ID: 925238929

View in Genome Browser
Species Human (GRCh38)
Location 2:2304901-2304923
Sequence CCACATGGGCTCTTGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925238929 Original CRISPR CCACATGGGCTCTTGAGCCC TGG Intronic
900229709 1:1550561-1550583 CCCCACGGGGCCTTGAGCCCCGG + Intronic
900474425 1:2869538-2869560 CCACATGTGCCCTGGAGCCCCGG + Intergenic
900609966 1:3540468-3540490 GCCCATGGGCCCTGGAGCCCAGG - Intronic
900921577 1:5674899-5674921 CCAGATGATCACTTGAGCCCAGG - Intergenic
901498603 1:9637421-9637443 CCACAGGATCACTTGAGCCCGGG + Intergenic
902546625 1:17194346-17194368 GCACATGGGCTCTGGGGCCTCGG + Intergenic
902835150 1:19042507-19042529 CCACAGATGCTATTGAGCCCTGG - Intergenic
903128618 1:21263925-21263947 TCACTTGGGCTCTTGTCCCCTGG - Intronic
904482978 1:30805648-30805670 GCACCTGGGCTCTTGGGCCTAGG - Intergenic
905165033 1:36075687-36075709 TCACTTGAGCACTTGAGCCCAGG + Intergenic
905798209 1:40827309-40827331 GCACAGGGGCTGTGGAGCCCGGG + Intronic
905852879 1:41286957-41286979 CCACATGTGAGTTTGAGCCCTGG + Intergenic
906022378 1:42641456-42641478 GCACATGATCACTTGAGCCCAGG + Intronic
907033836 1:51198900-51198922 CCAGAGGGTCACTTGAGCCCAGG - Intergenic
913035126 1:114957155-114957177 CCACAGGATCTCTTGAACCCAGG - Intronic
914716314 1:150257653-150257675 CCAGCTGGGCTCCTGAGCCAGGG + Exonic
917519355 1:175735219-175735241 AGACATGGGCTCTCCAGCCCTGG + Intronic
922894207 1:229088119-229088141 CCACATTGACTCCTGACCCCGGG - Intergenic
924329003 1:242923751-242923773 CCACATGGGCTCTTACACGCTGG - Intergenic
924696342 1:246404255-246404277 ACAGATGGGATCTTGAGCCAAGG - Intronic
1062823707 10:553157-553179 CCACATGGGCACTGGGGCCCAGG + Intronic
1063727117 10:8649796-8649818 GCACAGGGGCTGTAGAGCCCAGG - Intergenic
1065202187 10:23323799-23323821 CCACTTGGGAGCTTGAACCCGGG + Intronic
1065551346 10:26871271-26871293 CAAAATGGTCACTTGAGCCCAGG - Intergenic
1067097343 10:43310763-43310785 CCTCCTGGGCACTTGAGCCCAGG - Intergenic
1071454604 10:85836414-85836436 CCACAAGGGCTACTGAGCCCTGG + Intronic
1073517921 10:104094678-104094700 CCAGAGGGTCACTTGAGCCCAGG - Intergenic
1074133863 10:110609860-110609882 CCACAAGGGCTCTTACACCCAGG - Intergenic
1076382704 10:130036289-130036311 CCATCTGGGGTCTTGAGCTCTGG + Intergenic
1076817779 10:132923185-132923207 CCACATGGCTGCTTGAGGCCAGG - Intronic
1077186292 11:1236828-1236850 CCCCGAGGGCTCTGGAGCCCAGG + Intronic
1079060197 11:17241630-17241652 CCAGAGGACCTCTTGAGCCCAGG + Intronic
1080852264 11:36080011-36080033 CCACATGGGTTTTTGAAACCTGG + Intronic
1085583026 11:77672447-77672469 CCAAAGGATCTCTTGAGCCCAGG - Intronic
1087483615 11:98733464-98733486 CCACAAGGGGTTTTGTGCCCTGG - Intergenic
1088192851 11:107244976-107244998 CCAGAGGATCTCTTGAGCCCAGG + Intergenic
1088994278 11:114982827-114982849 CCACATAGGTTCTTGGGCACAGG + Intergenic
1089197815 11:116705128-116705150 CCACATAGGCCCTTGAGAACAGG + Intergenic
1089281966 11:117381049-117381071 CCACAAGGTTTCTTCAGCCCTGG - Intronic
1089384607 11:118059594-118059616 CAACAGGGGCTCTGGGGCCCAGG + Intergenic
1089871547 11:121677270-121677292 TCACTTGAGCCCTTGAGCCCAGG + Intergenic
1090410455 11:126504809-126504831 CCACATGGGATTTTTATCCCAGG + Intronic
1090631440 11:128652630-128652652 CCACAGAGGGTCCTGAGCCCAGG + Intergenic
1090733023 11:129588262-129588284 CCCCATTTGCTCTAGAGCCCTGG + Intergenic
1091448192 12:556786-556808 CAGCTTGGGCTCTTGGGCCCGGG - Exonic
1091825458 12:3509196-3509218 ACACAGGGGCTCCTGAGCCCGGG - Intronic
1093009850 12:14095241-14095263 CCACAGGATCACTTGAGCCCAGG + Intergenic
1099841105 12:87968454-87968476 GCACAGGGTCTCTTGAGCCTTGG - Intergenic
1100298443 12:93284775-93284797 GCACCTGGGCTCCTGAGCTCAGG + Intergenic
1102302994 12:111784381-111784403 TCACATGTGCTCCTGAGCCTGGG + Intronic
1102491550 12:113292501-113292523 GCACTTGATCTCTTGAGCCCAGG + Intronic
1103703348 12:122859091-122859113 CCCCATGAGCTCCAGAGCCCGGG - Exonic
1103970499 12:124667822-124667844 CCACCTGGGCTTTTGAGGTCTGG - Intergenic
1104654174 12:130560785-130560807 CGACATGGGCTCTTGGGCATAGG - Intronic
1104967018 12:132512875-132512897 CCAGAGGGGCTCTCGAGGCCTGG + Intronic
1105469991 13:20684876-20684898 CAACATGGGGGCTTGAACCCGGG - Intronic
1106236232 13:27862859-27862881 TCACTTGAGCACTTGAGCCCAGG + Intergenic
1107264388 13:38535529-38535551 CCACATGGGCTATTCAGTCAGGG + Intergenic
1107454061 13:40537817-40537839 CCAGAGGATCTCTTGAGCCCAGG + Intergenic
1112811723 13:103225922-103225944 CCTCCTGGGCCCTTGATCCCCGG + Intergenic
1113174450 13:107546142-107546164 CCACTTGGCCTCTTGCACCCTGG + Intronic
1114760545 14:25309056-25309078 CCAGATGGGCTATTGGGCTCTGG - Intergenic
1115316041 14:32026249-32026271 ACGGATGTGCTCTTGAGCCCTGG + Intergenic
1115409657 14:33059889-33059911 CTACTTGGGAGCTTGAGCCCAGG - Intronic
1116893986 14:50297871-50297893 TCACTTGAGCACTTGAGCCCAGG + Intronic
1117522599 14:56565823-56565845 CCACATGGTCTCTTGAAAGCAGG - Intronic
1119673358 14:76536660-76536682 CCACTTGGGCTCCTGAGTCTGGG - Intergenic
1121653498 14:95577027-95577049 GCATAGGGGCTCATGAGCCCTGG + Intergenic
1122721833 14:103726603-103726625 CCGCATTGGCTCTGGAGCCTGGG + Intronic
1122771119 14:104098420-104098442 CCACACGGGCTCCTGAGCAGGGG + Intronic
1123984890 15:25636582-25636604 CAACATGGGGGCTTGAACCCAGG + Intergenic
1124017166 15:25887055-25887077 CCACAGAGCCTCTGGAGCCCAGG + Intergenic
1124650055 15:31467800-31467822 CCACATTGGCTCTTCTGCCACGG + Intergenic
1126464129 15:48945103-48945125 CAATCTGGGCTCTTGAGCTCTGG - Intronic
1128567821 15:68712908-68712930 CCAAATGGGGCCATGAGCCCAGG + Intronic
1131523750 15:93136475-93136497 CCACATGGGTTCTTGTCCACAGG + Intergenic
1131994932 15:98124628-98124650 GCACATGCCCTCATGAGCCCTGG + Intergenic
1132016593 15:98323100-98323122 CCACTTGGGGTCTTGAACCAGGG - Intergenic
1132073336 15:98798739-98798761 TCACATGGGCCCTGGAGCCATGG + Intronic
1134121685 16:11588265-11588287 CCAGAGGATCTCTTGAGCCCAGG + Intronic
1134223638 16:12374987-12375009 CCCCAGGGTCACTTGAGCCCAGG + Intronic
1134824233 16:17271774-17271796 CAGTATGGGCCCTTGAGCCCTGG - Intronic
1135013860 16:18907446-18907468 CCAGAGGATCTCTTGAGCCCAGG - Intronic
1135379703 16:21985205-21985227 CCAGAGGGTCACTTGAGCCCAGG - Intronic
1135392922 16:22108943-22108965 GCACATGGTTGCTTGAGCCCAGG + Intronic
1136284525 16:29233302-29233324 CCTCTGGGGCTCTTGACCCCCGG - Intergenic
1136331021 16:29576722-29576744 CCAGAGGATCTCTTGAGCCCAGG - Intergenic
1136445661 16:30316455-30316477 CCAGAGGATCTCTTGAGCCCAGG - Intergenic
1137582876 16:49644760-49644782 CCTCAGGGCCTCTTGTGCCCAGG + Intronic
1138546668 16:57723498-57723520 CAACATGGGCAGTTGAGCCCAGG + Intronic
1139380656 16:66528511-66528533 TCACATGGTCACATGAGCCCAGG - Intronic
1140845045 16:78878826-78878848 CCCTATGGTCTCTTGAGTCCAGG + Intronic
1141039083 16:80656030-80656052 CCACACGAGCTCTTGAGCATTGG + Intronic
1141794088 16:86257900-86257922 CCTCCTGGCCTCTTGAGACCTGG - Intergenic
1141855807 16:86680952-86680974 CCACATGGGCATTTGGGTCCTGG - Intergenic
1142117556 16:88367772-88367794 CCAGATGGGGCCATGAGCCCGGG - Intergenic
1142593095 17:1015960-1015982 CCACAGGACCACTTGAGCCCAGG + Intronic
1142614365 17:1126103-1126125 CCACTTGGGCTCCAGAGCCCAGG + Intronic
1142826599 17:2516169-2516191 CTACCTGGGCTCTTGAATCCGGG + Intergenic
1146930133 17:36771032-36771054 CCAGATGATCACTTGAGCCCAGG - Intergenic
1149353308 17:55813813-55813835 CCAGAGGATCTCTTGAGCCCAGG + Intronic
1151068550 17:71180994-71181016 TCAAATGAGCACTTGAGCCCAGG - Intergenic
1151843004 17:76630985-76631007 CCACAGGATCGCTTGAGCCCAGG - Intronic
1152108862 17:78346043-78346065 GGACATGGGCACTGGAGCCCTGG - Intergenic
1152399061 17:80053301-80053323 CCAGATGGCCTCTTGAGGCCGGG + Intronic
1152430884 17:80247796-80247818 CCACGTGAGCCCTTGAGACCTGG - Intronic
1153635890 18:7113251-7113273 GCACATGGGCTCTTAAGTGCCGG - Intronic
1156038756 18:32795024-32795046 CCAGCTGGGCTCCTGAGTCCGGG + Intergenic
1157469470 18:47977834-47977856 GCACATGGATGCTTGAGCCCTGG - Intergenic
1157590104 18:48831399-48831421 CCCCATGGGCTCTTGGTCCAGGG - Intronic
1159309302 18:66687143-66687165 CTAGATGGGCTCAAGAGCCCAGG + Intergenic
1159402538 18:67956521-67956543 TCACAATGGCTCTTGAACCCAGG + Intergenic
1160505533 18:79424239-79424261 CCACCTGGCCTCTTTAGGCCGGG + Intronic
1160842172 19:1151047-1151069 CCACAGGGGCTCCAGAGCCCGGG + Intronic
1161962926 19:7532800-7532822 CCACACTGGCTTTTGAGCACTGG - Intronic
1162095061 19:8305334-8305356 CCAGTGGGGCTCTTGAGCCCAGG - Intronic
1162314754 19:9931794-9931816 CCAGAGGGTCTCTTGAGGCCAGG - Intronic
1162584820 19:11552266-11552288 CCACCCGGGCTCATGAGGCCAGG + Intronic
1162584821 19:11552269-11552291 CCACCTGGCCTCATGAGCCCGGG - Intronic
1162790130 19:13058419-13058441 CCAGAGGGTCGCTTGAGCCCAGG + Intronic
1163126232 19:15245687-15245709 CCACAGGGGGACATGAGCCCTGG + Intronic
1163152223 19:15422366-15422388 CCTCAGGGGCTCTGGGGCCCTGG - Exonic
1163413078 19:17169026-17169048 CCAGGTGGGCTCTTGAGCCCAGG + Intronic
1164540802 19:29120250-29120272 CCAGCCGGACTCTTGAGCCCTGG + Intergenic
1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG + Intronic
1166719117 19:44987463-44987485 CCTCTTGGCCTCTTGCGCCCAGG - Intronic
1166733450 19:45071237-45071259 CCACATGGGCCCCTTTGCCCAGG + Intergenic
1166863098 19:45820989-45821011 CCACAAGTGCCCTGGAGCCCTGG + Intronic
1168641480 19:58034326-58034348 CCCGATGGGCTCTGGAACCCCGG - Intronic
925238929 2:2304901-2304923 CCACATGGGCTCTTGAGCCCTGG + Intronic
927197042 2:20555263-20555285 CCACCTGGCCTCTTAAGCCGTGG - Intergenic
927857309 2:26535702-26535724 CATCATGGGGTGTTGAGCCCAGG + Intronic
927884986 2:26712849-26712871 CCATCTGAGCTCCTGAGCCCTGG + Intronic
928572168 2:32620540-32620562 CCGCATGTGCTCTTGGACCCAGG - Intergenic
928985210 2:37174014-37174036 CCTCATTGGCTGTTCAGCCCTGG + Intronic
930075011 2:47399444-47399466 CCAGAGGAGCACTTGAGCCCAGG - Intergenic
930760633 2:55031695-55031717 CAATATGGGCTCATGAGCCATGG - Intronic
931337642 2:61364267-61364289 CCAGAGGGTCACTTGAGCCCAGG + Intronic
931958216 2:67451981-67452003 CCAGAGGGTCGCTTGAGCCCAGG - Intergenic
932116362 2:69053183-69053205 CCACATGGGCTTTTCAGTACTGG + Intronic
933342973 2:81046561-81046583 CCACTGGGGCTTTTTAGCCCTGG - Intergenic
933464508 2:82635439-82635461 CCAGAGGATCTCTTGAGCCCAGG + Intergenic
933693077 2:85194643-85194665 CCCCAGGTGCCCTTGAGCCCAGG + Intronic
933798443 2:85940624-85940646 CCACATCAGCTTTTGAGCCAAGG + Intergenic
934777748 2:96949869-96949891 CCACATGGGCCCATCAGGCCTGG + Intronic
935707527 2:105870013-105870035 CCACATGGGTCCTTGTGTCCAGG - Intronic
936231086 2:110700069-110700091 ACAAATGGGCTCCTGGGCCCTGG + Intergenic
936445127 2:112588957-112588979 CCAGATGGAGTCCTGAGCCCTGG + Exonic
937517716 2:122674175-122674197 CCCAATGGGCGCTCGAGCCCTGG + Intergenic
947133439 2:226953507-226953529 CCACATGGCCTCTCAATCCCTGG + Intronic
948573789 2:238936807-238936829 CCCCATCAGCGCTTGAGCCCTGG - Intergenic
1169074631 20:2752996-2753018 CCACCTGGCCTCTGGAGTCCTGG - Intronic
1169214250 20:3784429-3784451 CCACCTGGTCCCCTGAGCCCAGG + Exonic
1169550527 20:6697271-6697293 CCACGTGGACTCTTGGGCTCTGG + Intergenic
1170708078 20:18764039-18764061 CCACACAGGCTCCTGAGTCCAGG + Intergenic
1171048458 20:21833301-21833323 CCACATGAGCTCTTAGGCCAGGG + Intergenic
1171095078 20:22325111-22325133 CCACACTGGCACTTGTGCCCAGG + Intergenic
1172046052 20:32080994-32081016 CCAGATGATCTCTTGAGTCCAGG + Intronic
1173525862 20:43732029-43732051 CCCCATGGGCTTTTGGGCTCTGG + Intergenic
1174365756 20:50055259-50055281 GCACTTGTGCTCTTGTGCCCTGG + Intergenic
1174407002 20:50309118-50309140 CCACACGGTCCCTTGATCCCTGG - Intergenic
1175456805 20:59121581-59121603 CCACAAGGGCGCTTGAGGCCTGG - Intergenic
1175871057 20:62209693-62209715 CCACATGAACCCTGGAGCCCAGG + Intergenic
1176007921 20:62876238-62876260 CCACATGGTCCCCTGAGCCCTGG + Intergenic
1178337317 21:31755002-31755024 CCAGAGGGTCGCTTGAGCCCAGG - Intergenic
1178897144 21:36568322-36568344 CCACCTGAGCTTTTGAGCCAAGG + Intronic
1179609145 21:42538135-42538157 CCAGATGGGCTCCTGAGAGCTGG - Intronic
1180613196 22:17110732-17110754 CCAGATGATCACTTGAGCCCAGG + Exonic
1181427314 22:22852057-22852079 CCCCATGTGCTCTTGTTCCCTGG - Intronic
1183438912 22:37812027-37812049 CAGCATGGACTCTTGAGCCAGGG - Intronic
1183457189 22:37929311-37929333 CCACATGACCTGTGGAGCCCAGG - Intronic
1183591392 22:38781197-38781219 CCTCGTGGGCTCTCAAGCCCAGG + Intronic
1184846696 22:47092200-47092222 CCACAGGGACTCCTGAGGCCAGG - Intronic
1185068804 22:48645136-48645158 CCACATGGGCACCTGCTCCCTGG - Intronic
951417147 3:22438908-22438930 GCACGTGGACTTTTGAGCCCTGG - Intergenic
951739594 3:25905844-25905866 CCACACGGCCTCCTGAGGCCAGG - Intergenic
951798026 3:26563465-26563487 CCACATGGGCTGGCGAGCCAAGG + Intergenic
952079435 3:29740217-29740239 CCACATGGGCTCTTTTGCTTTGG - Intronic
952231847 3:31439505-31439527 CCACATGGGTTCATCAGTCCTGG + Intergenic
952299831 3:32094810-32094832 CCAGAGGATCTCTTGAGCCCAGG + Intergenic
952475901 3:33710478-33710500 CCAGAGGGTCACTTGAGCCCAGG + Intronic
952959585 3:38581021-38581043 ACACACGGGCTCTGGATCCCCGG + Exonic
954881225 3:53837340-53837362 CCACTTGGCCCCTTGTGCCCTGG + Intronic
957300229 3:78382250-78382272 CCCCTTGGGCTCTGGGGCCCAGG + Intergenic
957391630 3:79580387-79580409 TCACTTGGACCCTTGAGCCCAGG + Intronic
958464553 3:94442328-94442350 CCACAAGGGCTGCTGAGCACTGG + Intergenic
958575695 3:95947935-95947957 CCACAAGGGGTTTTGTGCCCTGG + Intergenic
960402966 3:117226496-117226518 CAGCATGAGCTCTTGACCCCAGG + Intergenic
962971136 3:140403176-140403198 CCACAGGGGCTCTGGAACTCTGG + Intronic
966005334 3:175004284-175004306 CCACATGGGAGCTTGAGCTTAGG + Intronic
966366555 3:179194408-179194430 AGAGATGGGGTCTTGAGCCCAGG + Intronic
969307792 4:6335676-6335698 ACACCTGGGCTCTGCAGCCCTGG - Intronic
971870300 4:32227094-32227116 CTACATGGGCTTTTCAGCTCTGG - Intergenic
978489508 4:109297409-109297431 CCCCATGGTCTTTTAAGCCCAGG + Intronic
981625225 4:146747555-146747577 CCACATTTGCTCTGGAGCCAGGG - Intronic
982285034 4:153725254-153725276 CCACAGTGACTCTTGAGCCATGG + Intronic
984838228 4:184041934-184041956 TCACATGTGCTCAGGAGCCCAGG - Intergenic
984970002 4:185179596-185179618 CCACATGGGCCCTTGGGTTCTGG + Intronic
985970757 5:3376764-3376786 CCACATGGTCTTCTGAGCCGAGG - Intergenic
989506490 5:42231597-42231619 GCACAGGAGCTCCTGAGCCCAGG + Intergenic
991398628 5:66230718-66230740 ACACAAGGCCTCTTGAGGCCTGG - Intergenic
991743145 5:69703534-69703556 CCAGATGTGCTCCTGGGCCCTGG - Intergenic
991754551 5:69851669-69851691 CCAGATGTGCTCCTGGGCCCTGG + Intergenic
991794718 5:70283270-70283292 CCAGATGTGCTCCTGGGCCCTGG - Intergenic
991804170 5:70408419-70408441 CCAGATGTGCTCCTGGGCCCTGG + Intergenic
991822532 5:70578845-70578867 CCAGATGTGCTCCTGGGCCCTGG - Intergenic
991833879 5:70726817-70726839 CCAGATGTGCTCCTGGGCCCTGG + Intergenic
991887095 5:71282808-71282830 CCAGATGTGCTCCTGGGCCCTGG - Intergenic
994089422 5:95796728-95796750 CTACCTGGGCTCCTCAGCCCTGG - Intronic
995182058 5:109238506-109238528 CCACAAGAGAACTTGAGCCCAGG - Intergenic
998016570 5:138736790-138736812 CCTCTTGAGCTCTTGAGCCCAGG + Intronic
999305875 5:150519326-150519348 CCCCCTGGCCTCTTTAGCCCTGG + Intronic
1001734080 5:173984415-173984437 CTAGATGGCCTCTTAAGCCCAGG - Intronic
1001822159 5:174718927-174718949 ACAGATGGGCTGTTGAGTCCAGG - Intergenic
1001950589 5:175814156-175814178 CAGCATGGGCTCTGGAGCCATGG - Intronic
1001955604 5:175846269-175846291 CCACAGGTGCCCTTGAGCCCTGG - Intronic
1002163665 5:177332039-177332061 TCACATTGGCTCCTGGGCCCAGG + Exonic
1002305519 5:178280443-178280465 CCACATGGACTATAGACCCCTGG + Intronic
1002454626 5:179339041-179339063 CAACATGGGGTCTGGAGTCCAGG + Intronic
1003532595 6:6950217-6950239 CCCCTTGAGCACTTGAGCCCAGG - Intergenic
1003893001 6:10580230-10580252 CCACAGGGGATCATGAGCCCAGG - Intronic
1004312982 6:14562324-14562346 CCACCTTGGCTTTTGAGCCAAGG + Intergenic
1005947163 6:30602935-30602957 CCACATGGACTCCTAGGCCCTGG - Exonic
1006988060 6:38190037-38190059 CCACAGGTTCGCTTGAGCCCAGG - Intronic
1007125483 6:39422543-39422565 CCACATGTGTTCCTGATCCCTGG + Intronic
1007742669 6:44022358-44022380 ACCCCTGGCCTCTTGAGCCCTGG + Intergenic
1008037298 6:46759063-46759085 CCACATGGGCTGTTGTTTCCTGG + Exonic
1009203154 6:60770215-60770237 TCACTTGTGCTCTTGTGCCCAGG + Intergenic
1011604838 6:89092928-89092950 CCACAGGATCACTTGAGCCCAGG - Intergenic
1011931885 6:92723931-92723953 CCAGCTGGGCTCCTGAGTCCAGG + Intergenic
1013703945 6:112810182-112810204 CAAGATGATCTCTTGAGCCCAGG - Intergenic
1016732639 6:147443078-147443100 TCACATGATCCCTTGAGCCCAGG + Intergenic
1022824674 7:33996940-33996962 CCACATGTGCGATTGAGCACTGG - Intronic
1029205427 7:98866862-98866884 CCAGAGGGTCACTTGAGCCCAGG + Intronic
1029368713 7:100133663-100133685 CTACCTGGGGTCTTGAGCACAGG - Intergenic
1032067546 7:128783089-128783111 CCAGATGGGCTCACCAGCCCTGG + Intergenic
1032399783 7:131616710-131616732 CCAGAGGACCTCTTGAGCCCAGG + Intergenic
1032717625 7:134524096-134524118 CCAGATGGTTGCTTGAGCCCGGG - Intergenic
1033407843 7:141088037-141088059 CCACCTGGGACCTTCAGCCCAGG - Intronic
1035606890 8:935312-935334 CCACATGCGGTCGTGAGCCCAGG + Intergenic
1036505431 8:9350537-9350559 GCAATTGGTCTCTTGAGCCCTGG + Intergenic
1038304074 8:26383423-26383445 CCTCCTGGGGTCTTGGGCCCGGG + Intronic
1038910262 8:31955807-31955829 GCACATGGATCCTTGAGCCCAGG + Intronic
1040550096 8:48430946-48430968 CCACATGGGGTCTTGAGTCTTGG + Intergenic
1040972517 8:53152190-53152212 CCACATGCCCACTTGAGCCTTGG - Intergenic
1041134899 8:54747671-54747693 CCAGAGGATCTCTTGAGCCCAGG + Intergenic
1041233379 8:55775159-55775181 CCAGATGCTCTCTTGAGCCCAGG + Intronic
1042005711 8:64177794-64177816 CCACATGGCATCCTGATCCCTGG + Intergenic
1044598302 8:93979680-93979702 CTTCATGGGCTCTTGTCCCCAGG + Intergenic
1045248291 8:100462063-100462085 CCAAAGGGTCGCTTGAGCCCAGG - Intergenic
1048485507 8:134844080-134844102 CCCCAGGGGATTTTGAGCCCTGG - Intergenic
1048967489 8:139625167-139625189 CCACATGGGCACTTGGGGGCTGG - Intronic
1049359577 8:142205933-142205955 CCAAAGGGGCTCTAGAGACCGGG + Intergenic
1055249279 9:74282720-74282742 CCACATGGCCTCTTCAGTCCTGG - Intergenic
1055587847 9:77774552-77774574 CCAGAGGGTCACTTGAGCCCAGG - Intronic
1055814073 9:80185200-80185222 CCAAATGGGCTCCTGAGTCTAGG - Intergenic
1057125683 9:92614201-92614223 TCACATGTGCACTTGAACCCAGG + Exonic
1061011159 9:127955432-127955454 CCACTTTGGCTCAGGAGCCCGGG + Intronic
1061160903 9:128893149-128893171 CCACACGGGGTCCTGAGCCTGGG + Intronic
1061485712 9:130919604-130919626 CCACCTGAGCTCTTTAGGCCGGG - Intronic
1062183298 9:135202664-135202686 CCACATGGGCTCAGGGGTCCAGG + Intergenic
1203446176 Un_GL000219v1:58358-58380 CCAGAGGATCTCTTGAGCCCAGG + Intergenic
1187253681 X:17622360-17622382 CAACATGGGCTTGTGAGCCCTGG + Intronic
1187961645 X:24571687-24571709 CAAGAGGGTCTCTTGAGCCCAGG + Intronic
1191800723 X:65076245-65076267 CTACAGGGTCACTTGAGCCCAGG - Intergenic
1192356937 X:70412831-70412853 CCACAGGATCACTTGAGCCCTGG + Intronic
1198925586 X:141788249-141788271 CCAAGTGGGCTCTTGACCCTCGG - Intergenic
1199492604 X:148417534-148417556 TCACTTAGGCTCTTGAGTCCTGG - Intergenic
1200215154 X:154365030-154365052 CCACATGGGCTCTTCCTGCCTGG - Intronic