ID: 925239226

View in Genome Browser
Species Human (GRCh38)
Location 2:2308153-2308175
Sequence GTGAAGAGTAGGTGGAGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 2, 2: 3, 3: 29, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925239226 Original CRISPR GTGAAGAGTAGGTGGAGTAT GGG (reversed) Intronic
900406371 1:2494863-2494885 CTGAAGAGGACGTGGAGTCTGGG + Exonic
904197137 1:28794352-28794374 GTGATGAGGAAGTGGAGTTTCGG + Intergenic
906182663 1:43835338-43835360 GAGAAGAATAGGGGGAGTGTTGG - Intronic
906856881 1:49316117-49316139 GGGACGAATAGGTGGAGCATAGG + Intronic
909081870 1:71122283-71122305 GTGAAGTATAGATGGAGTTTTGG + Intergenic
910029688 1:82703682-82703704 GTGAAGATTAAGTGGATAATTGG - Intergenic
910682449 1:89881527-89881549 TTGCAGAGTAGGTGGAGATTTGG + Intronic
915271392 1:154756168-154756190 GAGAAGAAGAGGTGGAGGATGGG + Intronic
915979812 1:160413234-160413256 GTTTAGAGTAGTTGGAGTAAAGG + Intronic
917557718 1:176108551-176108573 GGGAAGGGTAGGTGGAGGAAGGG - Intronic
917687928 1:177436832-177436854 TTGAAGAGTGGGTGGAGGATAGG + Intergenic
918539362 1:185612120-185612142 GAGAAGAGTAGATGGTGTGTAGG - Intergenic
920254828 1:204647545-204647567 GGGGAGAGGAGGTGGAGGATGGG + Intronic
920986160 1:210891572-210891594 CTGAAGAGGATGTGGAGAATAGG + Intronic
921984293 1:221294117-221294139 GTAAACAGAAGGTAGAGTATTGG - Intergenic
923529611 1:234803169-234803191 GAGGAGAGTAGGGGGAGTAGGGG - Intergenic
923841721 1:237679810-237679832 GTGAATAGGATATGGAGTATGGG + Intronic
924816152 1:247443693-247443715 GTGAGGAGGAGGAGGAGTATGGG + Intronic
1063866043 10:10366830-10366852 GTGAGGAGCAGGTGGAGGAAGGG - Intergenic
1065431099 10:25656826-25656848 GGGAAGAGTAGTTGGGGGATTGG - Intergenic
1069086087 10:64141262-64141284 GTGAAGTGGAGGTGGAGGAATGG + Intergenic
1069729454 10:70601447-70601469 GAGAAGAATAGGTGCAATATAGG - Intronic
1074222734 10:111454249-111454271 GTGATGAGTATGTGGGGAATAGG + Intergenic
1075315660 10:121451141-121451163 GGGATGAGTAGGTGGAGCATGGG - Intergenic
1076497850 10:130909448-130909470 GTGAAGAGTTGGTGAAGAATTGG + Intergenic
1078648267 11:13162987-13163009 GTGAAGCATAGGTGAAGAATAGG - Intergenic
1079801727 11:24877747-24877769 GAGAAGAGTAGTTGGGGTGTGGG - Intronic
1080179163 11:29402259-29402281 ATTAAGAATAGTTGGAGTATGGG + Intergenic
1080453650 11:32399221-32399243 GGGAAGAACAGGTGGAGTGTAGG + Intronic
1082861684 11:57863159-57863181 GTTAAAAGTAGGTGGAGCATAGG + Intergenic
1082977170 11:59084466-59084488 GAGAAGATTAGGAGGAGGATTGG + Intergenic
1083487183 11:62990622-62990644 GTGAAGAGCAGGGGCAGTCTAGG + Intronic
1085648758 11:78247374-78247396 GTGAAGAGATGGTGGATTTTAGG - Intronic
1087808580 11:102583779-102583801 GGGATGAGGATGTGGAGTATGGG - Intronic
1088777945 11:113104190-113104212 GTGAAGAGGAGGTGGGGTGGGGG + Intronic
1094411841 12:30175337-30175359 GTGAAAAGCAGGTGGAGTGCTGG - Intergenic
1095039070 12:37422404-37422426 GTGCAGGGGAGGTGGAGTAAGGG - Intergenic
1095106189 12:38235800-38235822 GAGAACAGTATGGGGAGTATGGG + Intergenic
1100704864 12:97189415-97189437 GTGAAAAGTTGTTGGTGTATGGG + Intergenic
1101248210 12:102905188-102905210 ATAAAGAGTAGGAGGAATATAGG - Intronic
1102304457 12:111793955-111793977 GGGAAGAATAGGTGGAGGACGGG - Intronic
1103312297 12:120020695-120020717 GTGAACAGTAGATGGAGAACTGG + Intronic
1110351527 13:74513920-74513942 GTGAAGGGTAGTTGGAATAAAGG - Intergenic
1110511940 13:76361283-76361305 TTGGAGAGTATGTGGAGCATGGG + Intergenic
1111290023 13:86154690-86154712 GTGAACAATCAGTGGAGTATTGG - Intergenic
1114308134 14:21442067-21442089 GTGAAGAGCAGGTCAAGGATAGG + Intronic
1115027784 14:28764432-28764454 GGGAGGAGTAGGTGGAGGAATGG + Intergenic
1121631662 14:95425453-95425475 GGGATGAGTAGGTGGAGAACGGG + Intronic
1124868813 15:33520447-33520469 CTGATGAGGAGGAGGAGTATGGG + Intronic
1125014139 15:34914619-34914641 GACAAGAGTAGGTGGATTAATGG + Intronic
1128496616 15:68201850-68201872 GTGAAGAGATGGTGGAGGAAGGG - Intronic
1131357177 15:91755982-91756004 GTGATGAGTAGCAGGAGTCTGGG - Intergenic
1133583812 16:7172217-7172239 TTGAAGAGTATGTGGATTTTAGG - Intronic
1133937076 16:10277953-10277975 GTGAGGAGTGGGTGGGGTAGGGG - Intergenic
1139000103 16:62499234-62499256 GTGGAGAGTAATTGGATTATGGG + Intergenic
1142837274 17:2595922-2595944 GAGAAGACTGGGTGGAGTAAGGG + Intronic
1147939272 17:44034427-44034449 GTGGTGTGTAGGTGGAGTGTGGG - Intergenic
1152561170 17:81079513-81079535 GTGAGGAGGAGGAGGAGCATCGG - Intronic
1154167225 18:12025023-12025045 GGGAAGAATAGGCGGAGCATGGG - Intronic
1154281190 18:13004821-13004843 GTGAAGAGGAGGCAGAGAATTGG + Intronic
1155141447 18:23048279-23048301 GTGAAGAGTTGGTGGGGAGTGGG - Intergenic
1156184713 18:34648353-34648375 GTGAAGAGTAGGTTGAGGTGGGG + Intronic
1156206685 18:34893923-34893945 GTGAAAAGAGGGAGGAGTATTGG + Intergenic
1157220291 18:45824699-45824721 GTGAAGAGGAGGTGGTGTCAAGG + Intergenic
1160519938 18:79500935-79500957 CTGAAGAGTTTGTGGAGTATTGG - Intronic
1161246814 19:3257318-3257340 GGGGAGAGTAGGTGGAGGAGAGG + Intronic
1164715189 19:30385708-30385730 GGGAGAAGTAGGTGGAATATGGG - Intronic
1165817677 19:38652377-38652399 CTGAAGAAAAGGTGGGGTATGGG + Intronic
1167734738 19:51286935-51286957 ATGCAGAGGAGGGGGAGTATTGG - Intergenic
1168398713 19:56070407-56070429 GTGATGGGGAGGTGGAGTCTGGG + Intergenic
1168449915 19:56458363-56458385 GTGAAGGGCAGCTGGAGAATGGG + Intronic
925239187 2:2307661-2307683 CTGAAGCATAGGTGGAGTATAGG - Intronic
925239210 2:2307956-2307978 CTGAAGCATAGGTGGAGTATAGG - Intronic
925239213 2:2307988-2308010 CTGAAGCGTAGGTGGAGTGTAGG - Intronic
925239222 2:2308089-2308111 CTGAAGTGTAGGTGGAGTATAGG - Intronic
925239226 2:2308153-2308175 GTGAAGAGTAGGTGGAGTATGGG - Intronic
925239230 2:2308185-2308207 CTGAAGTGTAGGTGAAGCATAGG - Intronic
925239232 2:2308217-2308239 CCGAAGCGTAGGTGGAGTATAGG - Intronic
925239241 2:2308313-2308335 GTGAAGTGTAGGTGGAGTATGGG - Intronic
925239245 2:2308345-2308367 CTGAAATGTAGGTGAAGTATAGG - Intronic
925239247 2:2308377-2308399 GTGAAGTATAGGTGGAGTATGGG - Intronic
925239251 2:2308409-2308431 CTGAAGTGTAGGTGAAGTATAGG - Intronic
925239259 2:2308541-2308563 GTGAAGTGTAGGTGGAGTATGGG - Intronic
925239269 2:2308637-2308659 CTGAAGTGTAGGTGAAGTATAGG - Intronic
925239275 2:2308733-2308755 CTGAAGTGTAGGTAGAGTGTAGG - Intronic
925239285 2:2308851-2308873 CTGAAGTGTAGGTGGGATATAGG - Intronic
925239300 2:2308979-2309001 CTGAAGTGTAGGTGAAGTATAGG - Intronic
925239309 2:2309075-2309097 CTGAAGTGTAGATGGAGTACAGG - Intronic
925239320 2:2309201-2309223 CTGAAGTGCAGGTGGAGTATGGG - Intronic
925239327 2:2309291-2309313 CTGAAGTGTAGGTGGAGTATAGG - Intronic
925239340 2:2309547-2309569 CTGAAGTGTGGGTAGAGTATAGG - Intronic
925239347 2:2309641-2309663 CTGAAGTACAGGTGGAGTATGGG - Intronic
925239352 2:2309699-2309721 CTGAAGTGTAGATGGAGTATAGG - Intronic
925239362 2:2309860-2309882 CTAAAGTGTAGGTGGAGTATAGG - Intronic
925239365 2:2309892-2309914 CTGAAGTGTAAGTGGAGTATGGG - Intronic
925239373 2:2309988-2310010 TTGAAGTGTGAGTGGAGTATGGG - Intronic
925239394 2:2310340-2310362 CTGAAGTGTAAGTGGAGTATGGG - Intronic
925324490 2:3007335-3007357 CTGAACAGCAGGTGGAGTCTGGG - Intergenic
925422393 2:3723578-3723600 GTGAGGGGTAGGTAGAGTAAGGG + Intronic
927434095 2:23052476-23052498 GTGTAGAGGAGGTGGTGTCTTGG - Intergenic
930354026 2:50294621-50294643 GTGGAGAGGAGGTAGAGTTTAGG + Intronic
932957226 2:76366590-76366612 GATAAAAATAGGTGGAGTATAGG - Intergenic
935143949 2:100381179-100381201 TTGAAGAGCAGGTAGAGAATGGG - Intergenic
935868265 2:107416063-107416085 GTGAAGGTTAGGTGGACTTTTGG - Intergenic
937430665 2:121835643-121835665 GTGAAGGGGAGGTGGGGTTTTGG - Intergenic
937755531 2:125533450-125533472 GTATAGAATAGGTGGAGCATAGG + Intergenic
939118079 2:138084328-138084350 CTGCAGAGTAGTTGGAGTAGTGG - Intergenic
940274769 2:151927727-151927749 GTGCTGAGTAGGTGGAGGGTTGG + Intronic
941615222 2:167711080-167711102 GGCAAGAGTAGCTGGAGCATAGG - Intergenic
941833055 2:169983555-169983577 ATGAAGAGAATGTGGAGGATGGG - Intronic
942527837 2:176874238-176874260 GTGAATAGTAGTTGGTGAATCGG - Intergenic
944624267 2:201554885-201554907 GTAATGAGTATGTGGAGTTTTGG - Intronic
944859841 2:203804889-203804911 GTGATGAGTGGGTGGAGGACTGG + Intergenic
945089292 2:206163787-206163809 GTGAAGAGATGGTCAAGTATTGG + Intergenic
945641329 2:212434505-212434527 GGTAAGAGTAGGGGGAGTGTGGG + Intronic
946147759 2:217743740-217743762 GGGAAGAGTAGGTGGATTAGGGG + Intronic
1172927952 20:38557490-38557512 GGGATGAATAGGTGGAGTACAGG - Intronic
1174488176 20:50874279-50874301 GTGCTGAGTGGGTGGAGTGTGGG - Intronic
1175220080 20:57411794-57411816 GTGAAGAGAAGGGGGAGTCATGG - Intergenic
1176009434 20:62884793-62884815 GTGAAGAGGAGGTGGAGGTGAGG - Intronic
1177557381 21:22709798-22709820 GTGAAGAGTGGGAGGAGGGTGGG + Intergenic
1179145243 21:38762382-38762404 GTTAACAGTAGGTGTAGTCTTGG + Intergenic
1179800809 21:43810760-43810782 GTGAGGAGTAGGGGGAGGATTGG + Intergenic
1185007098 22:48286687-48286709 GTGATGAGTAGGTGGAGCACGGG + Intergenic
949550333 3:5107323-5107345 GAGATGAGTAGGTGGAATACAGG + Intergenic
950352853 3:12374211-12374233 GGAATGAATAGGTGGAGTATGGG + Intronic
950526803 3:13529066-13529088 GTGAGGAGTAGCTGGAGCAGGGG - Intergenic
953747365 3:45585455-45585477 GTATGGAGTAGGTGGAGAATTGG - Intronic
954405928 3:50345066-50345088 GGGTAGAGTAGGTGAGGTATGGG + Intronic
957460601 3:80513998-80514020 GCGAAGAGAAGGTGCAGGATGGG - Intergenic
958506064 3:94978503-94978525 GTGAAGAGTAAGAGGAGGAAGGG + Intergenic
958882620 3:99690155-99690177 AGGAAGAGTGGGTGGAGAATGGG + Intronic
960902318 3:122564779-122564801 GTGAACACTCGGTGGAGGATGGG + Intronic
961174855 3:124826490-124826512 GTGAAGATTAAGTGGAATAATGG - Intronic
962658951 3:137581185-137581207 GGGAAAAGTATGTGGAGTAAAGG - Intergenic
966081144 3:176003071-176003093 GTGAGGAGTAGGGGGAGAAGAGG - Intergenic
966128724 3:176610333-176610355 GGGAAGAGTAGGTGGTGGAGAGG + Intergenic
967150330 3:186642875-186642897 GTGAAGAGTTGGTGTAGTCTGGG - Intronic
967596057 3:191328153-191328175 TTGAAAAGTAGGTGGATTTTAGG - Intronic
968402332 4:308656-308678 GTGAAGAGTAAGGGGTGGATGGG - Intergenic
968982463 4:3857669-3857691 GTGAAGAGTAGGAGGGACATGGG - Intergenic
969315612 4:6379968-6379990 GAGAAGAGAAGGTGGAGAAGGGG - Intronic
970032168 4:11688435-11688457 ATGAAGAGAAGGTGGAGTGCAGG + Intergenic
972125637 4:35761306-35761328 GTGAAGATTAGTTGGAGTGGAGG - Intergenic
973978684 4:56287789-56287811 GGAAAGAGGAGGTGGAGTAAAGG + Intronic
975380955 4:73699972-73699994 GAAAAGAGTAGGTGGAAAATGGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978427143 4:108594407-108594429 GTGAAGAGTGGGCGGGGTAGGGG + Intergenic
978959308 4:114656766-114656788 GTGAAGAGTAGATAAAATATTGG + Intronic
979155808 4:117388973-117388995 GTGAAAAGAAGGTGGAGAGTAGG - Intergenic
979449241 4:120850456-120850478 TTGAACAGTAGCTGGAGTAGAGG - Intronic
979926776 4:126577429-126577451 GGGGTGAATAGGTGGAGTATAGG - Intergenic
980941023 4:139274143-139274165 GAAATGAGTAGGTGGAGTAGAGG + Intronic
981065636 4:140481789-140481811 ATTAAGAGTAGGGGGAGGATTGG + Intronic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
984051933 4:174875164-174875186 ATGTAGAGTAGGTGGTGGATGGG + Intronic
984813413 4:183816146-183816168 GTGAAGAGTAAGAGGAATATTGG + Intergenic
986000654 5:3628253-3628275 TTGAAGAGTAGGAGGGGTGTGGG - Intergenic
987979990 5:25071526-25071548 GTGTGGAGTTGGTGAAGTATTGG + Intergenic
989556854 5:42807224-42807246 ATAAAGAATAGGTGCAGTATGGG - Intronic
992878031 5:81076932-81076954 GTGCAGAGTGGGTGGAGGATTGG + Intronic
995765131 5:115606182-115606204 TTGAAGAGTATGTGTAGGATTGG - Intronic
997274863 5:132576730-132576752 GTGAAGAGGAGGTGAAGAAATGG - Intronic
997799708 5:136848038-136848060 CTGAAGAGGATGTGGAGAATAGG - Intergenic
998970499 5:147586090-147586112 GTGAACAGAAGGTGGGGTAAGGG + Intronic
998996938 5:147876293-147876315 GTGATGAGAAGGTGGGGTCTAGG + Intronic
999198052 5:149796203-149796225 GTGAGCAGTCGGTGGAGTAGGGG + Intronic
1006484646 6:34328915-34328937 GTGAATAGAAAGTGGAGTGTAGG - Intronic
1008220768 6:48851596-48851618 GTTAAGACTAGGCGGACTATTGG - Intergenic
1010380719 6:75221444-75221466 GTGTAGGGGAGGTGGAGGATGGG - Intergenic
1011139953 6:84141768-84141790 CTGGAAAGTAGGTGGAGTGTAGG - Intronic
1011419820 6:87159313-87159335 GGGAAGAGTAAGTAGAGGATGGG + Intronic
1014888501 6:126812621-126812643 GAATAGAGTAGGTGGAGTAGTGG + Intergenic
1014971077 6:127816213-127816235 GTGAGGGGTGGGTGGTGTATAGG - Intronic
1016642964 6:146371608-146371630 GGGAAGAGTAGTTGGGGCATGGG - Intronic
1016700975 6:147053860-147053882 TAGAAGAGTAGATGGAGCATGGG - Intergenic
1018296933 6:162357918-162357940 GAGATGAGTACGTGGAGTACAGG + Intronic
1020250108 7:6460695-6460717 GAGAAGAGCAGGTGGAGAAGTGG - Intronic
1020346670 7:7172947-7172969 ATGATGAATAGGTGGAGCATAGG - Intronic
1020444504 7:8255199-8255221 GTGAAGAGAAGGAAGAGGATGGG - Intronic
1021843965 7:24746063-24746085 AAGAAGTGTAGGTGAAGTATGGG - Intronic
1021854027 7:24835912-24835934 GTGGAGAGTGGGTGGAGGGTGGG + Intronic
1026137358 7:67675006-67675028 GGGAAGAGTAGGTGCAGTGAGGG - Intergenic
1027493750 7:78861585-78861607 GTGAATGGTAGGTGGAGGATTGG - Intronic
1027768755 7:82380033-82380055 GTGGAGAGAAGGTGGGTTATGGG - Intronic
1027814635 7:82953245-82953267 GTGAAGACTTGTTGGAGTGTGGG + Exonic
1029453472 7:100655593-100655615 GGGAAGGGTTGGGGGAGTATTGG + Intronic
1031734302 7:125337923-125337945 GTGAAGAATATGTGGATTACAGG - Intergenic
1032537438 7:132676777-132676799 GTGGAGAGTTAGTGGAGTAATGG - Intronic
1032984526 7:137322793-137322815 GTGAAGAATAAGTGAAGTTTTGG - Intronic
1034238349 7:149590320-149590342 GTGAAGTGGAGAGGGAGTATGGG - Intergenic
1034734318 7:153413973-153413995 GTGAGGAGTGGGTGGGGTAGGGG + Intergenic
1035342408 7:158172297-158172319 GTGAGGATTAGGGAGAGTATAGG + Intronic
1035463302 7:159059862-159059884 GTCATGGTTAGGTGGAGTATGGG - Intronic
1038881113 8:31613123-31613145 TTGAAAAAAAGGTGGAGTATGGG + Intergenic
1039455352 8:37702340-37702362 GGGAAGAGGAGGTGGAGAAATGG - Intergenic
1040472521 8:47746538-47746560 GGGATGAGTAGGTAGAGCATAGG + Intergenic
1040816106 8:51510127-51510149 ATGAAATGTAGGGGGAGTATTGG + Intronic
1041638854 8:60175135-60175157 GTGTAGAGTAGCTGGAGGAAAGG - Intergenic
1041673420 8:60515641-60515663 TGGAAGAGGAGGTGGAGAATAGG - Intergenic
1043189179 8:77195409-77195431 GTGAAGGGTAGGAGGAGGGTGGG + Intergenic
1044555702 8:93559581-93559603 GTGAAGAGTAGTTGGATCATGGG + Intergenic
1045233422 8:100328114-100328136 GTGAGGAGTGGGTGGAGAGTGGG - Intronic
1047137113 8:122091980-122092002 GGGAATAATAGGTGGAGCATAGG - Intergenic
1048641354 8:136366149-136366171 GGGATGAGTAGGTGGAACATGGG + Intergenic
1050950354 9:11583796-11583818 GTGGAGAGTGGGTGGAGAGTAGG - Intergenic
1056676217 9:88679017-88679039 GGGAAGAGGAGGTGGAATAGGGG + Intergenic
1060780199 9:126406299-126406321 CTGAAGAGGAGGTGGAATGTGGG - Intronic
1187075617 X:15931491-15931513 GAGAAGAGTAGGGGTAGTGTAGG - Intergenic
1187785105 X:22875699-22875721 GGGATGACTAGGTGGAGTATGGG + Intergenic
1189887968 X:45568466-45568488 GTGGAGAGAAGGTGTAATATTGG + Intergenic
1190546267 X:51531089-51531111 GGGGTGAATAGGTGGAGTATAGG - Intergenic
1193245690 X:79226133-79226155 GTGAAGGGTAGTGGCAGTATGGG - Intergenic
1195890453 X:109687922-109687944 GTACAGATTAGGTGGAGAATTGG - Intronic
1196305128 X:114093219-114093241 CTGATGAGTACGTGGAGTAAAGG + Intergenic
1198570398 X:137949049-137949071 GGGAAGGGTAGTTGGAGTTTGGG - Intergenic
1201769917 Y:17609887-17609909 GTGAGGAGTGGGTGGAGTAGGGG - Intergenic
1201831637 Y:18296100-18296122 GTGAGGAGTGGGTGGAGTAGGGG + Intergenic