ID: 925238231

View in Genome Browser
Species Human (GRCh38)
Location 2:2297730-2297752
Sequence CTGGGAGGGCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1637
Summary {0: 1, 1: 0, 2: 11, 3: 142, 4: 1483}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925238231_925238246 6 Left 925238231 2:2297730-2297752 CCCTCCTCCTTCTGCCCTCCCAG 0: 1
1: 0
2: 11
3: 142
4: 1483
Right 925238246 2:2297759-2297781 AGGACAGCCAGGAAAATAAAGGG 0: 1
1: 0
2: 1
3: 39
4: 516
925238231_925238245 5 Left 925238231 2:2297730-2297752 CCCTCCTCCTTCTGCCCTCCCAG 0: 1
1: 0
2: 11
3: 142
4: 1483
Right 925238245 2:2297758-2297780 GAGGACAGCCAGGAAAATAAAGG 0: 1
1: 0
2: 1
3: 33
4: 376
925238231_925238250 30 Left 925238231 2:2297730-2297752 CCCTCCTCCTTCTGCCCTCCCAG 0: 1
1: 0
2: 11
3: 142
4: 1483
Right 925238250 2:2297783-2297805 ATGTCTTTGGGAGCCGTCTGAGG 0: 1
1: 0
2: 1
3: 7
4: 93
925238231_925238249 18 Left 925238231 2:2297730-2297752 CCCTCCTCCTTCTGCCCTCCCAG 0: 1
1: 0
2: 11
3: 142
4: 1483
Right 925238249 2:2297771-2297793 AAAATAAAGGGAATGTCTTTGGG 0: 1
1: 0
2: 4
3: 49
4: 620
925238231_925238248 17 Left 925238231 2:2297730-2297752 CCCTCCTCCTTCTGCCCTCCCAG 0: 1
1: 0
2: 11
3: 142
4: 1483
Right 925238248 2:2297770-2297792 GAAAATAAAGGGAATGTCTTTGG 0: 1
1: 0
2: 2
3: 56
4: 448
925238231_925238243 -5 Left 925238231 2:2297730-2297752 CCCTCCTCCTTCTGCCCTCCCAG 0: 1
1: 0
2: 11
3: 142
4: 1483
Right 925238243 2:2297748-2297770 CCCAGGGAGGGAGGACAGCCAGG 0: 1
1: 1
2: 7
3: 100
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925238231 Original CRISPR CTGGGAGGGCAGAAGGAGGA GGG (reversed) Intronic
900103897 1:974137-974159 CAGGGAGGGAAACAGGAGGACGG + Intronic
900154727 1:1199323-1199345 CAGGGAGGGGTGAAGCAGGAGGG + Intergenic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900427054 1:2585708-2585730 CTGGGCGGGCTGGAGAAGGAAGG - Intergenic
900471915 1:2859278-2859300 CAGGGAGGAAGGAAGGAGGAAGG + Intergenic
900584152 1:3424492-3424514 CGTGGAGGCCAGATGGAGGAAGG + Intronic
900646949 1:3713323-3713345 CTGGGAGGGGTGAAGGCAGAGGG - Intronic
900812344 1:4816452-4816474 CTTGGAGGTTAGAAGCAGGATGG - Intergenic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
901059919 1:6467257-6467279 CAGTGAGGGTAGAAGTAGGATGG + Exonic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901672623 1:10865118-10865140 CAGGGAGGGGAGAAGGACCAGGG + Intergenic
901702020 1:11050157-11050179 CTTGGAGGTCAGGAGCAGGATGG + Intergenic
901767710 1:11514544-11514566 CTGGGAGGGGAGGAGGGGGCTGG - Intronic
901769070 1:11521400-11521422 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901769145 1:11521628-11521650 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901771845 1:11534567-11534589 CTGGGTGGGCAGGAGGCAGAGGG + Intronic
901875812 1:12166723-12166745 CTGGGAGGGCAGGTGGAGGCCGG + Intergenic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902184112 1:14712234-14712256 TTAGAAGGGCAGAAGGAGCAGGG + Intronic
902400046 1:16152637-16152659 CTGGGTGGGTAGAAGGACAAAGG + Intronic
902409659 1:16205568-16205590 CTGGAAGGGCAGGATAAGGAAGG + Exonic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902672312 1:17983319-17983341 CTGCGGTGGCAGAAGGAAGAGGG + Intergenic
903132553 1:21289569-21289591 TTGGGAGGGCAAGAGGAAGAGGG + Intronic
903138426 1:21324318-21324340 CTGGGTGGGCAGAGGAAGCAGGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903331229 1:22598128-22598150 CTGGGCGGGCAGTAGGGAGAGGG - Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903488292 1:23707843-23707865 GTGAGAGGGCAAGAGGAGGAGGG + Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903562097 1:24235994-24236016 CTGGGAGGGCAGTCGGGAGAGGG + Intergenic
903647778 1:24905176-24905198 GTCCGAGGGCAGAGGGAGGAGGG + Intronic
903654315 1:24939796-24939818 GTGGGAGGGGAGAAGTGGGAGGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
903976059 1:27150996-27151018 CTGAGAGTGCAGAGGGAGCATGG + Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
905166869 1:36088188-36088210 CTTGGAGGACTGCAGGAGGAGGG + Exonic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905278305 1:36833333-36833355 CTGACAGGTCAGAAGGAAGAGGG - Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905643547 1:39608975-39608997 CTGGGAGTGCTGGTGGAGGAAGG + Intergenic
905657258 1:39692633-39692655 CTGGGCGGGGCGATGGAGGATGG + Intronic
905773609 1:40654113-40654135 ATGGGAGGGCAGGCGGGGGAGGG - Intronic
906245022 1:44267397-44267419 AAGGGAGGGAAGAAGAAGGAGGG - Intronic
906283457 1:44569737-44569759 CTGAGGGGGAACAAGGAGGAAGG + Intronic
906591012 1:47023999-47024021 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
907105493 1:51878766-51878788 CCGGGAGGGCGGAGGGACGAGGG - Exonic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
907332134 1:53678309-53678331 CTGGGAGTGCAGGAGGGTGAGGG + Intronic
907970670 1:59377777-59377799 CTGGGAGGGCACAGGGTGGTGGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908309672 1:62867063-62867085 TGGGGTGGGCGGAAGGAGGAGGG - Intergenic
908418586 1:63937273-63937295 CTGGGATGGCAGTAAAAGGACGG - Intronic
908474591 1:64474922-64474944 CTGGGAGGGAGGGAGGAGCAGGG + Intronic
908672074 1:66559083-66559105 CTGGAAGGGAAGCAGGAGAAAGG - Intronic
908903776 1:68985231-68985253 GTGGGAGAGCAGAAGCAGGGTGG + Intergenic
908929918 1:69306096-69306118 TGGGGAGGCCAGAAGCAGGATGG + Intergenic
909344755 1:74572173-74572195 CTCTGAGGAAAGAAGGAGGAGGG - Exonic
910226936 1:84945183-84945205 CAAGGAGGGCAGCAGGCGGAAGG + Intronic
910309701 1:85809445-85809467 CTTGGAGGTCAGAAGTAAGATGG + Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911485221 1:98497194-98497216 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
911729678 1:101279828-101279850 CTCGGGGGGCTGAAAGAGGAAGG + Intergenic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912008596 1:104932936-104932958 CTAGGAGGGAAGGAGCAGGAGGG + Intergenic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912501582 1:110126189-110126211 GTTGGAGGACAGAAGGAGGCAGG + Intergenic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
912702552 1:111888993-111889015 GTGCGAGGGCAGCAGGAGGAGGG + Intronic
912730007 1:112093793-112093815 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
912873639 1:113332611-113332633 CTGGTACGGTAGAAAGAGGAAGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913611018 1:120509861-120509883 CTGGCAGGGGAGAAGAGGGAAGG - Intergenic
913703597 1:121397104-121397126 GTGGGAGAGAAGAAGGAGGGCGG + Intergenic
913979947 1:143498815-143498837 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914003165 1:143709834-143709856 CTGGGAGGGCATATGTGGGATGG - Intergenic
914074296 1:144324299-144324321 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
914104880 1:144642147-144642169 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
914214356 1:145611328-145611350 AGGGGAGGGGAGAAGGGGGAAGG - Intronic
914346998 1:146808482-146808504 AGGAGAGGGCAGAAGGATGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914466294 1:147931721-147931743 AGGGGAGGGGAGAAGGGGGAAGG - Intronic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914580172 1:149012378-149012400 CTGGCAGGGGAGAAGAGGGAAGG + Intronic
914756101 1:150562343-150562365 ATGGGCGGGCAGAAAGAGAAAGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915271350 1:154755939-154755961 TGGGGAGGGGAGGAGGAGGAGGG + Intronic
915325844 1:155080799-155080821 CTGGGCCGGCAGAGGTAGGAGGG + Intronic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
915530474 1:156499992-156500014 CTGGGAGGGCGGCGGGAGGGTGG - Intronic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
916280856 1:163049560-163049582 CTGGGAGTGCGGTAAGAGGATGG - Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917105006 1:171483326-171483348 AGGGGAGGGGAGAAGGAGGGAGG + Intergenic
917689009 1:177448390-177448412 CTGGGAGGCTAGGGGGAGGAAGG + Intergenic
917968965 1:180195240-180195262 CTGAGAGGCCAGAAGCAGGGTGG + Intronic
918064643 1:181090875-181090897 TTGGGAGGGAAGTGGGAGGAGGG + Intergenic
918066315 1:181104652-181104674 TTGGGAGGGGAGTAGGAGGTCGG - Intergenic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918295966 1:183157424-183157446 CTGGGTGGGACGAAGCAGGATGG + Intergenic
918457003 1:184731587-184731609 GAGGGAGGGCATGAGGAGGAAGG - Intronic
918876138 1:190046286-190046308 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
919758234 1:201079360-201079382 CTGGGAGGTCAGGAGCAGGAGGG - Intronic
919925537 1:202189994-202190016 CAGGGAGGGCATATGGAGAAAGG + Intergenic
920049116 1:203152642-203152664 CCGGGATGGCAAAAGGAGCAAGG - Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920693176 1:208162208-208162230 CAGGAAGGGCAGAAGGCTGAGGG + Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921320051 1:213930000-213930022 TTGGGAGGGCAGAGAGAGGCAGG - Intergenic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921747878 1:218758259-218758281 CAGGGAGGGAAGGAGGAGGTGGG + Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922001869 1:221487063-221487085 CTGAGAGGGAGTAAGGAGGAAGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922478049 1:225920453-225920475 CTGGGAGGCAAGAAGGACTAAGG - Exonic
922575484 1:226658429-226658451 CTGGGAGGGAAGGAGGGGAAGGG + Intronic
922729656 1:227942955-227942977 CTGGCAGGGCCGGAGAAGGAGGG - Intronic
922746690 1:228048229-228048251 CTGGGAGAGCAGGAGGGAGAAGG - Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922853590 1:228755383-228755405 CTGGGAGGTCACGAGGAGCAGGG - Intergenic
922934273 1:229411472-229411494 GGGGGAGGGGAGAGGGAGGAAGG - Intergenic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
923388424 1:233489235-233489257 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923776437 1:236982909-236982931 CTGGGAGGGTAGAATGATGTTGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924245730 1:242082423-242082445 CTAGGAGGTCTGATGGAGGAAGG - Intergenic
924279521 1:242422210-242422232 GAGGGAGGGCAGGAGGAGAAGGG + Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063059147 10:2532798-2532820 CTGGAAGGGAAGAAGCTGGAAGG + Intergenic
1063143603 10:3276572-3276594 CCGGGAGGGCAGTTGGAGGAGGG - Intergenic
1063223427 10:3992491-3992513 AGGGGAGGGGAGAAGGTGGAGGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063330250 10:5151453-5151475 CTTGGAGGTTAGAAGCAGGATGG + Intergenic
1064440019 10:15345402-15345424 CTGGGATGGCAGAACGAGAGGGG + Intronic
1064627241 10:17273841-17273863 GGAGGAGGGAAGAAGGAGGAAGG - Intergenic
1064769848 10:18712046-18712068 CTTGGAGGGGAGAAGGAAGGAGG - Intergenic
1064858395 10:19797391-19797413 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1064859944 10:19816136-19816158 AGGGGAGGGCGGAGGGAGGAGGG + Intergenic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066068336 10:31778705-31778727 CTGGGAGGAAACAGGGAGGATGG - Intergenic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066640567 10:37550852-37550874 CTGGGACTGCAGAAGGAGCTTGG - Intergenic
1066954142 10:42149497-42149519 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1067027172 10:42853877-42853899 AAGGGAGGGAGGAAGGAGGAAGG - Intergenic
1067053466 10:43038327-43038349 CTGGGAGGGTGGAGGGAGGCGGG + Intergenic
1067141610 10:43662248-43662270 CTGGGATGGAAGAAGGTGGGAGG + Intergenic
1067203376 10:44193989-44194011 CTGGGGGGCCACAAGGAGGCAGG + Intergenic
1067221486 10:44347343-44347365 CTGAGAGGGCAGTAGGTGGTGGG - Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1068523074 10:58098928-58098950 ATGGGAGGGGAAAAAGAGGAGGG - Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068985978 10:63108086-63108108 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1069480807 10:68780432-68780454 TTGGGAGGGAAGCAGGAAGATGG - Intronic
1069679915 10:70277182-70277204 CTGGGAGGGAAGAATGGGAAGGG - Intronic
1069683498 10:70301330-70301352 CTGGGTGGGCATGAGGAGGGTGG + Exonic
1069687100 10:70325326-70325348 CTGGGAAGGCAGTAGGAGATCGG - Intronic
1069819367 10:71217941-71217963 CTGGGAGGTGAGAAGGAGGGCGG - Intronic
1070710194 10:78675703-78675725 CAGGGAGGGCAGCAGGAGCCAGG - Intergenic
1070712670 10:78694046-78694068 CTGGCAGGGCCTGAGGAGGAAGG + Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071299309 10:84244746-84244768 AGGGGAGGGGAGCAGGAGGAGGG - Intergenic
1071514436 10:86287853-86287875 CTAGGATGGCAGAAGGTGGCTGG + Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071959759 10:90798763-90798785 CTTGGAGGTTAGAAGCAGGATGG - Intronic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1072428619 10:95351730-95351752 CTGGGCTGGCAGCAGGAGGCTGG + Intronic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1072523220 10:96248676-96248698 TGGGGAGGGCAGAAGAAGCAGGG - Intronic
1072552987 10:96493463-96493485 CTGTCAGGGCAGGAGCAGGAGGG + Intronic
1072584787 10:96772060-96772082 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1073042575 10:100617609-100617631 CTGGGAGGGAGGAAGGACTAGGG - Intergenic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073094726 10:100972666-100972688 CTAAGAGGTCAGAAGGAGGGAGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073319022 10:102602763-102602785 CCGGGAAGGCAGTGGGAGGAGGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074078823 10:110151960-110151982 GGGAGAGGGCAGGAGGAGGAAGG - Intergenic
1074432066 10:113402772-113402794 CTCAGACGGCAGAGGGAGGAAGG + Intergenic
1075339342 10:121633047-121633069 CTGGGAGGGGTGAAGAAGAATGG + Intergenic
1075341405 10:121649329-121649351 CCGGGAGGACGGAAGCAGGATGG + Intergenic
1075444214 10:122502662-122502684 CTGGGAGGCCAGAAGAAGAGAGG - Intronic
1075592909 10:123705396-123705418 CTGGGAGGGCAAAACCAAGAAGG - Intergenic
1076055687 10:127370397-127370419 GTGGGAGCGCAGCAGGAGGCTGG - Intronic
1076221947 10:128740889-128740911 GTGGGGTGGCAGAAGGAGGCTGG + Intergenic
1076259170 10:129051905-129051927 GTAGGAGGGCAGGGGGAGGAGGG + Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076610482 10:131723071-131723093 GTGGGAGGGCAGGAGGAGAGGGG - Intergenic
1076633050 10:131863578-131863600 CTGGGAGAGCCGAAGGGAGAAGG + Intergenic
1076694803 10:132242310-132242332 GGGGGAGTGCAGCAGGAGGACGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1076872788 10:133201851-133201873 CTGGGGCGGCAGCAGGCGGACGG + Exonic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077166469 11:1142017-1142039 ATGGGAGGAGAGAAAGAGGATGG + Intergenic
1077192603 11:1261729-1261751 CGGGGTGGGCAGCAGGAGCACGG - Exonic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077278864 11:1732958-1732980 CTGGGAGGGAAGAAAGTAGAGGG - Exonic
1077278929 11:1733260-1733282 ATGGGAGGGCAGGAGGCGGCGGG - Exonic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077292981 11:1808112-1808134 GTGGGAGGGCACATGGAGGGAGG + Intergenic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077353871 11:2105721-2105743 CTGAGAGGCCAGCAGGACGAAGG + Intergenic
1077518287 11:3015681-3015703 GTGGGTGGGCAGACAGAGGAGGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079361013 11:19770387-19770409 CTGGGAGGGTGGGAGGAGGGAGG + Intronic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1081279205 11:41187509-41187531 TGGGGAGGCCAGAAGGGGGATGG - Intronic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1082274628 11:50208121-50208143 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1083205538 11:61146573-61146595 CTGGGAGGGGAGGAGGAGGGAGG + Intronic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083504418 11:63142408-63142430 CTTGGAGGTCAGAAGCAAGATGG - Intronic
1083581917 11:63830483-63830505 CTGGGAGGGCAGGAGGTGGCTGG - Intergenic
1083730293 11:64649099-64649121 CTGGGAGGGGAGCAGGCAGATGG - Intronic
1083754703 11:64785212-64785234 ATGGGAGGCAAGAAGCAGGAGGG + Intergenic
1083771265 11:64868976-64868998 CTTGGAGGGCCGCGGGAGGATGG + Intronic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1083990025 11:66241317-66241339 CCGGGAGGGCAGGCTGAGGAAGG - Intronic
1083996793 11:66276902-66276924 CTGGCAGGGCAGAGGGCGGCAGG - Exonic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084104897 11:66975022-66975044 AGGGGAGGGGAGAAGGAGGGGGG + Intergenic
1084412638 11:69013302-69013324 GGGGGAGGGGAGTAGGAGGAGGG + Exonic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1084613689 11:70220423-70220445 CTTGGAGGCCAGAAGCAGGGCGG - Intergenic
1084977954 11:72813751-72813773 CTGGGAGGACAGGAGGCAGAAGG - Intergenic
1085023479 11:73223265-73223287 TTGGGAGGAAAGAAGGTGGATGG - Intronic
1085417703 11:76330247-76330269 CTGGGAGGGGAGGAGGGGGCTGG - Intergenic
1085442851 11:76579281-76579303 CTGGGAGGGAAGAGGCCGGAAGG + Intergenic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1086229200 11:84548190-84548212 CTGGCAGTGGAGAAGGAAGAAGG - Intronic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1086605909 11:88696114-88696136 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1086845860 11:91748943-91748965 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1087307883 11:96505847-96505869 CTGACAGGGCAGAAGGATAAAGG - Intronic
1087568697 11:99896121-99896143 CAGGGAGGGAACAAGGAGGTGGG + Intronic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1088422907 11:109668533-109668555 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089399707 11:118157353-118157375 GGAGGAGGGCAGAGGGAGGAGGG + Intergenic
1089558696 11:119332011-119332033 CTGGGAGGGAACAGGGTGGAGGG + Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089655631 11:119944667-119944689 AAGGGAGGGGAGTAGGAGGAAGG + Intergenic
1089691490 11:120189402-120189424 ATGGGAGGGCAGGAAGTGGATGG + Intergenic
1089696753 11:120220632-120220654 CTGGGAGGGCAGTCAGAGGAGGG + Intronic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090097545 11:123757747-123757769 CTGGGAGGCAAGAAAGAAGATGG - Intergenic
1090203282 11:124870766-124870788 GTAGGAGGGGAGAAGGAGGATGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090653580 11:128825973-128825995 CTGGCATGGAAGGAGGAGGAAGG + Intergenic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1091238493 11:134037140-134037162 CCGGGAGGGGAGCGGGAGGAGGG + Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091306296 11:134538400-134538422 ATGGCAGGGCAGAGGGAGGCAGG + Intergenic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091406024 12:210014-210036 CTGGGTGGGCAGGATGACGAGGG + Exonic
1091614568 12:2039771-2039793 GTGGGAGGGGAGAAGGAATAAGG + Intronic
1091754213 12:3041141-3041163 CGGGGAGGGCAGGAGGCGGCAGG + Intergenic
1091971047 12:4787498-4787520 TGGGGATGGCAGAGGGAGGAGGG - Intronic
1091972288 12:4797414-4797436 CTGAGAGTGCTGGAGGAGGAGGG + Intronic
1092229549 12:6769003-6769025 CGGGGAGGGCAGAAAGTGGGAGG + Intronic
1092264990 12:6974088-6974110 CTGAGAGGGAAACAGGAGGAAGG - Intronic
1092281475 12:7101118-7101140 GAGGGAGGGAAGAAGGAGGGAGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092982148 12:13807429-13807451 CAGGGAGGTGAGAAGGAGAAGGG - Intronic
1092984337 12:13831092-13831114 GTGGGAGAGCGGAAGCAGGAAGG - Intronic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1094203581 12:27817386-27817408 AAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1094472493 12:30816799-30816821 CTGGGAGGGGAGCAGGAAGAGGG + Intergenic
1094583714 12:31757851-31757873 CTTGGAGGTAAGAAGCAGGATGG + Intergenic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096142591 12:49254727-49254749 CAGGGAGGGGAGAAGGACTAGGG - Intronic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1096911271 12:54986757-54986779 ATGGGAGGGTAGAGGGTGGAAGG - Intergenic
1096979202 12:55718757-55718779 CTGGGAGGGAAAAAGGGGCATGG - Intronic
1097053924 12:56239044-56239066 TTGGGAGGGCAGAGGGTGGCGGG - Exonic
1097124980 12:56766805-56766827 CTGGGAGGGGTGAAGGGGAAGGG + Intronic
1097245364 12:57604946-57604968 CGGGGAGGGGAGGTGGAGGAGGG - Intronic
1097599579 12:61673999-61674021 AATGGAGGGCTGAAGGAGGAAGG + Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098554124 12:71799299-71799321 CTGGAAGGGTTGAAGGAGCAGGG - Exonic
1099694458 12:85999864-85999886 CTGGGAGGGGAGATGGAAGCTGG + Intronic
1099833251 12:87873112-87873134 CTGGGTTGGAAGACGGAGGAAGG - Intergenic
1100447932 12:94678504-94678526 GAGGGAGGGCAAGAGGAGGAAGG - Intergenic
1100836394 12:98570978-98571000 ATTGGACGGCAGGAGGAGGATGG + Intergenic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101630580 12:106489889-106489911 GTGGGAGGGGAGAAGGAGGCTGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101841311 12:108329269-108329291 CAGGGATGGCAGGAGGAGGTCGG - Intronic
1101876172 12:108598118-108598140 CGGGGAGGGAGGAAGGAGGAGGG - Exonic
1102466806 12:113135059-113135081 CTGGGAGGGGAGAAAGCGGGGGG - Intronic
1102764721 12:115422918-115422940 AAGGGAGGAGAGAAGGAGGAAGG + Intergenic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103235383 12:119368192-119368214 GGGGAAGGGCAGGAGGAGGAGGG + Intronic
1103515254 12:121503653-121503675 CTGAGAGGTGAGAAGGGGGAAGG + Intronic
1103844409 12:123891560-123891582 CTGAGAGGGCAGGCGGAGCACGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104004619 12:124883236-124883258 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1104092055 12:125525731-125525753 CTGGGAAGGAAGCAGGAGGCAGG - Intronic
1104320420 12:127745558-127745580 CTTGGAGGTTAGAAGCAGGACGG + Intergenic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1104480799 12:129106266-129106288 GTGGGAGGGCGGAGGGGGGAGGG + Intronic
1104852790 12:131885615-131885637 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
1105016287 12:132787972-132787994 CTGCGAGGGCAGGAGCAGGTCGG - Intronic
1105271275 13:18877450-18877472 CTGGGAGGGGCTAAGGAGTATGG - Intergenic
1105273933 13:18903986-18904008 GATGGAGGGCAAAAGGAGGATGG - Intergenic
1105792041 13:23811343-23811365 CTGAGAGGTTAGAAGCAGGATGG - Intronic
1105813822 13:24015944-24015966 ATCCGAGGGCAGAAGGACGAAGG - Intronic
1106013700 13:25848291-25848313 CTGGGAGGGGAGAGGCAAGATGG + Intronic
1106139759 13:27002332-27002354 CTGAAAGGGCAGAAGGGAGATGG + Intergenic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1106924537 13:34600314-34600336 CTGGGAGGTCTCATGGAGGAAGG - Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107689256 13:42935475-42935497 ATGGGAGGTATGAAGGAGGAGGG + Intronic
1107851641 13:44577344-44577366 CGCGGAGCGCAGGAGGAGGAGGG + Intergenic
1107861002 13:44660810-44660832 ATGGGAGGTCAGAGGGAGGGAGG + Intergenic
1107868510 13:44726667-44726689 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1108733539 13:53259061-53259083 CTGGGAGGGGAGAAAGGAGATGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109163046 13:59000285-59000307 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1109493932 13:63143161-63143183 GTGGGAGGGAGGAGGGAGGAAGG + Intergenic
1110143986 13:72167336-72167358 CTGGGAGTGCAGCAGCGGGAGGG + Intergenic
1110678013 13:78273362-78273384 CTGGTAGTTCAGAAAGAGGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111584583 13:90268298-90268320 TGGGGAGGCCAGAAGGGGGATGG + Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1112338542 13:98534338-98534360 CTTGGAGGGTAGAAGCAAGATGG - Intronic
1112590269 13:100757073-100757095 CTGGCATGGCAGAAGCAGAAGGG + Intergenic
1112737151 13:102433315-102433337 CTGGAAGGGCAGAGGAAGAAAGG + Intergenic
1112785592 13:102947883-102947905 CAGGCAGGGAAGTAGGAGGATGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113918420 13:113888880-113888902 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1114550720 14:23531424-23531446 CAGGGAGGGCAGCAGGATGTGGG - Intronic
1114626893 14:24136131-24136153 CGGGGAGGGCTGGAGGAGGCGGG - Intergenic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115522854 14:34250872-34250894 CTGGGAGGGCAGCAGACAGATGG - Intronic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1116133321 14:40889248-40889270 AAGGGAGGGAAGAAGGAGGGAGG + Intergenic
1116271598 14:42776629-42776651 CCAGGAAGGAAGAAGGAGGATGG - Intergenic
1116544058 14:46140749-46140771 TTGGAAGGGTAAAAGGAGGAGGG - Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117305890 14:54472776-54472798 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1117642628 14:57816363-57816385 CTGGGAGGGCTGAAAGAGTGGGG - Intronic
1118157088 14:63252853-63252875 CTGGGAAGGCCGAAGTGGGAGGG - Intronic
1118382630 14:65229871-65229893 CTGGGCGGGCCCACGGAGGAAGG - Intergenic
1118384284 14:65242786-65242808 CTTAGAGGGCAGGAGGAGGGAGG + Intergenic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118817671 14:69324465-69324487 CTGGGAGGGAAGCAGCAGGTTGG - Intronic
1118854360 14:69610080-69610102 CAGGGAGGGGACAAGGGGGAAGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119415657 14:74467711-74467733 CTGGCAGGGCAGTAGGAGCATGG + Intergenic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119726163 14:76922939-76922961 ATAGGAGGGAAGAAGGAGGAGGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119886565 14:78148490-78148512 CTGGGAGAGCAGAAGCGAGAAGG + Intergenic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120248840 14:82037574-82037596 CTAAGATGGCAGGAGGAGGATGG - Intergenic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120852581 14:89184810-89184832 ATAGGATGGCAGAAGGATGACGG - Intronic
1120871923 14:89345623-89345645 CTCGGAGGGGAGTAGGGGGAAGG - Intronic
1121103526 14:91265386-91265408 CTGGGAGGGCAGAAATGAGAGGG + Intergenic
1121123207 14:91389306-91389328 CGGGAAGGCCAGGAGGAGGATGG - Intronic
1121144616 14:91573637-91573659 CTGGCAGGGGAGGAGGAGGCTGG + Intergenic
1121582553 14:95041738-95041760 CTGGGGTGGCAGAAGTAGCATGG - Intergenic
1121592393 14:95125746-95125768 CAGGGAGGGGAGGAGGGGGAGGG + Intronic
1121658304 14:95614892-95614914 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1121664359 14:95660661-95660683 ATGGGAGGGGAGGAGGGGGAAGG - Intergenic
1121727766 14:96165716-96165738 CTGGGAGGGAAAGAGGAGGTGGG + Intergenic
1121832731 14:97066003-97066025 CAGGGAGGGAGGAAGGAGGGAGG - Intergenic
1122009249 14:98732158-98732180 CGGGGAGGGAAAGAGGAGGATGG + Intergenic
1122133363 14:99618905-99618927 CTGGCCGGGCAGGAGGAGCATGG + Intergenic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122538337 14:102481876-102481898 CTGGCAGGGTGGAAGTAGGAAGG - Intronic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1122948571 14:105027074-105027096 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1123068085 14:105628176-105628198 GTGGGGGGGCAGGAGGAGCAGGG - Intergenic
1202939850 14_KI270725v1_random:136513-136535 ATGGGAGAGAAGAAGGAGGGTGG - Intergenic
1123393274 15:19899364-19899386 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1123904322 15:24906956-24906978 AGGGGAGGGCAGAGGGAGGGAGG + Intronic
1124256526 15:28147023-28147045 CTGGGGGGGCCGCAGGAGGTGGG + Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1124567704 15:30832070-30832092 CTGGGGGGGCCGCAGGAGGTGGG - Intergenic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1124832330 15:33161330-33161352 ATTGGAGGGCAGATGGAAGAGGG + Intronic
1125533627 15:40429712-40429734 CTGGGAGGGCAGGAGTGGGCAGG + Intronic
1125555019 15:40577532-40577554 CTGGGAGGCCAGTCGGGGGATGG + Intergenic
1125685838 15:41562740-41562762 CTGGGAGTGGAGAAGGAGCTGGG + Intronic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1126023618 15:44426009-44426031 ATGGGAGGGCAGGGGGAAGATGG - Intergenic
1126222983 15:46236310-46236332 TTGGGAGGGCCGAAGGAGCATGG + Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126652835 15:50943034-50943056 CAGGGAGGGCAGGAGGGGAAAGG - Intronic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127145266 15:56016711-56016733 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1127151856 15:56083850-56083872 GTGGGGTGGCAGAAGGAGGGAGG + Intergenic
1127439106 15:58988136-58988158 CCTGGAGGGGAGAAAGAGGAAGG + Intronic
1127642508 15:60929265-60929287 GAGGGAGGGCTGGAGGAGGAGGG - Intronic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1128016953 15:64356100-64356122 GAGGGAGGGGAGAAGGCGGACGG + Exonic
1128264339 15:66253827-66253849 CTGGGAGGGAAGGAGAGGGAGGG - Intergenic
1129144329 15:73633355-73633377 CTGCGGCGGCAGGAGGAGGACGG - Exonic
1129426458 15:75467040-75467062 CTGGGAGGGATGAGGGAGGCAGG - Exonic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129720140 15:77873422-77873444 AGGGAAGGGGAGAAGGAGGATGG - Intergenic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1129891784 15:79076429-79076451 CTGAGAGGGCATGAGGAGCAGGG - Intronic
1129897763 15:79121287-79121309 CTGGGAGGGGACAAGGGGGTTGG + Intergenic
1130069496 15:80634619-80634641 CTGTGAGGGCACCAGGAGGCTGG + Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131676069 15:94671985-94672007 GTGGGAGGGAAGAGAGAGGAGGG + Intergenic
1131977702 15:97961787-97961809 GTAGGAGGGGAGGAGGAGGATGG - Intronic
1132156134 15:99496368-99496390 CAGGGAGGGCAGAAGGACAGAGG + Intergenic
1132307359 15:100826033-100826055 CAGGGAGGGGAGAAGAAGGTGGG - Intergenic
1132405904 15:101541766-101541788 CTGGCAGGGCACCAGGAGGCAGG + Intergenic
1132520304 16:384187-384209 AGGGGAGGGCAGTGGGAGGAGGG - Intronic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132826129 16:1906563-1906585 CCGGGAGCACAGACGGAGGAGGG + Intergenic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1132970109 16:2682974-2682996 CTGGGAGGGGAGGGTGAGGATGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133839258 16:9394026-9394048 GAGGGAGGGAAGAAGGGGGATGG - Intergenic
1133964359 16:10519703-10519725 AGGGGAGGGCAGGAGAAGGAAGG - Intergenic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1134260558 16:12647848-12647870 CTTGGAGGGTACAAGGACGATGG - Intergenic
1134612124 16:15617875-15617897 CTGAGAGGGGAGAATGGGGATGG - Intronic
1134868225 16:17628147-17628169 CTGGGTGAGGAAAAGGAGGAAGG - Intergenic
1135321992 16:21503203-21503225 CAGGGAGGGAAGAAAAAGGAAGG + Intergenic
1135662078 16:24305645-24305667 CTGGGTGGGGAGCAAGAGGAGGG + Intronic
1135700040 16:24624359-24624381 CAAGGAGGGCTGAAGAAGGAGGG + Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135937858 16:26796326-26796348 CCAGCAGGGCAGCAGGAGGAAGG + Intergenic
1136031194 16:27504301-27504323 AGGGGATGGCAGAGGGAGGAAGG + Intronic
1136036496 16:27544465-27544487 GGGGGAGGGGAGGAGGAGGAAGG + Intronic
1136114643 16:28087175-28087197 CTGGAAGGGCAGCAGGAGCTGGG + Intergenic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136333463 16:29596315-29596337 CAGGGAGGGAAGAAAAAGGAAGG + Intergenic
1136403560 16:30030915-30030937 CTGGGAGGGCCCGAGGAGGCGGG + Exonic
1136771626 16:32846141-32846163 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1136957675 16:34803922-34803944 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1137290906 16:47051314-47051336 CTAGCAGGGCAGAAGGAGCTGGG - Intergenic
1137374415 16:47940536-47940558 CTGGGATGGAGGATGGAGGATGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137401896 16:48160568-48160590 ATGTGAGGGGAGAAGGAGGTGGG + Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1138199807 16:55080273-55080295 CTGGGAGGTCTGAATGAGAATGG + Intergenic
1138245429 16:55463579-55463601 CTGGCAGGGTAGTAGGAGGAAGG + Intronic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138294825 16:55877133-55877155 GTGGGAGGGCAGAGGGAGCTTGG - Intronic
1138519894 16:57565011-57565033 CTGGAAGGGCAGCAGGAGAAGGG - Intronic
1139510988 16:67428515-67428537 CTGGCAGGGCAGAGGAATGAAGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1139986986 16:70906788-70906810 AGGAGAGGGCAGAAGGATGAGGG - Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140227982 16:73094008-73094030 CTGGCAGGGCAAAGGCAGGATGG + Intergenic
1140247795 16:73267168-73267190 GCGGAAGGGCAGAAGGAGAAGGG + Intergenic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140603611 16:76507353-76507375 ATGGGAGGCCAGTAGGAGGTGGG - Intronic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1141039515 16:80660966-80660988 CTGAGAGGGCAGGAAGTGGAGGG + Intronic
1141075654 16:81004680-81004702 CTGGGAGGGTAGAAGCGGTAGGG + Intronic
1141151141 16:81565427-81565449 CCAGGAGGGGAGCAGGAGGATGG - Intronic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141266988 16:82506667-82506689 TGGGGAGGGGCGAAGGAGGAGGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142251449 16:88993779-88993801 GGGGGAGGGAAGAGGGAGGAGGG - Intergenic
1142346594 16:89557978-89558000 CAGGGAGGGCAGAAGCAAGGGGG - Intergenic
1142351478 16:89582769-89582791 CTGGGAGGTCACAATGAGGTAGG - Intronic
1203074052 16_KI270728v1_random:1108252-1108274 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143504730 17:7357250-7357272 TGGGGAGGGCAGAGGAAGGATGG + Intergenic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143542949 17:7580380-7580402 CTCAGAGGGAAGAAGGAAGAGGG + Intronic
1143659553 17:8316096-8316118 CTGGAAGGGCAGTAGCAGGAAGG - Exonic
1143780369 17:9225919-9225941 CTGCGAGGCCTGGAGGAGGAAGG - Intronic
1143804638 17:9416281-9416303 CTGAGAGGCTAGAAGCAGGATGG - Intronic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1144180423 17:12746382-12746404 GTAGAAGGGCAGAAGGTGGAAGG + Intronic
1144238698 17:13288109-13288131 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1144472776 17:15559581-15559603 GGGGGAGGGGAGAAGAAGGAGGG + Intronic
1144923704 17:18785120-18785142 GGGGGAGGGGAGAAGAAGGAGGG - Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145101274 17:20079862-20079884 CTGGGTGGGCAGGAGGCGCAAGG + Intronic
1145369509 17:22297509-22297531 CTGGGAGGGCACAGGATGGAAGG - Intergenic
1145765635 17:27456674-27456696 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145868518 17:28255874-28255896 GTGGGAGGGAGGCAGGAGGAAGG + Intergenic
1145973073 17:28968307-28968329 CTGGGAGCTGAGAAGGAGGCAGG + Intronic
1146123726 17:30216265-30216287 AGGGGAGGGGAGAAGGAGAAGGG + Intronic
1146139966 17:30357266-30357288 CTGAGAAGGCAGCAGGGGGATGG + Intergenic
1146243567 17:31255830-31255852 CTGGGAGTGGAGAAGGAACAAGG - Intronic
1146289632 17:31598250-31598272 ATGGGAGGGAAGAAGGAGGTGGG + Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146472221 17:33133751-33133773 GGGGCAGGGTAGAAGGAGGAGGG - Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146623610 17:34419395-34419417 CTGAGAGGGTAGGAGGAGGAAGG + Intergenic
1146718137 17:35103453-35103475 CTGGGAGGTCAGCAGAGGGAAGG - Exonic
1146744297 17:35314208-35314230 CTGGGAGGGAACAAGGAGGCTGG - Intergenic
1146809144 17:35889521-35889543 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1146886574 17:36474780-36474802 CTGGGAGGGAAGGGTGAGGAGGG + Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147319384 17:39636817-39636839 TTGGGATGGCTGAAGGAGGCAGG + Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1147418633 17:40311085-40311107 CAGGGATGGCAGAAGGAAGGTGG - Intronic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147747276 17:42702523-42702545 CTGGGAGGGCTAAAGGACGTCGG + Exonic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1147925108 17:43941215-43941237 CTGGGAGGGAAGAGGCAGCAGGG + Intronic
1148029797 17:44611697-44611719 CTGGGACGGCTGGAGGAGAAGGG + Intergenic
1148793520 17:50186591-50186613 CTGGCATGGCAGGAGTAGGAGGG + Intronic
1148905067 17:50906804-50906826 CTGGGCGGGCAGAGGCAGAAGGG - Intergenic
1149446580 17:56717854-56717876 CTGGTAGGGCAGAAGGACACTGG - Intergenic
1149453683 17:56770222-56770244 CTTGGAGGCCAGAAGGAGCAAGG - Intergenic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1150125188 17:62630571-62630593 CTGGGAGGCCAGAATGGGGATGG + Intronic
1150129302 17:62658378-62658400 CTAGGATGTCAGAGGGAGGAGGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150472125 17:65446352-65446374 CTGGGAAGGCTGCAGGAAGAGGG + Intergenic
1150479189 17:65496600-65496622 GTGGGAGGGGCGCAGGAGGAGGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1150947610 17:69765399-69765421 AGGGGAGGGAAGAAGGGGGAGGG - Intergenic
1150947659 17:69765528-69765550 AGGGGAGGGAAGAAGGGGGAAGG - Intergenic
1151055320 17:71023930-71023952 GTGGGAGTGCAGAAGGAGCACGG - Intergenic
1151294684 17:73176151-73176173 CTGGGAGGGCAGAAGAAGCATGG - Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1151816558 17:76474142-76474164 CCTGGAGGGCAGAAGAAGGCTGG + Exonic
1151824980 17:76519178-76519200 GTGGGAGGGAGGATGGAGGAGGG - Intergenic
1152187077 17:78864266-78864288 GAGGGAGGGAAGAAGAAGGAAGG - Intronic
1152197914 17:78928377-78928399 CTGGGAGGGGACACGGCGGAGGG + Intergenic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152361977 17:79837040-79837062 CGGAGAGGGTAGAAGGGGGAAGG - Intronic
1152369578 17:79878051-79878073 CTGTGAGGGCATAAGAGGGAAGG + Intergenic
1152409069 17:80112853-80112875 CTGGGAGGGCAGAGTCAGGCTGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152523620 17:80875044-80875066 CGGGGAAGGCATAAGGAGGCAGG - Intronic
1153372276 18:4332798-4332820 CTGAGAGGTCAGAAGGAAAATGG - Intronic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1153998904 18:10466622-10466644 AGGGGAGGGCAGAATGAGGGAGG + Intronic
1154356873 18:13628064-13628086 CTCGGAGGGCACAGGGAGCAGGG + Intronic
1154465600 18:14641039-14641061 GATGGAGGGCAAAAGGAGGATGG - Intergenic
1154518294 18:15197723-15197745 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1155156932 18:23165517-23165539 CTGGGGGGGCAGGAGGAACAGGG - Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1156335437 18:36167518-36167540 CTAGGAGGGCAGCGGGAGGTAGG + Intronic
1156514932 18:37671387-37671409 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1156541304 18:37913688-37913710 CTGGGAGGGAAGGAGGAGACAGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157316396 18:46593557-46593579 ATGGGAGGGAGAAAGGAGGAAGG - Intronic
1157729133 18:49988711-49988733 CTGGGAAGGAAAGAGGAGGATGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157843708 18:50982837-50982859 AAGGGAGGGGAAAAGGAGGAGGG - Intronic
1157895685 18:51464650-51464672 CTGGGAGGACAGCAGGAGCTTGG + Intergenic
1157913383 18:51640090-51640112 CGGGGAGGGCAGTAGGAGACTGG + Intergenic
1157957880 18:52119200-52119222 CTGGGAGGCCAGAATCATGAAGG - Intergenic
1157959310 18:52134541-52134563 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1158103827 18:53861495-53861517 AAGGGAGGGCAGAAGGAAGGAGG + Intergenic
1158278204 18:55791910-55791932 GTGGGAGGGCAGGATGGGGAGGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158485090 18:57859094-57859116 TTGGCAGGGCAGAAGATGGAAGG - Intergenic
1158555345 18:58470366-58470388 CTGGGAGGGAGAGAGGAGGAAGG + Intergenic
1159310225 18:66698355-66698377 GAGGGAGGGGAGGAGGAGGAAGG + Intergenic
1159310249 18:66698427-66698449 GAGGGAGGGGAGGAGGAGGACGG + Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159705492 18:71680598-71680620 CTAGAAGGGAGGAAGGAGGAAGG + Intergenic
1159775713 18:72601258-72601280 CTTGGAGGTCAGAAGTAGGATGG + Intronic
1159935345 18:74361290-74361312 TAGGGAGGGAGGAAGGAGGACGG + Intergenic
1160018115 18:75159305-75159327 CTGAGGCGGCAGAAGAAGGAGGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160448637 18:78947002-78947024 GGGGGAGGGAGGAAGGAGGAGGG + Intergenic
1160450943 18:78965579-78965601 GTGGGAGGGCAGGGGGATGAAGG - Intergenic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1160685120 19:431019-431041 CTGGGAGAGCAGAGCGGGGAAGG - Intronic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160703437 19:518554-518576 CTGGGAGGGGACTGGGAGGAGGG + Intronic
1160799541 19:961293-961315 CCGGAAGGGAAGGAGGAGGAGGG + Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1160997188 19:1888245-1888267 ATGGGAGGGGGGAAGGAGGCTGG - Intergenic
1161046099 19:2135873-2135895 CTGGGAGGGAGGAGGGTGGAGGG - Intronic
1161050741 19:2162974-2162996 CTTGGAGGTTAGAAGGAAGAGGG - Intronic
1161085478 19:2333081-2333103 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161085516 19:2333202-2333224 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161222895 19:3126176-3126198 CTGGGAGGACAGACGGGTGAGGG + Intergenic
1161256675 19:3313706-3313728 CTTGGAGGCCAGGAGAAGGAAGG + Intergenic
1161320219 19:3637628-3637650 CCGGGTGGGCCGGAGGAGGAAGG + Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161453298 19:4358345-4358367 GAGGGAGGGCAGAAGTTGGAGGG - Intronic
1161535927 19:4818442-4818464 CTGGGCGTGCAGAAGGCGGGGGG - Exonic
1161614953 19:5264953-5264975 CTTGGAGGGCAGCAGGGGGTGGG - Intronic
1161932509 19:7350132-7350154 CTGGGAGGGGTGGGGGAGGAAGG + Intronic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162467138 19:10849075-10849097 GAGGGAGGGCAGGAGAAGGAAGG - Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162755213 19:12854039-12854061 CAGGGAGGGAGGAATGAGGAGGG - Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163327351 19:16613617-16613639 CTCTGAGGGCAGAAGGAGTCGGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163600911 19:18248436-18248458 CGGGGAGGGCAGAGGAAGGAGGG + Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163703182 19:18797094-18797116 GGGGGAGGGAGGAAGGAGGAAGG - Intergenic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164339316 19:24371994-24372016 CTGGGAGGGCTGCAGGAGACGGG - Intergenic
1164606874 19:29605967-29605989 CTGGGAGGGCGGAAATGGGACGG - Exonic
1164630790 19:29760281-29760303 CAAGGAGGGCAGCAGGAGGCAGG + Intergenic
1164785622 19:30928094-30928116 TTGGGAGGTCAGAAGCAAGATGG - Intergenic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1164811206 19:31157727-31157749 ATGGGAGGGCCCAAGGAGAATGG + Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165773084 19:38389499-38389521 CGGGAAGGGAAGAGGGAGGAAGG + Intronic
1166203650 19:41254583-41254605 AGGGGAGGGTAGAAGGTGGAGGG + Intronic
1166324837 19:42042756-42042778 CTGGGTGGGCAGAAGAAAGCAGG + Intronic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166571957 19:43802646-43802668 CTGGGAGGGGTGAAGGAAGAAGG - Intronic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167103210 19:47416703-47416725 CTGGGAGGGAAGAGAGAGGCCGG + Intronic
1167143412 19:47667706-47667728 CTGGCATGGAAGGAGGAGGAAGG - Intronic
1167292910 19:48634580-48634602 CTGGGAGGAAGGGAGGAGGAGGG - Intronic
1167452677 19:49581372-49581394 AGGGGAGGGGATAAGGAGGAGGG - Exonic
1167485884 19:49762815-49762837 TGGGGAGGGAAGAAGGAGAAGGG - Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167781758 19:51602880-51602902 GTGGGAGGGGAGAATCAGGAAGG - Intergenic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168098916 19:54130653-54130675 CAGGGAGGGGAGGAGGTGGAAGG + Intronic
1168168875 19:54573538-54573560 CTGGAAGGGCAGACGCAGGAGGG + Intronic
1168344648 19:55644251-55644273 CTGGGAGGGCACAAAGAGGAAGG + Intronic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
1202680197 1_KI270712v1_random:2656-2678 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925068649 2:950179-950201 AAGGGAGGGTGGAAGGAGGAGGG + Intergenic
925091107 2:1156663-1156685 AGGTGAGGGCAGAAGGACGAGGG + Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925357258 2:3250583-3250605 CTTTGAGGGCAGAAGCAGAATGG + Intronic
925395819 2:3533078-3533100 CTGAGAGGGCAGTGTGAGGAAGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925689842 2:6510714-6510736 CTGAGAGGGCAGGAGGAGCAGGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925907533 2:8548164-8548186 CGGGGAGGGGACATGGAGGAAGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
927278196 2:21279601-21279623 CAGGCAGGGTAAAAGGAGGAGGG - Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927599931 2:24431892-24431914 GTAGGAGGGCCAAAGGAGGAAGG - Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927747814 2:25638208-25638230 ATGGGATGGCAGGAGGGGGAGGG + Intronic
927929800 2:27036794-27036816 ATGGGAGGGCAGCAAGGGGAAGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928370334 2:30735906-30735928 CAGGGAGGGGAGAGGCAGGAGGG + Intronic
929061697 2:37930934-37930956 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929450659 2:42034923-42034945 CTGGGAGGACAGAAGGGTGGTGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929766516 2:44848277-44848299 CTGGGTGGGCTCAAGGAGGGAGG + Intergenic
929822458 2:45284317-45284339 CAGGGAGGGCAGGAGGGGAAGGG - Intergenic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
929918375 2:46154664-46154686 CTAAGAGGGCAGCAGGAGAAAGG - Intronic
930164442 2:48190368-48190390 CTGAGAGGCTAGAAGCAGGATGG + Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
930298880 2:49589872-49589894 CTGGGAGAGCAGTAATAGGAAGG + Intergenic
930699095 2:54441201-54441223 CTAGGAGGGAAGAAGGGAGAAGG - Intergenic
931216909 2:60253774-60253796 GTTGGAGGGCAGAAGAGGGAAGG - Intergenic
931239146 2:60437107-60437129 CTTGGAGGGAAGAAGCAGCAAGG + Intergenic
931412484 2:62046102-62046124 CTTGGAGGTCAGAAGCAAGATGG + Intronic
931427298 2:62182875-62182897 CTGGGAAGGGAAAAGGAGCAGGG - Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931765595 2:65453269-65453291 CTGGGAAGGAAGAAGGTAGAAGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932133939 2:69212208-69212230 AGGGGAGGGGAGGAGGAGGATGG + Intronic
932409266 2:71535533-71535555 CTCTGAGGGCAGAAGGAGCTGGG + Intronic
932449994 2:71803426-71803448 CTGGGAAGGAAGAAGAGGGAGGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
934541728 2:95180930-95180952 CTGGGAGTGAAGAAGGTGGCAGG - Intronic
934563874 2:95327832-95327854 CTGGGAGGGAAGAAGGAGCCAGG + Intronic
934654487 2:96110136-96110158 GTGGGAGGGCAGGAGAAGGTGGG - Intergenic
934871534 2:97871268-97871290 CTTGGAGGTCAGAAGCAAGATGG - Intronic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
935011175 2:99137577-99137599 GTGGGAGGGGAGAAGGGAGAGGG - Intronic
935037327 2:99391274-99391296 CTGAGAGGGAAGAAGGAGAGGGG + Intronic
935171014 2:100611629-100611651 CTGGCAGGGCAGAATGAAGCTGG + Intergenic
935185010 2:100723936-100723958 CTAAGAGGGCAGAAGCAGGCAGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936062759 2:109306420-109306442 CTGCAAGGGCAGCAGCAGGATGG - Intronic
936595464 2:113843088-113843110 CTGGCAGGGCTGAAAGAGAATGG + Intergenic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937386959 2:121443435-121443457 CTGGGAGGGGAGGAGGAGAGTGG - Intronic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938035527 2:128031815-128031837 CGTGGAGGTCAGAAGTAGGATGG - Intergenic
938118976 2:128620616-128620638 CTGTGAGGGCATTAGGAGGCAGG + Intergenic
938143271 2:128813220-128813242 TTGGGAGGGAAGCAGGAGGGAGG - Intergenic
938343841 2:130552780-130552802 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
938345992 2:130567942-130567964 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
938518206 2:132037953-132037975 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
939436214 2:142181055-142181077 TGGGGAGGCCAGAAGGAGGATGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
940692570 2:156937500-156937522 GAGGGAGGGAGGAAGGAGGAAGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941403088 2:165056097-165056119 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
941465137 2:165816703-165816725 TTGGAAGGGTAGAAGGTGGATGG + Intergenic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
941877425 2:170448269-170448291 CTTGGAGGTTAGAAGGAAGATGG + Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
941960338 2:171246928-171246950 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942249388 2:174034517-174034539 CTGGGATGCCGGAAGGAGGGTGG + Intergenic
942289591 2:174455622-174455644 ATGGGAGGTCAGGGGGAGGAGGG + Intronic
942860069 2:180598734-180598756 CTGGTAGGGAAGAAAGAAGATGG + Intergenic
942892338 2:181006394-181006416 CTGGAACGGCAAAAGGTGGAAGG - Intronic
943657965 2:190529316-190529338 CTGGGAGGGAAGGTGGAGGAGGG - Intronic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944145519 2:196503544-196503566 ACAGGAGGGCAGAAGGAGTAGGG - Intronic
944257790 2:197641401-197641423 CTGGGAGAGAAGAAGAGGGAGGG + Intronic
945049281 2:205807809-205807831 GTGGGAGGGCGGCAGGAGGGAGG - Intergenic
945090936 2:206174912-206174934 TTGGGAGGGGAGAGGGAGGGAGG + Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945901361 2:215541341-215541363 CTGGGAGGGATGGAGGAGGGTGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946179629 2:217941775-217941797 CTGGTGGGTCAGCAGGAGGATGG - Intronic
946193886 2:218022014-218022036 CCGGGAGGGCAGAGGGTGAAGGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946537951 2:220651746-220651768 CTGAGAGGGAAGAAGGAAGCCGG + Intergenic
947179423 2:227399021-227399043 GAGGGAGGGAAGAAGGAGGCAGG + Intergenic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
947742138 2:232489549-232489571 GAGGGAGGGCAAAAGGAGGGAGG - Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947802752 2:232941498-232941520 CTTGGAGGTTAGAAGGAAGATGG + Intronic
947914611 2:233823224-233823246 ATATGAGGGCAGAAAGAGGAGGG + Intronic
948006632 2:234614918-234614940 CTTGGAGGTTAGAAGGAAGATGG - Intergenic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948109165 2:235440575-235440597 CTGGGAGGAGGGATGGAGGAAGG - Intergenic
948181220 2:235982427-235982449 CTAGGAGGTCAGAAGGAAGGGGG + Intronic
948201939 2:236135898-236135920 CTGGGAGGGCAGCAGGAGGCAGG - Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948362391 2:237432307-237432329 CTGGGAGGCCGGAAAGATGAGGG - Intergenic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948610307 2:239162418-239162440 GTTGCAGGGCAGAAGGAGCAAGG - Intronic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
948800172 2:240429916-240429938 CAGGGAGGGAAGGAGGAGGGGGG - Intergenic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948902311 2:240962940-240962962 ATGGGGGGGCAGTGGGAGGAGGG - Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168890187 20:1290355-1290377 CTGGAAGGGAAGAAGGAACAGGG - Intronic
1168925262 20:1574127-1574149 CTGGGAGTGCTGAGGGAGGGAGG + Intronic
1168929140 20:1607155-1607177 CTGGGAGTGCTGAGGGAGGGAGG + Intronic
1169027225 20:2381234-2381256 CTCGGAGGACTGAAGGAGGCAGG + Intronic
1169244429 20:4015045-4015067 CTGGGAGGCTAGGAGGAGGATGG - Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169758720 20:9068726-9068748 CCGGGAGGCGAGAACGAGGAGGG + Intergenic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170117629 20:12877738-12877760 ATGGGAGGGCATATGGAGAAAGG + Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170519441 20:17168825-17168847 GTGGGAGGTCAGGAGGGGGAAGG - Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171020706 20:21581939-21581961 CTGGGAGGGCATCAAGAGGGTGG - Intergenic
1171021664 20:21589723-21589745 GTGGGAGGGGAGATGGAGAAAGG - Intergenic
1171282966 20:23916960-23916982 CTTGGAGGGGAGCAGGAGGCAGG - Intergenic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1171437786 20:25136511-25136533 GTGGAAGGGCAAAAGGAGGGAGG - Intergenic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1172189606 20:33054017-33054039 ATGGGAGGGCAGAAGGCAGTGGG - Intergenic
1172602829 20:36195595-36195617 GTGGGAGGGCTGAGGGAGGAGGG - Intronic
1173130740 20:40390888-40390910 CTGGGAGGGCAGAAGGAAAGTGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174094047 20:48073840-48073862 CTCCCAGGACAGAAGGAGGATGG - Intergenic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1174804495 20:53593869-53593891 CGGGGAGGGCGGAGGGAGGGAGG + Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175153358 20:56952972-56952994 CTGGGAGGGGAAAGAGAGGACGG - Intergenic
1175389395 20:58616839-58616861 AGGGGAGGGCAGAAGCAGAATGG - Intergenic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175553557 20:59832129-59832151 CTGGGAGGGCTGAGGCAGGGAGG - Intronic
1175574384 20:60049894-60049916 GTGGGAGGGCAGAGAAAGGAAGG - Intergenic
1175674563 20:60935622-60935644 AGGGAAGGGGAGAAGGAGGAAGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176126946 20:63479824-63479846 CTGAGAGGGCGTCAGGAGGAGGG + Intergenic
1176200028 20:63855910-63855932 CGGGGAGGGGAGAAGGTGCAGGG + Intergenic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176583339 21:8550572-8550594 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1176733488 21:10521909-10521931 CGGGGAGGGCGGAGGGAGGGAGG - Intronic
1176808957 21:13517443-13517465 GATGGAGGGCAAAAGGAGGATGG + Intergenic
1176910597 21:14560359-14560381 CTTGGAGGTCAGAAGCAAGATGG - Intronic
1177036307 21:16047297-16047319 GTGGGAGGGCATTAGGAGGTAGG - Intergenic
1177090689 21:16763764-16763786 CTGGGAGGGTAGCAGCAGGGAGG + Intergenic
1177776060 21:25567609-25567631 CTGAGAGGGCAAGAGAAGGAAGG + Intergenic
1177779571 21:25607786-25607808 CGCGGAGGGCTGAAGGCGGAGGG - Intergenic
1177844051 21:26268102-26268124 TGGGGAGGGCAAAAGGGGGATGG + Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178321611 21:31610323-31610345 TTGGCAGGGGAGAAGGGGGAAGG + Intergenic
1178321783 21:31611359-31611381 CTGGGAGGGCAAAAGAATGAAGG + Intergenic
1178372993 21:32042709-32042731 CAGGGCGGGCAGAAGGGGGTGGG + Intronic
1178699307 21:34819855-34819877 CTGGCGGGCCAGAAGCAGGATGG - Intronic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178909857 21:36665826-36665848 CTTGGAGGGCTGAGGCAGGAGGG - Intergenic
1178929419 21:36804626-36804648 TGGGGATGGCAGGAGGAGGAAGG - Intronic
1178966847 21:37128231-37128253 CTGGTATGGCAGGAGGAGCAGGG - Intronic
1179053191 21:37906818-37906840 AAGAGAGGGCAGAAAGAGGACGG - Intronic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179884984 21:44309996-44310018 CTGGTTGGGGAGAAGGCGGAGGG + Intronic
1179896102 21:44364591-44364613 CTGGGAGGGAGTAGGGAGGAAGG + Intronic
1179931673 21:44574905-44574927 CTGGGTTGGCAGGAGGAGGTGGG - Exonic
1179937077 21:44612791-44612813 CTGGGCTGGCAGGAGGAGGCAGG - Exonic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180185143 21:46135712-46135734 CTGGGAGGGGAGACTGGGGAGGG - Intergenic
1180230413 21:46423810-46423832 GTGGGAGGGGAGGAGGGGGAGGG + Intronic
1180266149 22:10527502-10527524 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1180729281 22:17969539-17969561 GTGGCAGGGAAGAAGGAAGAAGG - Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181644073 22:24221101-24221123 CTGGGAGGTTAGAAGCAAGATGG - Intronic
1181654250 22:24282433-24282455 CTGGGAGGTTAGAAGCAAGATGG + Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1181947501 22:26529479-26529501 CTGGGAGGGGAGAGGGGAGAGGG + Intronic
1181958539 22:26605882-26605904 GTGGCAGGGCAGAGAGAGGAAGG + Intronic
1182109918 22:27715655-27715677 CTGGGAGGGAAGAGGCAGGGAGG + Intergenic
1182153380 22:28047277-28047299 CTGGCAGGGCAGAAGCAGGATGG - Intronic
1182282018 22:29223313-29223335 AGGGGAGGGCAGAAGCAGGTGGG + Intronic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182456927 22:30457764-30457786 CTGGCAGGGAAGGAGGAGGGAGG - Intronic
1182468118 22:30530806-30530828 CTGGGAGTGCTGCAGTAGGAGGG - Intronic
1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG + Intergenic
1182662254 22:31933374-31933396 GTGGGAGGGAAGAAGGAGCAAGG - Intergenic
1183050596 22:35257749-35257771 TGGAGCGGGCAGAAGGAGGAGGG + Intronic
1183227726 22:36561916-36561938 CTGGGAGGGCTCAAGGCTGAGGG - Intergenic
1183249479 22:36719784-36719806 TTGGGAGGAGAGAATGAGGACGG + Intergenic
1183279012 22:36922380-36922402 GAGGGAGGGGAGCAGGAGGAGGG - Intronic
1183344098 22:37297492-37297514 CTGGGAGGGGGAAGGGAGGAAGG - Intronic
1183354174 22:37349601-37349623 AGGGCAGGGCAGGAGGAGGAAGG - Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183535520 22:38398551-38398573 CGGGGAGGGCGGAGGGAGGGAGG + Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183582502 22:38734301-38734323 CTGGGAAGGGACAAGGAGGTAGG - Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
1183734128 22:39634542-39634564 CTGGGAGGGGAAAAGGTGGAGGG - Intronic
1183754399 22:39746734-39746756 CTGGGAGGCCAGCAGGGGGAGGG + Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184096799 22:42320492-42320514 CTGGGACGGCTGTTGGAGGAAGG - Intronic
1184104610 22:42360170-42360192 CTGGGAGGACAGCAAGAGTAGGG - Intergenic
1184293425 22:43509781-43509803 GAGGGAGGGAAGGAGGAGGAAGG - Intergenic
1184490948 22:44808541-44808563 CTGGTAGGGCGGAGGGTGGAGGG + Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184735518 22:46395499-46395521 CTGGGAGTGGAGAGGGAGGTGGG - Intronic
1184768812 22:46586419-46586441 AGGGGAGGGCAGACAGAGGAGGG - Intronic
1184927883 22:47657022-47657044 CTGGGCGGGTAGAAGGAGTGTGG - Intergenic
1184952559 22:47854645-47854667 GTGTGAGGGTAGAAGCAGGAAGG - Intergenic
1184970937 22:48019400-48019422 GGGGCAGGGCAGAAGGAGAAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185362189 22:50414969-50414991 CTGGCAGGGGAAAAGGAGGCAGG - Intronic
949542935 3:5048289-5048311 CTGGGAGGGCAGAAAACAGAAGG - Intergenic
949812473 3:8020743-8020765 CCAGTAGGGAAGAAGGAGGAGGG + Intergenic
950522847 3:13506760-13506782 CTGGCAGGGCAGTGGGTGGATGG + Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
950853922 3:16088055-16088077 CTGGGAGCGAAGCAAGAGGAAGG + Intergenic
951080352 3:18444908-18444930 CGGGGGGGGGAGAAGGGGGAGGG + Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951607277 3:24449987-24450009 AAAGGAGGGAAGAAGGAGGAAGG + Intronic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
952509122 3:34036385-34036407 CTGGGAGGGGACTTGGAGGAGGG + Intergenic
952542047 3:34376991-34377013 GTCGAAGGGAAGAAGGAGGATGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953027283 3:39152567-39152589 CTGGGTGGGCAGCAGGAGACGGG + Intronic
953389963 3:42528213-42528235 GTGGGAGGGAAGAGGGAGGAGGG - Intronic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953546669 3:43868678-43868700 CTGGAAGGGTCAAAGGAGGAGGG + Intergenic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
953870127 3:46619112-46619134 ATGGGAGTGCAGAAGAGGGAGGG - Intronic
954060659 3:48063986-48064008 CTGGGAGGTTAGAAGCAGGATGG - Intronic
954420154 3:50414545-50414567 CTGGGAGGGCAGTGGAAGGGTGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955252158 3:57294576-57294598 TTGGGAGGGGAGAATGAGAAGGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957358690 3:79125849-79125871 CTGAGAGAGCATATGGAGGAGGG + Intronic
957555162 3:81757526-81757548 CTAGGATGGCAGCAGTAGGAAGG + Intronic
957834356 3:85567918-85567940 GTGGAAGGGCAGGAGGAGAAGGG + Intronic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958616054 3:96494430-96494452 GAGGCAGGGCTGAAGGAGGAGGG - Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959161920 3:102734422-102734444 CTTGGAGGTCAGAAGCAAGAGGG - Intergenic
959334921 3:105052076-105052098 GTTGGAGGAAAGAAGGAGGAAGG + Intergenic
960223333 3:115142909-115142931 ATGGGAGGGCTGGAGGAGGGAGG + Intronic
960249628 3:115437764-115437786 CTAGGAGGCCATTAGGAGGATGG - Intergenic
960290374 3:115877271-115877293 GTGGGAGGGAGGAAGGAGGCAGG - Intronic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
961061392 3:123831965-123831987 CTGGCAGGGGTGAGGGAGGAAGG + Intronic
961115463 3:124325417-124325439 TTGGCAGGGCTGAAGGAGGTAGG + Intronic
961218852 3:125183890-125183912 CTGAGAGGGATGAAGGGGGAAGG + Intronic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961504752 3:127362695-127362717 CAGGGAGGGAGGAAGCAGGAAGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961577415 3:127849257-127849279 CTGGGATGGCTGAAGGAGCTGGG - Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962431873 3:135327618-135327640 CTGAGAGGACTGAAGCAGGAAGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
962890225 3:139665350-139665372 CAAGGAGGGAAGAAGGAGGGAGG - Intronic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
964563963 3:158029403-158029425 CTGGGAAGGAAGAGGGAGGGAGG + Intergenic
965175356 3:165323257-165323279 CTGGGAGATCAGTAGGAGGTTGG + Intergenic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966597941 3:181742849-181742871 ATGGGAGGGTAGAAGAAGGGGGG + Intergenic
966711876 3:182980303-182980325 CGGGAAGGGGCGAAGGAGGAAGG + Intronic
966939218 3:184734950-184734972 ATGGGAGGTCAGTAGCAGGAAGG - Intergenic
966968602 3:185020708-185020730 TTGGGAGGCCAAAAGGAGGTTGG - Intronic
967282516 3:187835938-187835960 CTGGGATGGCATTAGGAAGATGG - Intergenic
967795038 3:193590703-193590725 CTTGGAGGTCAGAAGCAAGATGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968081492 3:195849564-195849586 GTGGGAGGGCAGGGGTAGGAAGG + Intergenic
968230826 3:197003579-197003601 CTGGAAGGGCAGCAGGGGAAAGG - Intronic
1202739227 3_GL000221v1_random:38985-39007 CTGGGAGGGGAGGGGGAGCATGG + Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
968606658 4:1538511-1538533 GTGGGAGGGCAGAGGTGGGAGGG + Intergenic
968628815 4:1639662-1639684 CTTGCAGGGCAGAGGCAGGAGGG + Intronic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968725785 4:2247261-2247283 CTGGGAGGCCTGACGGAGCACGG - Intergenic
968755324 4:2412906-2412928 CAGGCAGGGCAGACGGGGGAGGG - Intronic
968909040 4:3467276-3467298 GCGGGAGGGAAGAAGGAGGAGGG - Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
969350301 4:6594437-6594459 CTGGGAGGGCAGCTGGTGGAGGG + Intronic
969401247 4:6957021-6957043 CTGGGAGTGGAGCAGGAGCATGG + Intronic
969460204 4:7325000-7325022 ATGGGAGGGCAGAAGGCAGTGGG + Intronic
969573259 4:8022494-8022516 CTGGGGGGCCAGAATGAGGTGGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969718309 4:8879048-8879070 TTGGGAGGGCTGCAGGAGGTGGG + Intergenic
969847818 4:9933412-9933434 CTGGGAGAGCAAAAGGAGTTGGG - Intronic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
971231658 4:24804986-24805008 CGGGGAGGGGAGAAGAAGGTGGG + Intergenic
972027283 4:34398777-34398799 ATGGTAGAGTAGAAGGAGGAAGG + Intergenic
972108573 4:35525650-35525672 TGGGGAGGCCAGAAAGAGGATGG + Intergenic
972138136 4:35918819-35918841 ATGGGAGGGCATAATGAGTATGG + Intergenic
972649088 4:40998910-40998932 CTGGGCGGGATGAAGCAGGATGG + Intronic
972683068 4:41325483-41325505 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
972762622 4:42121912-42121934 CTGGGAGGAAAGCAGCAGGAGGG + Intronic
972894079 4:43597508-43597530 ATGGGAGGGTAGAAGGAGAGAGG - Intergenic
973555794 4:52081418-52081440 CCCTGAGGCCAGAAGGAGGAGGG - Intronic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
973723705 4:53751100-53751122 CTGGGAGGGAAGAAGGAAAAGGG - Intronic
973850575 4:54957672-54957694 CTGGTAGGCCAGAATGAGGCAGG - Intergenic
973856817 4:55019733-55019755 CTGGGAGGTGAGAAGGAGCAAGG - Intergenic
974468801 4:62292700-62292722 TTGCAAGGGCAGAAGGAAGAAGG - Intergenic
974955548 4:68636602-68636624 CTTGGAGGGTAGAAGGTGGGAGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976116533 4:81734048-81734070 CTCAGAGGGCAGAAAGAGCATGG + Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976217395 4:82728229-82728251 CTTGGAGGTCAGAAGCAAGATGG - Intronic
976246483 4:83010832-83010854 CGGGGAGGGGAGGAGGAGGAAGG - Intronic
976619147 4:87110856-87110878 CTGGGAGGGCAGATTGGGGGTGG + Intronic
976667485 4:87612434-87612456 CTAAGTGGGCAGAAGTAGGAGGG + Exonic
976842891 4:89452395-89452417 TTTGGAGGAGAGAAGGAGGAAGG + Intergenic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
977118577 4:93066959-93066981 CTGGGAGGGAAGAAGCAGCATGG + Intronic
978230474 4:106391842-106391864 GTGGGAGGCCAAATGGAGGAGGG - Intergenic
978340862 4:107720217-107720239 CCGGGAGGGTAGCAAGAGGAGGG + Exonic
978713677 4:111816347-111816369 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
979188666 4:117831763-117831785 ATGGGAGGCCAGAAGGGGAATGG + Intergenic
979399422 4:120230070-120230092 CTAGGAGGGAAGAGTGAGGAGGG + Intergenic
980438299 4:132809539-132809561 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
980857709 4:138460008-138460030 TGGGGAGGGGAGAAGGGGGAGGG - Intergenic
980859132 4:138479031-138479053 GGGGGAGGGGAGAAGGGGGAGGG - Intergenic
980875415 4:138657497-138657519 GAGAGAGGGCAGAAGGAGCAGGG - Intergenic
980893574 4:138839727-138839749 GTGGGAGGGCGGCAGGAGGGGGG + Intergenic
981229763 4:142338975-142338997 CCAGGAGGGGAGAAGGAGGTCGG + Intronic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981971999 4:150674765-150674787 CTTGGGAGGCTGAAGGAGGAGGG + Intronic
982248421 4:153379461-153379483 CTGGGAGGCCAAGATGAGGATGG + Intronic
982665375 4:158254513-158254535 CTGGGGCGGCTGAAGTAGGAGGG + Exonic
984053402 4:174895559-174895581 ATTGGAGGGTAGAAGGTGGAGGG + Intronic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703736 4:182833870-182833892 AGGGGAGGGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703988 4:182834592-182834614 AGGGGAGGGGAGAAGAAGGAGGG - Intergenic
984703995 4:182834611-182834633 AGGGGAGGGGAGAAGAAGGAGGG - Intergenic
984767270 4:183409157-183409179 CTTGGAGGGCAAGAGGTGGAGGG - Intergenic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
985259012 4:188097681-188097703 CTGGGAGGGCAGTGGGAGCCAGG + Intronic
985339486 4:188934104-188934126 CTTGGAGGCTAGAAGCAGGATGG - Intergenic
985433085 4:189900319-189900341 GGGGCAGGGCAGGAGGAGGACGG - Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985524479 5:395033-395055 TTGGGAGGGCAAAGGCAGGACGG + Intronic
985629376 5:1006814-1006836 CTGGGAGGACAGGTGGAGGTGGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985669839 5:1201600-1201622 CAGGCAGGGCAGAAGCTGGAGGG - Exonic
985783192 5:1881430-1881452 CTGGGAGGACAGGAAGAGGGAGG + Intronic
986040311 5:3987892-3987914 ATGGAAGGGCAGATGGAAGAAGG + Intergenic
986296671 5:6445079-6445101 CTGAGATGGAAGAAGGAGGGGGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987033110 5:13993980-13994002 CTCAGAGGTCGGAAGGAGGAAGG + Intergenic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
989410472 5:41114088-41114110 ATAGGAGGAAAGAAGGAGGATGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
991410401 5:66339835-66339857 CTTGGAGGTTAGAAGCAGGATGG + Intergenic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992174873 5:74139899-74139921 ATGGGAGCTCAGAAGGAGCAGGG + Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
992678959 5:79134089-79134111 CAGGGAGGGAGGAAGGAGGGCGG + Intronic
992688976 5:79224775-79224797 CTTGGAGGTCAGAAGCAAGATGG + Intronic
992892187 5:81213627-81213649 CTTGGAGGGCAAAATGAAGATGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993909307 5:93661905-93661927 CTGAGTGGGCAGAAAGAGTAAGG + Intronic
994237752 5:97384447-97384469 GTGGGAGGGGAGGTGGAGGATGG - Intergenic
994239009 5:97398797-97398819 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
994332775 5:98526826-98526848 CTGGGAGGCCATTAGGAGGAAGG - Intergenic
994665930 5:102705237-102705259 CTCATATGGCAGAAGGAGGAAGG - Intergenic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995915116 5:117236245-117236267 CTGGGAGGGCAAAGGGAGTTGGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996917395 5:128728849-128728871 TTGGGAGGGGAGCAAGAGGAGGG - Intronic
997376738 5:133402931-133402953 CGGGGAGGGAAGGAGGCGGAAGG + Intronic
997964408 5:138346007-138346029 CTGTGAGGGCTGAAGCAAGATGG + Intronic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998447566 5:142210646-142210668 GAGGGAGGGGAGAGGGAGGAAGG - Intergenic
998563098 5:143190011-143190033 TTTGGAGGACAGAAGGAGGGGGG + Intronic
998630065 5:143888356-143888378 CTCAGAGTGAAGAAGGAGGAGGG + Intergenic
998921992 5:147079686-147079708 CTGGGAGGGTGGTAGGAAGATGG + Intronic
999244591 5:150147237-150147259 TGGGGAGGGCAGCAGCAGGATGG - Intronic
999328971 5:150660120-150660142 CTGGAAGGGGAGGAGCAGGAGGG - Intergenic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999496534 5:152104432-152104454 CTGGGAAGGCACCAGAAGGAAGG - Intergenic
999922356 5:156335652-156335674 CTTGGAGGGCAGGAGGGGGATGG - Intronic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000475706 5:161704310-161704332 CTGGGAGGACACAATGAGGCTGG + Intergenic
1000772029 5:165366295-165366317 GAGGGAGGGCGGAGGGAGGAAGG + Intergenic
1001076009 5:168628678-168628700 GAAGGAGGGCAGGAGGAGGAAGG - Intergenic
1001206626 5:169769446-169769468 CTGGGATGGTAGAAAGAGAATGG + Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001437961 5:171715172-171715194 CTGTGAGGCCTGAAGAAGGAAGG + Intergenic
1001849281 5:174949761-174949783 CTGGGAGGCCAGGAGGATGCAGG + Intergenic
1002042283 5:176523483-176523505 GGGGGAGGGGAGGAGGAGGAGGG - Intergenic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002306692 5:178287713-178287735 CTGGGATGTCAGAAAGAGTAGGG - Intronic
1002423253 5:179161290-179161312 TTGGGATGGCACAAGAAGGAAGG + Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002719014 5:181246777-181246799 CTGGGAGGGACGGAGGGGGATGG - Intronic
1002862596 6:1093532-1093554 CTGGGAGGGGAGAGAGAGGGAGG - Intergenic
1002947740 6:1779141-1779163 CTGAGAGGGCTGCTGGAGGAAGG - Intronic
1003052250 6:2790620-2790642 CTGGGAGAGCAGGAGGTGGCCGG + Intergenic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003414819 6:5898383-5898405 GAGGGAGGGCAGGAGGAGGGAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004358980 6:14954313-14954335 CTTGGAGGGTAGAAGCAAGATGG - Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004746192 6:18511223-18511245 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1004751372 6:18565772-18565794 GAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1005276466 6:24224585-24224607 CTGGGGTGGCAGAAGCCGGAAGG + Intronic
1005292997 6:24397381-24397403 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1005870726 6:29972616-29972638 CTGGGAGGGCAGGAGGATGGAGG + Intergenic
1006093951 6:31644386-31644408 CAGGGAGGGCAGCTGGATGAGGG + Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006340543 6:33443998-33444020 CAGGGAGGGAAGAAGGAGATGGG + Intronic
1006440639 6:34051639-34051661 CTGGGAGGAAAGGAGGAGGCAGG + Intronic
1006642060 6:35494666-35494688 CTGGGCGGGGAGGAGGAGGAGGG + Intronic
1006699752 6:35962477-35962499 AGGGGAGGGCAGAGGGAGGTTGG - Intronic
1006731013 6:36236144-36236166 TGGGGAGGCCAGAAGGAGGATGG - Intergenic
1006745593 6:36339674-36339696 CTGGGAGGGAAGATGGCAGAGGG + Intergenic
1006832919 6:36979648-36979670 CTGGAAGGAGAGGAGGAGGAGGG + Intronic
1006939777 6:37744078-37744100 GTACGAGGGAAGAAGGAGGAGGG - Intergenic
1006944929 6:37778701-37778723 CTGGCAGGGCACATTGAGGAAGG + Intergenic
1007208576 6:40172693-40172715 CTGGGAGGGCATTGGGAGGTGGG + Intergenic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007947219 6:45837393-45837415 CTGGGAAGCAAGAAGGAGCATGG + Intergenic
1008138872 6:47808807-47808829 TTGGGCGGGCAGAGGAAGGAAGG + Intronic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1009828392 6:68897593-68897615 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1009828422 6:68897724-68897746 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010831926 6:80541520-80541542 GTGGGAGGCAAGAAGGAAGATGG - Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1011078421 6:83462885-83462907 TTGGGAGGGCAGGAGGAGTTGGG + Intergenic
1011410503 6:87061312-87061334 GTGGAAGGTGAGAAGGAGGAGGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011598000 6:89034624-89034646 CGGGGAGGGCATAGAGAGGAGGG + Intergenic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011965968 6:93157503-93157525 CGGGGAGGGAAGAAGGGGGTTGG - Intergenic
1012603668 6:101130889-101130911 CTGGGTGGCAAGAAGGGGGAAGG + Intergenic
1013273161 6:108560789-108560811 CGGGGCGGGGAGAAGGGGGAGGG - Intronic
1013588569 6:111601117-111601139 TTGGGAGGGAAGAAAGGGGATGG + Intronic
1013657588 6:112261504-112261526 CTGAGAGAGCAGTAGGAGGCTGG - Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014315253 6:119856545-119856567 AAGGGAGGGGGGAAGGAGGAAGG - Intergenic
1014657283 6:124123305-124123327 ATTGGAGGGGAGAAGGAGGCAGG + Intronic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1015227010 6:130869478-130869500 CTGGGAGGACAGGAGAAGAAAGG + Intronic
1015281548 6:131440197-131440219 CTGGAAGGTCAGCGGGAGGATGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1015916724 6:138225006-138225028 GTGGGAGGGCAGTGGTAGGATGG + Intronic
1016021002 6:139236046-139236068 TGGGGAGGCCAGAAGGGGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016430858 6:143983776-143983798 GTGGGAGGACAGATGGAGAATGG + Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017096904 6:150812716-150812738 ATGGCAGGGAAGGAGGAGGAAGG + Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017359180 6:153545966-153545988 TGGGGAGGGCAGAAGGAGCATGG - Intergenic
1017456333 6:154604479-154604501 CTGGGAGGGGACAGGGAGGCAGG - Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017817786 6:158027858-158027880 TGGGGAGGGCAGAGGCAGGATGG + Intronic
1017864352 6:158429946-158429968 CTGGGAGGGAAGAAAGGGGCAGG + Intronic
1018058350 6:160071105-160071127 CTGGGAGGGAAGGATGAGGGTGG + Intronic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018726468 6:166616654-166616676 CTGGCCTGGCAGAGGGAGGATGG - Intronic
1018863431 6:167729903-167729925 GTGTGAGGGCAGGAGGTGGATGG + Intergenic
1018900258 6:168048364-168048386 CTTCAAGGTCAGAAGGAGGACGG - Intergenic
1019215192 6:170438840-170438862 CTGGGAGGTCAGAAGGCTGGGGG + Intergenic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1019624745 7:2010284-2010306 CTGGGAGGTCACGGGGAGGAAGG + Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019846789 7:3510636-3510658 ATGGGAGGGAAGAAGGGGGGAGG + Intronic
1020152840 7:5696785-5696807 CTGGGAGGGCTGTAGGAGGACGG + Intronic
1020267572 7:6571519-6571541 CTTGGAGGTTAGAAGTAGGATGG + Intergenic
1020510527 7:9050783-9050805 CTGGGAGGAGAGAAGAATGAGGG + Intergenic
1020595920 7:10207426-10207448 CCGAGAGGGCAAAGGGAGGAAGG - Intergenic
1021121196 7:16797560-16797582 TGGGGAGGAGAGAAGGAGGATGG + Intronic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1023628090 7:42136682-42136704 CGGGGAGGGCAGAGGTAGCAAGG + Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023818986 7:43969906-43969928 CTGGTAGGGCTGAGGGTGGAGGG - Intergenic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1023932425 7:44713928-44713950 CTTGGAGGTCAGAAACAGGATGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024099068 7:46010704-46010726 CTGGGAGGGCAGCAAGAGAAAGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024255868 7:47539644-47539666 CTGGGAGGTCAGATGGGGGGCGG - Intronic
1024903965 7:54354693-54354715 GTAAGAGGGAAGAAGGAGGAGGG - Intergenic
1024971766 7:55078172-55078194 TGGGGAGGGGAGAAGGAGCAAGG + Intronic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025553369 7:62275626-62275648 ATGGGAGGGAAGAAGGAGAGCGG - Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1025840385 7:65141208-65141230 ATGGGAGAGAAGAAGGAGGGCGG + Intergenic
1025878329 7:65508956-65508978 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025882672 7:65554756-65554778 ATGGGAGAGAAGAAGGAGGGCGG - Intergenic
1025890771 7:65647847-65647869 ATGGGAGAGAAGAAGGAGGGCGG + Exonic
1026205670 7:68255321-68255343 GGAGGAGGGGAGAAGGAGGAGGG - Intergenic
1026742941 7:72990331-72990353 CTGGGAGCCCAGAAGGTGGGGGG + Intergenic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027100794 7:75374747-75374769 CTGGGAGCCCAGAAGGTGGGGGG - Intergenic
1027228796 7:76260675-76260697 CTGGGAGGGCAGAGGGGGACTGG - Intronic
1027269600 7:76512458-76512480 GTGAGAGGGCAGAAGGGGGCTGG - Intronic
1027320310 7:77006352-77006374 GTGAGAGGGCAGAAGGGGGCTGG - Intergenic
1027579834 7:79978402-79978424 CTTGGAGGTTAGAAGGAAGATGG + Intergenic
1027649913 7:80853615-80853637 CTGGGAGGGTAGTGGCAGGAGGG + Intronic
1027855224 7:83502495-83502517 CATGGAGGTCAGAAGGAGGTGGG - Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1028730906 7:94147282-94147304 CTTGGAGGGAAGAAGGGAGATGG - Intergenic
1029101044 7:98130203-98130225 CTGGGAGGTCAGAAGTAGCCAGG + Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029158388 7:98533519-98533541 ATGAGCGGGCAGACGGAGGAAGG - Intergenic
1029262776 7:99314625-99314647 GTGGGAGAGCAGGAGGAGGTAGG + Intergenic
1029375399 7:100174294-100174316 CTGGGAGGTCAGGTAGAGGATGG + Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029478361 7:100798636-100798658 CAGGGAGGGCAGAAGGAACAGGG + Intergenic
1029535304 7:101154424-101154446 GAGGGAGGGCAGCAGGAGAAAGG + Exonic
1029620612 7:101688082-101688104 CTGGGAGTGCAGCAGGGGGGTGG - Intergenic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030035518 7:105405310-105405332 AGGGCAGGGGAGAAGGAGGAGGG + Intergenic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030198749 7:106880156-106880178 CTGTTAGGGCAGAAGGTGAATGG + Intronic
1030745537 7:113161094-113161116 CTGGAATGGTAGAATGAGGATGG - Intergenic
1030783083 7:113625755-113625777 AGGGGAGGGGAGAAGGGGGAAGG - Intergenic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031922636 7:127612985-127613007 CTGAGCGGGCAGATGGATGATGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032475301 7:132207693-132207715 TTGTGATGGCAGAAGGAGGTGGG - Intronic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1032708701 7:134444071-134444093 GTGGGAGGGGAAAAGGAAGACGG + Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033505463 7:141995283-141995305 CTGGGAGGTTAGAAGCAAGATGG + Intronic
1033970620 7:147034691-147034713 TGGGGAGGTCAGAAGGGGGATGG + Intronic
1034067766 7:148153124-148153146 CTGTGAGGCTAGAAGCAGGACGG + Intronic
1034228629 7:149501765-149501787 TGGAGAGGCCAGAAGGAGGATGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034427064 7:151019528-151019550 AAGGGAGGGCAGAAAGAGAAAGG - Intronic
1034427922 7:151024215-151024237 GTGGGAGGGGAAAATGAGGAGGG + Exonic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1034605331 7:152307390-152307412 AAGGGAGGGGAGAAGGAAGAAGG + Intronic
1034686769 7:152978706-152978728 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1034752373 7:153582873-153582895 TGGGGAGGGCAGAATGGGGATGG + Intergenic
1034763596 7:153696467-153696489 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1034897356 7:154886084-154886106 CTGGGAGCAGAGAAGGAGGGCGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035016915 7:155774696-155774718 ATGGGAGGGCACAGGAAGGAGGG - Intronic
1035108016 7:156458223-156458245 CGGGGAGGGCAGAGGAAGAAAGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035395069 7:158529393-158529415 AGGGGAGGCCAGCAGGAGGACGG + Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036137473 8:6175184-6175206 CTCGGAGGACAGGAGGAGGCTGG + Intergenic
1036424226 8:8628487-8628509 CAGGGAGGGCAGAAGGAAAATGG - Intergenic
1036487229 8:9190218-9190240 ATGGGAGGGAGGAAAGAGGAAGG - Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036544828 8:9757564-9757586 CTGGGAAGGAAGGAGCAGGAAGG - Intronic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036663049 8:10720862-10720884 CGGGGAGGGGGGAAGGAGGGAGG - Intergenic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1036763347 8:11528419-11528441 CTTGGAGGTCAGAAGCAAGATGG + Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037454210 8:19047494-19047516 CTGGGAGGTAAGAATGTGGAGGG + Intronic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037834061 8:22205970-22205992 CTGGGAGGGTAGCAGGAGTGGGG + Intronic
1037859298 8:22393252-22393274 GTGGGAGGGCAAGAGGAGGCAGG + Intronic
1037883933 8:22586446-22586468 CTGGGAGGGGAGGGGAAGGAAGG + Intronic
1038440409 8:27567475-27567497 CTGGGAGGGCGCAAGAATGATGG - Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038842454 8:31197755-31197777 GGGGGAGGGGAGAAGGAGGCAGG - Intergenic
1038965068 8:32562609-32562631 CTGAGAGGGCTGAAGGATGACGG + Intronic
1039043478 8:33429578-33429600 GGGGGAGGGCAGATGGAGGAAGG + Intronic
1039611872 8:38926015-38926037 CTGAGAGGACAGAAGTGGGAGGG - Intronic
1040386288 8:46917016-46917038 CTGGGAGGTTAGAAGCAAGATGG - Intergenic
1040855982 8:51948302-51948324 CTGGGAGGGCAGAAGCAAGATGG + Intergenic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1041020848 8:53636809-53636831 GTGGGAGGGGGGAAGGAGAAGGG - Intergenic
1041063326 8:54057659-54057681 CTGGAAGGGTAGAAGGGGGCTGG + Intronic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041714426 8:60921441-60921463 CCGGGAGGGCAGGGGGAGGAGGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042040547 8:64584516-64584538 GAGTGAGGGCAGAAGGAGGGAGG + Intergenic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1042517439 8:69674299-69674321 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042564569 8:70099070-70099092 AGGGGAGGGGAGAAGGAGGGAGG + Intergenic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1042824429 8:72965716-72965738 CTGCGAGGCCAGAAGCAGGATGG + Intergenic
1042948095 8:74174875-74174897 CTGTGAGGCTAGAAGCAGGATGG + Intergenic
1043260496 8:78188515-78188537 AGGGGAGGGGAGAAGGAGAAGGG + Intergenic
1043296382 8:78668151-78668173 GGGAGAGGGGAGAAGGAGGAAGG - Intronic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1045010160 8:97951815-97951837 CGGGGAAGGGAAAAGGAGGAAGG - Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045317132 8:101052864-101052886 ATGGCAGGGCAGAGGGAGGATGG - Intergenic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046465400 8:114595794-114595816 TTGGGAGGGATGAAGGAGAATGG - Intergenic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046719975 8:117608424-117608446 GAGGGAGGGGGGAAGGAGGAAGG - Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047047327 8:121069581-121069603 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047632424 8:126722782-126722804 GTAGGAGGGAAGAAGGGGGATGG - Intergenic
1047826498 8:128582026-128582048 GAGGGAGGGAGGAAGGAGGAAGG - Intergenic
1047938520 8:129804983-129805005 CTGGGAGGTCAGAAGGGGTGGGG + Intergenic
1048274639 8:133057058-133057080 CGGGGAAGGAAGAAGGAGGTAGG - Intronic
1048292711 8:133192697-133192719 CTGGGAGGGCAGGGAGAGGATGG + Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048477094 8:134753262-134753284 TTGGGGGGGCAGAGGGAGGGTGG + Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048837862 8:138538306-138538328 CTGAGAGTGGAGAAGAAGGAAGG + Intergenic
1048840032 8:138557607-138557629 GAGGGAGGGAAGAAAGAGGAAGG + Intergenic
1048841287 8:138568673-138568695 AAGGGAGGGAGGAAGGAGGAAGG + Intergenic
1049027843 8:140008684-140008706 CTGGGAGGCCAGGAGGTGGCAGG - Intronic
1049257547 8:141621915-141621937 CTGGGAGGCCAGGAGTCGGAAGG - Intergenic
1049370261 8:142261021-142261043 CAGGGAGGAGAGAAAGAGGAGGG + Intronic
1049370313 8:142261199-142261221 AAGGGAGGGGAGAGGGAGGAGGG + Intronic
1049372193 8:142273217-142273239 CTGGGACGGCAGGAGGACGATGG - Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049428783 8:142549698-142549720 CTGGGAGTGCATAAGTGGGAGGG + Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049824743 8:144661533-144661555 TTGGGAGGGGAGAAAGGGGAAGG - Intergenic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1049959199 9:722065-722087 CTTGGAGGTCAGAAGTAAGACGG - Intronic
1050077018 9:1875996-1876018 ATGGGAGGGCAGGAGGCCGAGGG + Intergenic
1050085100 9:1957141-1957163 CTGGGAAGGCAGGAAGCGGAAGG - Intergenic
1050130418 9:2406551-2406573 CTGGGGGGCCAGGAGCAGGAAGG + Intergenic
1050224380 9:3434686-3434708 TTTGGAGTGCAGAAGGAGGGTGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050429566 9:5548913-5548935 ATTGGAGGCCAGAAAGAGGACGG - Intronic
1050472603 9:6008172-6008194 CTGGGAGGGGGCGAGGAGGAAGG + Intergenic
1050517617 9:6461372-6461394 GGGGGAGGAGAGAAGGAGGAGGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1052112741 9:24608956-24608978 AAGGGAGGGTAGAAGGGGGAGGG - Intergenic
1052141880 9:24995908-24995930 CTGGGAAGGCAGCAGGATTAAGG + Intergenic
1052311109 9:27070215-27070237 CTGGGTGGGAAGGAGTAGGATGG + Intergenic
1052778124 9:32753686-32753708 GTGGGAGGGCAGGAAGAGAAAGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1053144718 9:35704590-35704612 CTGAGAGGGCTGGAGGAGGATGG + Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053379307 9:37636009-37636031 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
1053379922 9:37640290-37640312 CTGGTAGGGCTGAAGCAGGAGGG + Intronic
1053423843 9:37998203-37998225 CTTGGAGGGAGGAGGGAGGAGGG + Intronic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1054925998 9:70589367-70589389 TTGGGATGGGAGAAGGAGGGAGG - Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055151885 9:73010331-73010353 CTGGGAGTGCTGAAGGAAGCCGG + Intronic
1055686558 9:78781480-78781502 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1056010250 9:82321700-82321722 CTGGGAGGGCAGGGGGTGGGAGG - Intergenic
1056215137 9:84399472-84399494 CTTGGAGGTCAGAAGTAAGATGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056562349 9:87742676-87742698 CTTGGAGGTTAGAAGCAGGATGG - Intergenic
1056571469 9:87820424-87820446 CTGGGAGGTGAGAAAGAAGAGGG + Intergenic
1056831433 9:89920305-89920327 CTGGGAGGCCAGGTGGAGGGTGG + Intergenic
1056897562 9:90565255-90565277 AGGGAAGGGGAGAAGGAGGAGGG - Intergenic
1057519875 9:95752144-95752166 CTGAGAGGGCAGCGGGAGGGGGG - Intergenic
1058070609 9:100597626-100597648 CTGTGAGGGCTGAAGGATGAAGG - Intergenic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058102542 9:100933264-100933286 CGGGGAGGGAAGAAGGGGGCAGG - Intergenic
1058341663 9:103904784-103904806 AAGGGAGGGGAGAAGGAGGGAGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058946035 9:109857146-109857168 GTTGGAGGACAGGAGGAGGAAGG - Intronic
1058960461 9:109988553-109988575 GAGGGAGGGAGGAAGGAGGAAGG + Intronic
1059347239 9:113637316-113637338 CGGCCAGGGCAGAAGGAAGAGGG - Intergenic
1059352709 9:113676940-113676962 CTGGGGGGGCAGGTGGAGGTGGG + Intergenic
1059479240 9:114575622-114575644 ATGGGAGGGCAGCAGGAGAATGG - Intergenic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1060098892 9:120819935-120819957 CTGGGAGGGAATAAGGAAAATGG - Intronic
1060446185 9:123690150-123690172 GAGGGAGGGAGGAAGGAGGAGGG + Intronic
1060506664 9:124202925-124202947 CTGGAAGGGGTGAGGGAGGAAGG + Intergenic
1060776284 9:126377031-126377053 CTGGCACTGCAGAAGGCGGAGGG - Intronic
1060795247 9:126508612-126508634 ATGGGAGGGTTGGAGGAGGAGGG - Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1060953684 9:127622158-127622180 GGGGGAGGGCAGAATGGGGAGGG + Intronic
1060999068 9:127892210-127892232 CTGTGAGGTCAGAAACAGGATGG - Intronic
1061243319 9:129386958-129386980 CTGCCAGGGAAGAAGAAGGATGG - Intergenic
1061244642 9:129395144-129395166 ATGGGAGGATAGATGGAGGATGG + Intergenic
1061257345 9:129460422-129460444 GCGGGAGGGCGGAGGGAGGAAGG - Intergenic
1061258794 9:129467817-129467839 GTGGGAGGGAAGAAGGAGGCAGG - Intergenic
1061261223 9:129482162-129482184 CTGGGAGGGGAGAGGGGGGCGGG - Intergenic
1061313616 9:129779965-129779987 AGGGGAGGGAGGAAGGAGGAAGG + Intergenic
1061315947 9:129795856-129795878 CTGGGAGGTCAGAGGAAGGAGGG + Intergenic
1061368228 9:130183427-130183449 CTGGCAGGGGAGCAGGGGGAGGG + Intronic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1061855100 9:133437726-133437748 CTGGGAGGGCAGAGTGAAAAAGG - Intronic
1061868489 9:133507521-133507543 CTGGGAGACCCGAAGGAGAAGGG - Intergenic
1062022875 9:134327351-134327373 GCGGGATGGCAGGAGGAGGAGGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1062378426 9:136275319-136275341 CTGGGAGGGCAGGCACAGGAGGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062622393 9:137428785-137428807 CTGGGTGGGCAGACCGAGGGAGG + Intronic
1062675330 9:137739864-137739886 CGGGCAGGGAGGAAGGAGGACGG + Intronic
1062725129 9:138068743-138068765 CTGAGAGGGCACAAAGTGGAGGG + Intronic
1203613294 Un_KI270749v1:28339-28361 ATGGGAGAGAAGAAGGAGGGTGG + Intergenic
1185575475 X:1168971-1168993 GGAGGAGGGGAGAAGGAGGAAGG + Intergenic
1185582690 X:1223165-1223187 CTGGGAGGAAAACAGGAGGATGG + Intergenic
1185627580 X:1493363-1493385 GGGGGAGGGAGGAAGGAGGAAGG + Intronic
1185627603 X:1493428-1493450 GAGGGAGGGAAGGAGGAGGAAGG + Intronic
1185680010 X:1880806-1880828 TAGGGAGGGAAGGAGGAGGATGG + Intergenic
1185688344 X:1948492-1948514 AGGAGAGGGTAGAAGGAGGAGGG + Intergenic
1185688622 X:2134014-2134036 AGGAGAGGGTAGAAGGAGGAGGG + Intergenic
1186166452 X:6831479-6831501 CTTGGAGGTCAGAAGCAAGATGG + Intergenic
1186169216 X:6859350-6859372 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1186526953 X:10257577-10257599 CTGGGAGGGTAGAGGGATGTTGG + Intergenic
1186748692 X:12598452-12598474 CTGGCAGGAGAGAATGAGGATGG - Intronic
1187053940 X:15723075-15723097 CTGGGATGACAAGAGGAGGAGGG - Intronic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187572718 X:20521255-20521277 CTTGGAGGGCTGAAGCAGGAGGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188939357 X:36217527-36217549 ATGGGAGGGCAGCAGGAGAAAGG - Intergenic
1189173837 X:38934437-38934459 CTGGGAGAGCAGCAATAGGAAGG - Intergenic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189217737 X:39341623-39341645 CTGGGTGGGCAGAAGGGATATGG - Intergenic
1189242021 X:39532666-39532688 CAGGGAGGGCTGAAGGATGCAGG + Intergenic
1189532760 X:41903274-41903296 GGGAGACGGCAGAAGGAGGAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190259110 X:48786837-48786859 ATGAGAGGGCAGAAAGAGGTGGG - Intronic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190399331 X:50015911-50015933 CTGGGAGAGAAGAAGGACCAAGG - Intronic
1190973136 X:55371985-55372007 CTTATATGGCAGAAGGAGGAAGG + Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192358223 X:70423047-70423069 CTGGGAGGGGAACAGGAGGAGGG + Exonic
1192544135 X:71998713-71998735 CTGAGAGTGCAGAAAGATGAAGG - Intergenic
1192724195 X:73730336-73730358 CTAGGAGGGGAGAAGTAGAAAGG - Intergenic
1192733652 X:73827112-73827134 CAAGTAGGGCAGAAGGTGGAAGG - Intergenic
1193119069 X:77804895-77804917 GTGAGAGGGTAGAAGGAGGGAGG - Intergenic
1193308699 X:79979743-79979765 ATGGGAGGGTGGAAGGTGGAAGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193836339 X:86349181-86349203 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1194451329 X:94047739-94047761 CTGGGAGGTTAGAAGCAAGATGG + Intergenic
1194473120 X:94322421-94322443 TTGGGAGGTCAGAAGCAAGATGG - Intergenic
1194859560 X:98980032-98980054 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1195382440 X:104283522-104283544 CTGGAAGGGCAGGTGTAGGAGGG + Intergenic
1195512965 X:105738881-105738903 CTGTGAGGGCAGAAAGCAGAGGG + Intronic
1196000967 X:110785418-110785440 GTGGGAGGGTAGAAGAAGTATGG + Intronic
1196006649 X:110843901-110843923 TGGGGAGGCCAGAAGGAAGATGG - Intergenic
1196287504 X:113899471-113899493 CTTGGAGGTCAGAAGCAAGATGG - Intergenic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196649050 X:118150202-118150224 CTTGGAGGCCAGAAGCAAGATGG - Intergenic
1196988072 X:121296520-121296542 CTTGGAGGTGAGCAGGAGGATGG + Intergenic
1197707727 X:129646548-129646570 CGGAGAGGGGAGAAGAAGGAAGG - Exonic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198383422 X:136105258-136105280 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198383427 X:136105276-136105298 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198676995 X:139141637-139141659 CTGGGATGGAAGAATGTGGAGGG - Intronic
1199362067 X:146932868-146932890 CTTGGAGGTTAGAAGCAGGATGG - Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1199792945 X:151171925-151171947 CTGGGATGGGAGGAGCAGGAGGG + Intergenic
1200150647 X:153949848-153949870 CTGGGAGGGCAGTGAGAGGTGGG - Intronic
1200487429 Y:3786277-3786299 CTGATAGGGCAGAAGGATGTAGG + Intergenic
1201411427 Y:13702976-13702998 AGGGGAGGGTAGAAGGAGTAAGG - Intergenic
1201461738 Y:14233022-14233044 GGGGGAGGGGAGAGGGAGGAGGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic