ID: 925235450

View in Genome Browser
Species Human (GRCh38)
Location 2:2273364-2273386
Sequence AGACCAATACAGAAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925235447_925235450 7 Left 925235447 2:2273334-2273356 CCTGATAAATGAGATGTTTGGAA 0: 1
1: 0
2: 1
3: 19
4: 266
Right 925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG 0: 1
1: 0
2: 5
3: 28
4: 228
925235444_925235450 9 Left 925235444 2:2273332-2273354 CCCCTGATAAATGAGATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG 0: 1
1: 0
2: 5
3: 28
4: 228
925235446_925235450 8 Left 925235446 2:2273333-2273355 CCCTGATAAATGAGATGTTTGGA 0: 1
1: 0
2: 2
3: 20
4: 230
Right 925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG 0: 1
1: 0
2: 5
3: 28
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925235450 Original CRISPR AGACCAATACAGAAAGTGGG TGG Intronic
903870136 1:26428046-26428068 AGACAAATACAGTAACTTGGGGG - Exonic
906586655 1:46984460-46984482 AGATCAATGCAGAATGTGGGTGG + Intergenic
907744901 1:57203427-57203449 TGCCCAAGACAGAAAGTAGGGGG + Intronic
910024587 1:82634607-82634629 GGATGATTACAGAAAGTGGGTGG + Intergenic
910276412 1:85454014-85454036 AGACCTACACAGACACTGGGAGG - Intronic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
911962288 1:104320773-104320795 AAACCAAAACATAAAGTGGGGGG - Intergenic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
912894965 1:113576546-113576568 ACACCAACACAGAAGGTGGGTGG - Intronic
916860586 1:168800372-168800394 AGAAAAATACAGAATGAGGGAGG + Intergenic
918271269 1:182902390-182902412 AGAATCATACAGAGAGTGGGAGG + Intronic
921100771 1:211927311-211927333 AGACAAAGACAGTAACTGGGAGG - Intergenic
921579782 1:216882670-216882692 ATATCAATGCAGAAAATGGGTGG + Intronic
923769585 1:236926789-236926811 GGACTAATACAGAAGGCGGGAGG + Intergenic
924049294 1:240064145-240064167 AGAGCAATTATGAAAGTGGGAGG + Intronic
1063154410 10:3365263-3365285 AGGCCAAGACAGAAAGGAGGCGG - Intergenic
1064593464 10:16919046-16919068 AAACCAATACAGAATATGGAAGG - Intronic
1065422180 10:25557305-25557327 AGACGAATGCAGGAAGTGAGAGG - Intronic
1066159564 10:32714153-32714175 ATACCAATGCAGAAGGTGGGTGG + Intronic
1067010411 10:42706895-42706917 AAACCAATACAGAATATGGAAGG - Intergenic
1068829075 10:61472390-61472412 TGAGCAAGACAGAAAGTGAGAGG - Intergenic
1068881152 10:62050064-62050086 AGATCTACACAGAAAGTAGGGGG - Intronic
1068960365 10:62861167-62861189 AGACAAACACAGGAAGGGGGAGG - Intronic
1069764363 10:70842598-70842620 AGAGCAAGAAAGAGAGTGGGGGG + Intronic
1071036791 10:81257680-81257702 AGACCAATACGGAAAGTGGCTGG - Intergenic
1072006187 10:91250466-91250488 AGACAAATACAGGATGTGAGAGG - Intronic
1073123958 10:101138541-101138563 AGACCATCACTGCAAGTGGGTGG + Intergenic
1074260777 10:111851293-111851315 GGAGCAAGAGAGAAAGTGGGGGG + Intergenic
1075024352 10:118973300-118973322 AGAAAAATACAGAAAATGAGGGG + Intergenic
1077648260 11:3945925-3945947 AGAGCAAGATAGAGAGTGGGTGG + Intronic
1081149683 11:39611880-39611902 AGAGGAAGAGAGAAAGTGGGAGG + Intergenic
1081264716 11:41005642-41005664 AGAGCAAGACAGAGAGTGAGAGG - Intronic
1081942607 11:46956482-46956504 AGACAAATACAGTAACTTGGGGG + Intronic
1083979129 11:66151047-66151069 AGAGGACTACAGAAAGGGGGAGG + Intronic
1085995600 11:81908981-81909003 AGACTAATACAGGTAGTGAGAGG + Intergenic
1086685265 11:89726880-89726902 AAACAAATAATGAAAGTGGGAGG + Intergenic
1088460412 11:110076453-110076475 GGAGCAAGAGAGAAAGTGGGGGG + Intergenic
1089378602 11:118012107-118012129 AGCCCAATAGAGCAAGTGGGAGG - Intergenic
1090650772 11:128804007-128804029 AAAGCAACACAGAAAGTGAGGGG - Intronic
1092347063 12:7724186-7724208 AGTACAGTTCAGAAAGTGGGTGG + Intergenic
1093253865 12:16841743-16841765 AGAGCAAGTCTGAAAGTGGGAGG + Intergenic
1093317393 12:17667857-17667879 TGACCAAGCGAGAAAGTGGGAGG + Intergenic
1093396845 12:18693322-18693344 AGACCTATGCAGATACTGGGGGG + Intronic
1093435687 12:19131022-19131044 AGACCAGTACAGAAACTACGAGG - Intronic
1094817405 12:34201637-34201659 AGATAAATATAGAAAGTTGGGGG + Intergenic
1095523433 12:43095813-43095835 AGACCTTTACACAAAGTGGGTGG - Intergenic
1098224673 12:68309194-68309216 AGACCAATACAGTGTGTGGCAGG - Intronic
1099390428 12:82072301-82072323 AGTACAATATAGAAAGTGGTTGG - Intergenic
1102219650 12:111185968-111185990 AGAGAAATACAGAAAGAGAGGGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106567594 13:30899827-30899849 AGACTAAGACACAAAGTTGGTGG - Intergenic
1106827252 13:33537517-33537539 ACACCCATGCAGAAAGTGAGGGG + Intergenic
1108593408 13:51930132-51930154 ATAGAAATATAGAAAGTGGGGGG - Intergenic
1109436872 13:62315014-62315036 AGAGCAAGAGAGAGAGTGGGAGG + Intergenic
1110187933 13:72696922-72696944 AGACCAAATCAGAAATAGGGAGG - Intergenic
1111017319 13:82398316-82398338 AGAATAATATAAAAAGTGGGTGG + Intergenic
1113812821 13:113152924-113152946 ACACCAAGACACAAAGAGGGCGG + Intergenic
1114547402 14:23512980-23513002 AGAAAAAGAGAGAAAGTGGGTGG + Intergenic
1116017632 14:39426408-39426430 GGACCAAGAGAGAAAGTAGGGGG - Intronic
1116252047 14:42498881-42498903 GGACCAAAAGAGACAGTGGGAGG - Intergenic
1116805378 14:49489417-49489439 AGAGAAAGAGAGAAAGTGGGAGG + Intergenic
1116997309 14:51337059-51337081 ATACCAAAATAGAAAGTGGCTGG + Intergenic
1117299291 14:54407911-54407933 AGACCAATGCAGAAAGAAGACGG - Intronic
1117882614 14:60327217-60327239 AGACGGATACAAAATGTGGGTGG + Intergenic
1120338666 14:83190674-83190696 AGACCAACAGAGAAGGTGGGTGG - Intergenic
1120456237 14:84733861-84733883 ACACACATACAGAAAATGGGAGG - Intergenic
1120977718 14:90264120-90264142 AGACCTATGCAGATATTGGGGGG + Exonic
1121075896 14:91067941-91067963 AGACCAACACAGTTAGGGGGTGG + Intronic
1121105310 14:91275432-91275454 AGAACACTCCAGAAATTGGGGGG - Intronic
1124210881 15:27764140-27764162 AGAGGGATACAGAAAGAGGGAGG + Intronic
1124660118 15:31540928-31540950 AGGCAAGTACAGAAAATGGGAGG + Intronic
1127569562 15:60228650-60228672 AGACCCAAACAGAAAATGGAAGG - Intergenic
1131738349 15:95358930-95358952 AGACAGAAACAGAACGTGGGAGG + Intergenic
1131997423 15:98145714-98145736 AAAGCAATAGAGGAAGTGGGTGG + Intergenic
1132725719 16:1337562-1337584 AAAACAAAACAAAAAGTGGGTGG + Intronic
1133107885 16:3525542-3525564 AGACAAAGAGAGAGAGTGGGGGG - Intronic
1136268757 16:29136142-29136164 AGACAAATACAGGAGTTGGGGGG - Intergenic
1136470742 16:30478351-30478373 AGAAAAAGAAAGAAAGTGGGGGG + Intronic
1137690564 16:50424091-50424113 AGTCAAATAAAGTAAGTGGGCGG + Intergenic
1137781461 16:51101107-51101129 AGAAGGAGACAGAAAGTGGGTGG + Intergenic
1141289443 16:82704138-82704160 AGACAAATAAAGAAAGAGGTGGG + Intronic
1142072062 16:88096508-88096530 AGACAAATACAGGAGTTGGGGGG - Intronic
1142918694 17:3165030-3165052 AAACAAATACAGAAAGGGGAAGG + Intergenic
1143178703 17:4971065-4971087 AGACTAATGGAGTAAGTGGGTGG - Intronic
1143282417 17:5764791-5764813 AGACCATCCCTGAAAGTGGGGGG - Intergenic
1147373463 17:40010244-40010266 AGATGAAAACAGGAAGTGGGAGG + Intergenic
1150612024 17:66740869-66740891 AGAAGAGTACAGAAAGGGGGAGG - Intronic
1153819882 18:8824151-8824173 AGGCTAAGACAGAAAGTGGCCGG - Intronic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1155224802 18:23719888-23719910 AGCCCAATCCAGAAGGTGGATGG + Intronic
1156009744 18:32482961-32482983 AGACCAAATCAGGAAGTGGAAGG + Intergenic
1157820636 18:50765863-50765885 AGAAGAAGACAGAAAGTGGTGGG - Intergenic
1159679299 18:71327096-71327118 AGCCCAATAAAGAATGTGGTTGG + Intergenic
1159985500 18:74836337-74836359 ACACCAATACAGAAGGTAGGGGG - Intronic
1160164823 18:76501346-76501368 AGAAAAAGAAAGAAAGTGGGGGG + Intergenic
1164112640 19:22184110-22184132 AGACTGACACAGAAGGTGGGTGG + Intronic
1164507388 19:28870970-28870992 GGACCAACACAGAAAGAGCGGGG - Intergenic
1167296225 19:48651765-48651787 AGAGCTATACAGAAAGTGAAAGG + Intergenic
925169571 2:1742918-1742940 TGAACAATTCAGGAAGTGGGCGG - Intronic
925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG + Intronic
926149833 2:10419229-10419251 AAACAAATAAAGAAGGTGGGTGG + Intronic
927133707 2:20081399-20081421 GGACCCTTACAGAATGTGGGCGG + Intergenic
927318184 2:21710464-21710486 AGACTAATACAGAAAGTGTTAGG - Intergenic
927662867 2:25007542-25007564 AGACAAATCCAGAATGTGGGAGG + Intergenic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
927796424 2:26052883-26052905 ACACCAAGGCAGAAAGTGAGGGG - Intronic
928263106 2:29785665-29785687 AGACCAAGAAAGAAAGTAGATGG + Intronic
929054464 2:37863761-37863783 AGACCTTTCCAGAAAGAGGGTGG - Intergenic
930469042 2:51790323-51790345 AGAGTAAGAGAGAAAGTGGGAGG - Intergenic
930539550 2:52688348-52688370 AGACAGATAGAGATAGTGGGGGG - Intergenic
930995923 2:57717933-57717955 AGAGCAAGAGAGAAAGTGGCAGG + Intergenic
931248113 2:60507738-60507760 AGCACAAGACAGAAAGCGGGTGG + Intronic
931510753 2:62990714-62990736 AGAACAAAACAGTAAGTTGGTGG + Exonic
933074641 2:77907597-77907619 AGACCACTAGAGAAAGTGACAGG - Intergenic
933283950 2:80364097-80364119 AGTTGAATACAGTAAGTGGGTGG + Intronic
933531030 2:83512461-83512483 AGACAAAGACAGAAAGAGGAGGG + Intergenic
933585082 2:84171562-84171584 AGGCAGATACAGAAAGTGAGAGG + Intergenic
934919987 2:98335293-98335315 AGAGCAATGGAGAGAGTGGGTGG + Intronic
935058746 2:99590248-99590270 GGACTAAGACAGGAAGTGGGAGG + Intronic
935742520 2:106162484-106162506 AGACCAATATAGAAAATGTGTGG + Intronic
936713971 2:115162760-115162782 AGACCAAAACAAAAAGGGGTTGG - Intronic
937735762 2:125286649-125286671 TGACAGATAGAGAAAGTGGGAGG + Intergenic
938183162 2:129203124-129203146 AGTACAATACAGAAAGAGGGTGG + Intergenic
939140590 2:138349799-138349821 ATACCAGAACAGAATGTGGGAGG + Intergenic
939260116 2:139796371-139796393 AGAGCAAAAGAGAGAGTGGGAGG - Intergenic
939457256 2:142453585-142453607 ACAGCAATGCAGAAGGTGGGAGG + Intergenic
940160865 2:150711861-150711883 AGCCCAATAAAGAAGGTGGTTGG + Intergenic
940371998 2:152913029-152913051 AAACCAATACTGCATGTGGGAGG + Intergenic
940570151 2:155421460-155421482 ATACCTATACAGACAGTGGTTGG + Intergenic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
941919183 2:170832127-170832149 AAACTAATACAGAAAGGGAGAGG - Intronic
942035180 2:172003736-172003758 AGACTAATACAGCAAGTAAGAGG + Intronic
942137764 2:172945009-172945031 AGAAAAATACAGAAAGGGGAAGG + Intronic
943081627 2:183264264-183264286 AGACAAATACAATAACTGGGGGG - Intergenic
943778205 2:191791509-191791531 AGAGCAAGAAGGAAAGTGGGAGG + Intergenic
945327004 2:208493541-208493563 AGACCAAGGAAGATAGTGGGAGG + Exonic
947075034 2:226333576-226333598 AGACCACTAGAGAAAGAGAGAGG + Intergenic
947756894 2:232572717-232572739 AGACTAATGAAGAAACTGGGAGG + Intronic
947793238 2:232879428-232879450 AGACCCCGACAGAAGGTGGGGGG - Exonic
948159355 2:235811641-235811663 TGAGAAATACAGAAAGTGTGCGG + Intronic
948565442 2:238883470-238883492 AGAAAAAAACAGAAAGTGAGGGG + Intronic
1169718672 20:8648169-8648191 ATACCAAAGCAGGAAGTGGGTGG + Intronic
1170670805 20:18431375-18431397 AGACCAACGCAGAAAGGGGACGG + Intronic
1171779229 20:29403969-29403991 AGATAAATATAGAAAGTTGGGGG + Intergenic
1173187190 20:40849190-40849212 GGACCTAGACAGAAAGAGGGGGG + Intergenic
1173766289 20:45612859-45612881 AGAGCAATAGAGAATGAGGGGGG - Intronic
1176008754 20:62880722-62880744 CCACCAGGACAGAAAGTGGGGGG - Exonic
1177092050 21:16781585-16781607 AGATCAACACAGAAGGTGGATGG + Intergenic
1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG + Intronic
1182696433 22:32202173-32202195 AGAGGAAGACAGAAAGTGGGGGG - Intronic
1182749227 22:32628355-32628377 AGACCATTACTGGAAGTGAGGGG + Intronic
1182941625 22:34282537-34282559 AGACTAATACAGAAGGACGGGGG - Intergenic
1184104790 22:42361206-42361228 AGACAAATACAGAAATTGGCCGG - Intergenic
1184439881 22:44503353-44503375 AAACAAATAAACAAAGTGGGGGG + Intergenic
1185396248 22:50591451-50591473 ACACCAATACAGAGGATGGGAGG - Intronic
950291937 3:11791730-11791752 AGACCACTGCAGACAGTGGCAGG + Intronic
950402029 3:12776317-12776339 AGACTAATACAGGGAGTGAGAGG + Intergenic
950552352 3:13674379-13674401 CGATGAATCCAGAAAGTGGGAGG - Intergenic
953127813 3:40108904-40108926 AGCCCCATAGAGAAAGTGGTGGG - Intronic
956378012 3:68636249-68636271 AGACCTATGCAGATATTGGGGGG + Intergenic
956631740 3:71323376-71323398 ATCCCAACACAGAAACTGGGAGG + Intronic
957085915 3:75676686-75676708 AGATAAATATAGAAAGTTGGGGG - Intergenic
957437697 3:80200330-80200352 AAACCATTGCGGAAAGTGGGTGG - Intergenic
959525675 3:107373601-107373623 TGACCAAGACATAAAGTGTGTGG - Intergenic
961741433 3:129035504-129035526 AGACCAAGACAGAAGGTAGCAGG + Intronic
961747361 3:129073089-129073111 ATTCCAAGACAGAAAGTGGGTGG + Intergenic
963842813 3:150124990-150125012 AATCCAATACAGAAAGAGTGAGG - Intergenic
967759506 3:193207478-193207500 AGATCAATACAGGAAGTGGTTGG + Intergenic
969252629 4:5979480-5979502 ACACACATTCAGAAAGTGGGTGG + Intronic
970262888 4:14247641-14247663 AGATCAATTCTGAAAGGGGGAGG - Intergenic
970416845 4:15866409-15866431 AGACCATTACAGTCACTGGGAGG - Intergenic
970714625 4:18907514-18907536 AGACCAATGCAGAAGGAGAGTGG + Intergenic
970752550 4:19382048-19382070 AGAACAAGGCAGAAAGTGGTAGG + Intergenic
971442780 4:26707600-26707622 ACAGCAATACAGAAAATGAGAGG - Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973104530 4:46317963-46317985 AGACAAATACCGAAAGTTGATGG + Intronic
974434648 4:61841114-61841136 AGACGAAGAAAGAAAGGGGGAGG - Intronic
975690979 4:76963107-76963129 ATTCCAATAAAGAGAGTGGGAGG + Intronic
976118669 4:81756451-81756473 AGAGGAACACAGAAAGTAGGTGG - Intronic
976688334 4:87840659-87840681 AAAACAAGACAGAATGTGGGAGG + Intronic
977039586 4:92000115-92000137 AAGCCAATAAATAAAGTGGGGGG - Intergenic
977234304 4:94488809-94488831 AGTCCAATAAACAAAGAGGGTGG - Intronic
979059487 4:116039160-116039182 AGGCAAATACAGAAAGGGAGAGG + Intergenic
979319376 4:119304390-119304412 AGACCATTACAGAATGTAGAGGG - Exonic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
984730592 4:183064788-183064810 AGCCCAATACAGGAGGTGGTTGG - Intergenic
985444096 4:190010841-190010863 AGATAAATATAGAAAGTTGGGGG + Intergenic
986761633 5:10885320-10885342 AAACGAATACAGGATGTGGGGGG - Intergenic
987384135 5:17313018-17313040 AAAAGAATACAGAAAGTGGGAGG - Intergenic
988619008 5:32803313-32803335 AAACCAATACAGAAAGACTGAGG - Intergenic
990823995 5:59876610-59876632 AAAGCAAGACAGAAGGTGGGGGG - Intronic
993410580 5:87567910-87567932 AGACCAACGCAGAAAGTGGGTGG - Intergenic
993656888 5:90588707-90588729 ATAGCAATACAAAAAGTGAGTGG - Intronic
995808460 5:116079953-116079975 AGACCAACGCAGAAAGCGGGTGG + Intergenic
1000705717 5:164508900-164508922 ATACCATTACTGTAAGTGGGAGG - Intergenic
1001372555 5:171220356-171220378 AGACCAATGCAGAAGGCGGGTGG - Intronic
1003320101 6:5043761-5043783 AGACCAATAAAGGAGGTGGTTGG - Intergenic
1004392897 6:15224125-15224147 AGAACAATGGAGAAAGTGAGAGG - Intergenic
1005276869 6:24229055-24229077 AAACCAATACAGAAAGAGCAAGG - Intronic
1006410234 6:33869335-33869357 AGGCCAATCCAGGTAGTGGGTGG + Intergenic
1008375483 6:50786533-50786555 AGACCAGTGACGAAAGTGGGTGG + Intergenic
1008425315 6:51349695-51349717 AGACCAATGCAGAAGGCAGGTGG - Intergenic
1008885206 6:56424902-56424924 AGACAAATAGAGTAAGTGTGAGG + Intergenic
1009297498 6:61971649-61971671 AGACAAAGAGAGAAAGTGGAAGG - Intronic
1009727958 6:67558725-67558747 AGATCAATGCAGAAAGCGGGTGG - Intergenic
1009777993 6:68230746-68230768 AGAGAAAGAAAGAAAGTGGGAGG + Intergenic
1011299057 6:85854608-85854630 AGACCAATACAGAGTATAGGAGG + Intergenic
1016648885 6:146441073-146441095 AGAGAAAGAGAGAAAGTGGGGGG + Intergenic
1016665508 6:146635350-146635372 AGACAGAGACAGAGAGTGGGTGG - Intronic
1017206283 6:151807645-151807667 AGACCAGTACTTAAAGTTGGAGG + Intronic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1018337477 6:162809716-162809738 AGACCAACTCAGTAAGTGGGAGG + Intronic
1024897658 7:54279196-54279218 AGACCAAGAGAAAAGGTGGGTGG + Intergenic
1027343388 7:77233454-77233476 AGACCAATCCAGGGGGTGGGTGG - Intronic
1028198753 7:87935742-87935764 CTACCAATAAAGAAAGTCGGAGG - Intronic
1028956013 7:96691264-96691286 AGACGAATGTGGAAAGTGGGGGG + Intronic
1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG + Intronic
1030781035 7:113600497-113600519 AGACCAACAGAGGATGTGGGTGG + Intergenic
1031689879 7:124774322-124774344 AGCACAAAACAGAAGGTGGGAGG + Intergenic
1032684108 7:134213287-134213309 AGAGCAATACAGGAAGCAGGAGG + Intronic
1033617568 7:143031793-143031815 AGACCAACACAGAAGGCAGGTGG + Intergenic
1037177554 8:15964968-15964990 AGAACAATTTAGAAAGTGAGTGG + Intergenic
1037496189 8:19443382-19443404 AGACTAATACAGATACTGAGGGG - Intronic
1041665166 8:60437121-60437143 AAAACAATAAAGAAAGTGGAGGG - Intergenic
1042195457 8:66228274-66228296 AGATCAACACAGAAGGTGAGTGG + Intergenic
1043384375 8:79733407-79733429 AGAGCAAGAGAGAAAGTGGGTGG + Intergenic
1043956216 8:86362710-86362732 ATACCACTTCAGAAAGTAGGAGG + Intronic
1045185281 8:99830988-99831010 AGACCAACACAGAAGGTGGATGG - Intronic
1045912479 8:107426362-107426384 ATTCTAAAACAGAAAGTGGGCGG + Intronic
1047985244 8:130226421-130226443 AGACTAATACAGTTAGTGGTGGG - Intronic
1049139795 8:140942952-140942974 AGAACAAGAGAGAGAGTGGGAGG - Intronic
1050854893 9:10341174-10341196 AAATCAATACCGAAAGTTGGAGG - Intronic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1053417777 9:37957542-37957564 AGCACAGTCCAGAAAGTGGGTGG - Intronic
1056286073 9:85089084-85089106 AGACAAATACAGAATGAGTGGGG - Intergenic
1056941229 9:90958364-90958386 AGCTCAAAAAAGAAAGTGGGTGG + Intergenic
1057144098 9:92747052-92747074 ACACCAATATGGAAGGTGGGTGG + Intronic
1058247252 9:102642798-102642820 AGCCCAATAAAGCTAGTGGGTGG + Intergenic
1062181972 9:135195737-135195759 GGACCACTGCAGACAGTGGGTGG + Intergenic
1185870597 X:3662001-3662023 AAACCAATAAAGAATGTGGCTGG - Intronic
1186145995 X:6624584-6624606 AGATCAATACAGGAAGAGAGAGG + Intergenic
1186452484 X:9685106-9685128 GGACCAATGTAAAAAGTGGGAGG - Intronic
1186581058 X:10819158-10819180 AGACACACACAGAAAGAGGGAGG - Intronic
1187021398 X:15386597-15386619 AAATCAACACAGAAAGGGGGAGG + Intronic
1189210905 X:39281092-39281114 AGATCAACACAGAAAGCAGGTGG - Intergenic
1189280149 X:39815562-39815584 AAAACAACACAGAAAGTTGGGGG + Intergenic
1190408798 X:50114322-50114344 AGGCCATGACAGAAAGTGAGGGG - Intergenic
1191021663 X:55867206-55867228 AGGCCATTAGGGAAAGTGGGGGG - Intergenic
1192766014 X:74140389-74140411 AGACCAATACAGAAGGCAGGTGG + Intergenic
1192994709 X:76500618-76500640 AAACAAAAACATAAAGTGGGGGG - Intergenic
1194553678 X:95332049-95332071 AGACAAATAAAGAAAATGGGGGG + Intergenic
1194678522 X:96822540-96822562 AGAGCAGTAGACAAAGTGGGGGG + Intronic
1195732332 X:107980021-107980043 AGACCATTAAAGAAAATGGTGGG - Intergenic
1196948532 X:120852364-120852386 GGAGCAAGACAGAAAGGGGGTGG + Intergenic
1197202760 X:123763042-123763064 AGATAAATACAGAAATTGAGAGG + Intergenic
1198944639 X:141996696-141996718 AGATCAAGGCAGAAGGTGGGTGG - Intergenic
1199699729 X:150366085-150366107 TGACAAATAAGGAAAGTGGGCGG + Intronic
1200793439 Y:7319129-7319151 AAACCAATAAAGAATGTGGCTGG + Intergenic
1201762232 Y:17553217-17553239 AGATAAATAGAGAAAGTTGGGGG + Intergenic
1201839320 Y:18352771-18352793 AGATAAATAGAGAAAGTTGGGGG - Intergenic
1201981248 Y:19912345-19912367 AGACTAATACAGCATGTGAGTGG + Intergenic
1202096370 Y:21251695-21251717 AGACCAATGCAGAAAGTGAATGG - Intergenic