
1176525768 21:7916897-7916919 AATACAATGCAGAAATAGAATGG - Intergenic
1177385352 21:20403167-20403189 AATGCCAGACAGAGGTAAGATGG + Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1179638904 21:42734021-42734043 AAGGCAACGGAGAAGCAGGAGGG - Intronic
1180989303 22:19924939-19924961 AATGCAAGCCAGAAGTCAGAGGG + Intronic
1181260423 22:21593395-21593417 AATGGAAGGCACAGGTTGGAGGG - Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181638440 22:24184927-24184949 TACGCAGGGCAGAAGTAAGAAGG + Exonic
1182649581 22:31840278-31840300 AATGGAGGGCAGGAGTAGAAGGG + Intronic
1183639900 22:39086573-39086595 AATGGAAGCCTGGAGTAGGATGG + Intronic
1184017018 22:41793975-41793997 AATGGAAGGCTGGAGCAGGAGGG - Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
949474509 3:4430844-4430866 AAGGCAGGGCAGGAGTGGGAAGG + Intronic
949477959 3:4466888-4466910 AAAGCAAGGCACTAGTAGGAAGG - Intronic
950604536 3:14066052-14066074 AATGCAAGAGAGAAGCTGGAAGG - Intronic
952502785 3:33979496-33979518 AAAGCTAGGCACAAGTTGGATGG - Intergenic
952593047 3:34980498-34980520 AATCCAAGGCATATGTAGGCCGG + Intergenic
953402793 3:42640993-42641015 ACTCCAAGGCAGAGGTGGGAAGG - Intronic
954907630 3:54076397-54076419 TATGCAAGGCAGAGGCAAGAGGG - Intergenic
955250039 3:57272159-57272181 AATGCATTGTAGAAGTAGGCAGG - Exonic
955557302 3:60151710-60151732 AATTGCAGGCAGAGGTAGGAAGG - Intronic
956502009 3:69897041-69897063 AATGCAAGGTAGCAGAAGGTAGG + Intronic
956607803 3:71090651-71090673 AGTGCAGGGAAGAACTAGGAGGG + Intronic
956933699 3:74075674-74075696 AATGCAAGTGAGATGGAGGAAGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
957891038 3:86359222-86359244 AATGCAAGACTGAATTAGTAAGG - Intergenic
957894273 3:86400816-86400838 AATGCAAGGTAGAATAAGTAAGG + Intergenic
958810916 3:98859152-98859174 ACTGCAAGGCAGCAGGAGGCTGG + Intronic
958860451 3:99438893-99438915 AATTTAAAGCAGAAGAAGGAAGG + Intergenic
960480282 3:118179633-118179655 AATGAAAAGGAGAAGTAGCATGG - Intergenic
960593362 3:119386721-119386743 GATACAAGGCAGAAGGAGCAGGG + Intronic
961077534 3:123995818-123995840 AAAGCAAGGGAGGAGTTGGAAGG - Intergenic
961307049 3:125965467-125965489 AAAGCAAGGGAGGAGTTGGAAGG + Intergenic
961457260 3:127030415-127030437 AATGCAGGGCAGGGGGAGGAGGG + Intronic
962543194 3:136404200-136404222 AATCCAAGGCAGAAAGAGTATGG - Intronic
963900204 3:150726347-150726369 GATGCTAGGCAGAAGTAGTGAGG + Intergenic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
965224016 3:165964673-165964695 AATGCAGAGCAGCTGTAGGAGGG + Intergenic
965612459 3:170558558-170558580 ACAGCAAGTCAGAAGTAGAATGG - Intronic
965843596 3:172936431-172936453 AATGCATGACAGAAGAGGGAGGG - Intronic
966729035 3:183135139-183135161 AACTCAAGGCAGAAGTTAGAGGG + Intronic
968967947 4:3778822-3778844 AAATCAAGGCAGAAGAAGGAGGG - Intergenic
969501008 4:7552946-7552968 AGAGGAAGGCAGAACTAGGAAGG + Intronic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971990274 4:33883413-33883435 AATGAAAGGAAAAAGAAGGAAGG - Intergenic
972177283 4:36423335-36423357 AATGCTAGGAAGAAGCAAGAAGG - Intergenic
972415619 4:38837337-38837359 ACTGCAAAGCAAAAGTAGCATGG + Intronic
973348606 4:49083338-49083360 AATGGAAGGCAATAGTGGGAAGG + Intergenic
973769728 4:54195417-54195439 AGTGGAAGGCAGATGAAGGAGGG + Intronic
973897738 4:55432288-55432310 AATGCAAGTGAGAACTAGAAGGG - Exonic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974425038 4:61731628-61731650 TCTCCAAGGCAGAAGTGGGAAGG - Intronic
975635889 4:76447710-76447732 AGTGTAAGGCAGCAGGAGGAAGG + Intronic
975964103 4:79948746-79948768 AATGCAAAGAAGGAGAAGGAAGG + Intronic
976357544 4:84136838-84136860 CAAGCAAGGCTGAAGTAGTAAGG - Intergenic
976990659 4:91360865-91360887 AATGCAAATCAGTAATAGGATGG + Intronic
977299923 4:95256031-95256053 AAAGCAAGTCAGGAGGAGGAAGG - Intronic
977448148 4:97158250-97158272 AAAAAATGGCAGAAGTAGGAAGG - Intergenic
977533457 4:98227684-98227706 AATACAACTCAGCAGTAGGATGG + Intergenic
979088689 4:116450026-116450048 AATGCAATTCAGGAGTCGGAGGG + Intergenic
979631057 4:122903677-122903699 ACTGCAAGGCTGGAGGAGGAAGG + Intronic
979667291 4:123326318-123326340 AATTCAAGGATGGAGTAGGAAGG + Intergenic
979937078 4:126711205-126711227 AATGGAAAGGAGAGGTAGGATGG + Intergenic
980421203 4:132563857-132563879 AATTTAAGGCAGAAGTAAAAAGG + Intergenic
980505773 4:133718817-133718839 AATGCAAGGCATATGTATGATGG + Intergenic
980636865 4:135517460-135517482 AAAGCAAGGAAGAGGCAGGAAGG + Intergenic
981004956 4:139865419-139865441 TATGAAAGGCAAAAGAAGGATGG - Intronic
981227886 4:142318269-142318291 AGTGGAAGGCAGAGGAAGGAAGG + Intronic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
981651916 4:147069903-147069925 ACTGCAAGGAAGAAGGAGCAGGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982133926 4:152256191-152256213 AATGCCAGGATGAAGTAGGAGGG - Intergenic
983297388 4:165883099-165883121 AATGGAACTCAGAAGTAGCATGG + Intronic
984042862 4:174758070-174758092 CACTCATGGCAGAAGTAGGAAGG - Intronic
985191270 4:187376036-187376058 TATGAAAGGCACAAGTAAGAAGG - Intergenic
985693412 5:1326111-1326133 AGTGGCAGGCAGAAGTAGGTGGG - Intronic
985709416 5:1419927-1419949 AACCCAAGGCAGAAGTGGGAAGG - Intronic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
987371481 5:17197413-17197435 AATGCAAGGCTGAAAAAGCAGGG - Intronic
988032094 5:25775997-25776019 AATGCAAATCAGAAGAAAGATGG + Intergenic
988331192 5:29842028-29842050 ACAAAAAGGCAGAAGTAGGAAGG + Intergenic
989263570 5:39446626-39446648 AAGGGAAGGAAGAAGTAGGCAGG + Intronic
990199000 5:53349987-53350009 AATGCCAGGAAGAAGTAAAAAGG + Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
991255060 5:64604332-64604354 AATGCCAGGCAGGAGAAGGGGGG - Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
992907060 5:81357019-81357041 AATGCAAGGTAGAGGGAGGCGGG - Intronic
994448187 5:99904630-99904652 AAGGCAAGAAAGAAGTAGGGAGG + Intergenic
996349371 5:122521590-122521612 TATAGAAGGCAGAAGAAGGAAGG - Intergenic
997379206 5:133423369-133423391 AGAGCAAGGCAGAGGGAGGATGG - Intronic
997974167 5:138429346-138429368 AATCCAAGGCAAATGTAGGCTGG - Intronic
999127754 5:149259014-149259036 AATCCAGGGCAGAAGGAGGAGGG - Exonic
999749928 5:154620255-154620277 AAAACAAGACAGAAGGAGGAAGG - Intergenic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1000586096 5:163100764-163100786 AAAGTAAAGCACAAGTAGGAAGG - Intergenic
1000840888 5:166216847-166216869 AATGCCAGCCAGAATTGGGAGGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1002661516 5:180793616-180793638 AATTCAAAGCAGAAGTGGAAAGG + Intronic
1002992686 6:2252471-2252493 AATGCATAGCAGAAGCAGCAGGG + Intergenic
1003711463 6:8596526-8596548 AATGCAAGTCAGAAAAAGGAGGG - Intergenic
1004515762 6:16321199-16321221 AATGCAACTCAAAAGAAGGATGG - Intronic
1007258061 6:40542361-40542383 AATGCTGGGCAGGAGGAGGAGGG + Intronic
1007303438 6:40886311-40886333 GATGCGAGGCAGAAGTATGGAGG + Intergenic
1008455268 6:51703543-51703565 ATTCCAAGCCAGAAGAAGGAGGG + Intronic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009420607 6:63460278-63460300 AATGAAGGTCAGAAGTAGAAGGG - Intergenic
1010076781 6:71807690-71807712 AAAGCAAGACAGAAATAGAATGG - Intergenic
1010703144 6:79077160-79077182 AGTGCAAGGCCGGAGGAGGAGGG - Intronic
1010799748 6:80161724-80161746 AATGAAAAGCTGATGTAGGATGG - Intronic
1010831519 6:80536309-80536331 AGTGCAAGGGAGAACAAGGAAGG + Intergenic
1010895398 6:81356954-81356976 AAAGGAAGGAAGAAGTAGAAGGG - Intergenic
1011150004 6:84260869-84260891 AAAGTAAGGCACAAGTAAGATGG + Intergenic
1012404461 6:98879302-98879324 AATGCAAGGCAGAAATGGAATGG + Intronic
1013280736 6:108634564-108634586 AAGCCAAGGCAGAAGGGGGAAGG - Intronic
1014151060 6:118055757-118055779 ACTGCAAGGAAGAAGTAGACAGG + Intronic
1015868379 6:137751073-137751095 AATGGAAGATAGAAGTAGGCTGG - Intergenic
1015922700 6:138281463-138281485 ACTGCAAGGCAGGAGAGGGAGGG - Intronic
1016121625 6:140349527-140349549 AAAAGAAGGTAGAAGTAGGATGG + Intergenic
1016168501 6:140977742-140977764 AAAGCAATGCAGGATTAGGAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017547326 6:155466586-155466608 AATGCAAGTCAAATGTAGTAAGG - Intergenic
1017579163 6:155841907-155841929 AAAGCAAGTCAGAGGGAGGAAGG + Intergenic
1017869766 6:158477271-158477293 TATGAAAAGCAGAACTAGGAGGG + Intronic
1018216403 6:161532121-161532143 AGTGCAAGACAGAGATAGGATGG - Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1019056548 6:169227644-169227666 AAGGCAAGGCAGAATAAGCATGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1022027086 7:26458854-26458876 AATGAAAGGAGGAAGCAGGAGGG + Intergenic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1024054335 7:45649987-45650009 GATGCTGGGCAGAAGCAGGAAGG + Intronic
1024184952 7:46940288-46940310 ACTGCAGGGCAGAAATAAGATGG - Intergenic
1024516395 7:50262614-50262636 AGTGGAAGGCAGAAGAAGAAGGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026598389 7:71753040-71753062 AAAGCAAGGGAGAAATGGGAGGG + Intergenic
1028759516 7:94480012-94480034 AGTGCAATGAAGAAGTAGAATGG - Intergenic
1029637466 7:101794510-101794532 AATGAAAAGCAGAAGCAGGTTGG + Intergenic
1030613865 7:111717384-111717406 AATGCAAGTAAGAGGTAAGAAGG - Intergenic
1031390367 7:121206060-121206082 ATTTCAAGGCAGAAGAAGGGAGG - Intronic
1032318014 7:130858472-130858494 ACTGCAATGCAGCAGTAAGAGGG + Intergenic
1035023379 7:155811517-155811539 AAGCCAGGGCAGAGGTAGGATGG + Intronic
1035456305 7:159011196-159011218 AATGCAGGGGAGGCGTAGGAGGG + Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1036672284 8:10799432-10799454 AGAGCCAGGCAGAAGAAGGATGG - Intronic
1038041019 8:23724306-23724328 TTTGCAAGGCTGAAGCAGGAGGG - Intergenic
1038419427 8:27422881-27422903 AATACGAGGCAGAATGAGGATGG + Intronic
1039218823 8:35305183-35305205 ACTCCAAGTGAGAAGTAGGATGG + Intronic
1039367046 8:36939787-36939809 ACTCCCAGGCAGAAGTAGGAGGG + Intergenic
1039918923 8:41879530-41879552 AATGCCAGAGAGATGTAGGAAGG + Intronic
1040505671 8:48045676-48045698 AGTGCCAGGCAGAGGTAGGAGGG + Intronic
1040678215 8:49777092-49777114 AATGCAAGCCAGACTTAGCAAGG - Intergenic
1041165670 8:55090140-55090162 AAACAAAGGCAGCAGTAGGAGGG - Intergenic
1044338083 8:91013328-91013350 AATGCAAGGTAGCTGTAGAAGGG + Intronic
1044635873 8:94323409-94323431 AATGGATGGCAGAAGCAGAATGG + Intergenic
1044894268 8:96873027-96873049 AGTGCAAGGAAGAAGGAAGATGG - Intronic
1045211569 8:100105565-100105587 AATTCAAGGTGGAAGTGGGAAGG + Intronic
1045700947 8:104865511-104865533 AATGGAAGTCAGGAGAAGGAGGG + Intronic
1047038674 8:120968580-120968602 AATACAAGGAATAAATAGGAAGG - Intergenic
1047148028 8:122227687-122227709 AATGGAAGCCAAAAGTAGGTAGG + Intergenic
1048172342 8:132119420-132119442 GATGGAAGGCAGAAGTCAGAAGG + Intergenic
1048330976 8:133470690-133470712 GAAGCAAGGCAGGAGAAGGAAGG + Intronic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1049297611 8:141851198-141851220 AATGCAAAACACAGGTAGGAGGG + Intergenic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1051331267 9:16027052-16027074 GATGCAGGGCAGAAGTAGTTTGG + Intronic
1051362358 9:16292452-16292474 AATTCAAGGCAGATTTTGGAGGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1054957587 9:70930162-70930184 AGTGGAAGGCAAAGGTAGGATGG + Intronic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055883726 9:81033826-81033848 AAAGCAAGGAAGAAACAGGAAGG + Intergenic
1056017957 9:82411177-82411199 AATGCAAGAGAGAAGGAGGGAGG - Intergenic
1057357859 9:94346536-94346558 AAGTAAAGTCAGAAGTAGGACGG + Intergenic
1057649890 9:96911073-96911095 AAGTAAAGTCAGAAGTAGGACGG - Intronic
1059245689 9:112848031-112848053 AAGGCAGGGCAGAAGCAGGGTGG + Intronic
1059451716 9:114375298-114375320 ATTGCACGGCAGAAGTAAGAAGG + Intronic
1059856970 9:118410080-118410102 AATACAAGACAGAAAGAGGAAGG + Intergenic
1060019117 9:120113798-120113820 AATGTAAGGAAGAACTAGGTAGG + Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1185714582 X:2330715-2330737 AGGGGAAGGAAGAAGTAGGAGGG + Intronic
1185943013 X:4342257-4342279 AATGCAAGACGGTAATAGGAAGG + Intergenic
1186969046 X:14820051-14820073 AATGTAAGGCTGGAGAAGGAAGG - Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1188537251 X:31211168-31211190 AATGCAAGGAGGCAGGAGGACGG + Intronic
1189745637 X:44166157-44166179 AGGGCAAGGCAGAAGTGGCAAGG + Intronic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190952013 X:55155385-55155407 AATGCAAGCCTGAATTAGGATGG + Intronic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192056759 X:67781264-67781286 AATTAAAGGCAGAGGTAGGAGGG + Intergenic
1192702958 X:73495859-73495881 AATGGAAAGCAGAAGAAGCAGGG - Intergenic
1193235729 X:79104891-79104913 AATGCAAGGCAAAAATAAGAAGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1196320364 X:114332935-114332957 AATGCAAAGCAGAACTACAATGG - Intergenic
1197700740 X:129597738-129597760 AAAGCAAGAAAGAAGAAGGAGGG + Intergenic
1199658615 X:150023356-150023378 AATGCAAGTCAGATTCAGGAAGG - Intergenic
1199680618 X:150221998-150222020 AAAGCAAGGAAGAAGTGGGAAGG - Intergenic
1201369013 Y:13240209-13240231 TATGCAAGCCAGAAGTAAGCAGG + Intergenic
1201588896 Y:15591871-15591893 AAAGGAAGGAAGAAGTAAGAGGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic