ID: 925239247

View in Genome Browser
Species Human (GRCh38)
Location 2:2308377-2308399
Sequence GTGAAGTATAGGTGGAGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 2, 2: 7, 3: 19, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925239247 Original CRISPR GTGAAGTATAGGTGGAGTAT GGG (reversed) Intronic
904491140 1:30859829-30859851 GTCAAGTAGGGCTGGAGTATTGG - Intergenic
906182663 1:43835338-43835360 GAGAAGAATAGGGGGAGTGTTGG - Intronic
906584448 1:46964397-46964419 GTGACGTACAGGTGGGGTTTTGG + Intergenic
906856881 1:49316117-49316139 GGGACGAATAGGTGGAGCATAGG + Intronic
907229366 1:52981373-52981395 GTGAAGTACACATGGAGTTTTGG + Intronic
909081870 1:71122283-71122305 GTGAAGTATAGATGGAGTTTTGG + Intergenic
909106558 1:71417144-71417166 GTAAAATATAGATGAAGTATAGG - Intronic
909108456 1:71442993-71443015 GTGGAGGATAAGTGGAGAATGGG + Intronic
909384668 1:75040779-75040801 GTGACGTACAGGTGGGGTTTTGG - Intergenic
909747754 1:79119821-79119843 GTGATTTATAGGTAGATTATTGG - Intergenic
911323064 1:96438622-96438644 GTGACGTACAGATGGAGTTTTGG + Intergenic
913271380 1:117096876-117096898 TTGAAGGATAGGTGGGGTTTTGG + Intronic
915088939 1:153407951-153407973 GTGACGTACAGATGGAGTTTTGG - Intergenic
915271392 1:154756168-154756190 GAGAAGAAGAGGTGGAGGATGGG + Intronic
916961808 1:169896337-169896359 GCAAAGTATATGTGGGGTATAGG - Intergenic
917266723 1:173228412-173228434 GTGACGTATAGATGGGGTTTTGG - Intergenic
917398378 1:174618626-174618648 GTGACGTATAGATGGGGTTTTGG - Intronic
921779549 1:219146290-219146312 GTGAAGTAGGGGTAGAATATTGG - Intergenic
921840016 1:219818653-219818675 GTGAAGGATATGTGAGGTATGGG - Intronic
922393232 1:225169130-225169152 GTGATGTACAGATGGAGTTTTGG - Intronic
924795182 1:247287699-247287721 CTGAAGTAAAGGTGGGGCATGGG - Intergenic
1064000998 10:11663802-11663824 GTGAAAGATGGGTGGAGTAGGGG - Intergenic
1068477876 10:57551440-57551462 GTGACGTACAGATGGAGTTTTGG + Intergenic
1069086087 10:64141262-64141284 GTGAAGTGGAGGTGGAGGAATGG + Intergenic
1069729454 10:70601447-70601469 GAGAAGAATAGGTGCAATATAGG - Intronic
1071748116 10:88444305-88444327 GTGACGTACAGGTGGGGTTTTGG - Intronic
1073953602 10:108840555-108840577 GTGAAGTAGAGGTAGATTCTGGG - Intergenic
1074054130 10:109906826-109906848 TTGAAGGATGGGTGGAGTTTGGG - Intronic
1074227329 10:111497562-111497584 GGGATGGATAGGTGGAGCATAGG + Intergenic
1077450371 11:2639369-2639391 GTGACGTATAGATGGAGTTTTGG + Intronic
1078121741 11:8517315-8517337 GTGACGTACAGATGGAGTTTTGG - Intronic
1078648267 11:13162987-13163009 GTGAAGCATAGGTGAAGAATAGG - Intergenic
1079427543 11:20357779-20357801 TTGAAGCAGAGGAGGAGTATGGG - Intergenic
1080179163 11:29402259-29402281 ATTAAGAATAGTTGGAGTATGGG + Intergenic
1080453650 11:32399221-32399243 GGGAAGAACAGGTGGAGTGTAGG + Intronic
1082141682 11:48616913-48616935 GTGATGTACAGATGGAGTTTTGG + Intergenic
1082147156 11:48683985-48684007 GTGATGTATAGATGGGGTTTTGG - Intergenic
1082684431 11:56220435-56220457 GTGATGTACAGGTGGGGTTTTGG - Intergenic
1086422574 11:86651578-86651600 GTGATGTACAGATGGAGTTTTGG - Intronic
1086811951 11:91321459-91321481 GTGATGTACAGGTGGGGTTTTGG + Intergenic
1088098463 11:106127596-106127618 GGGAAGTAAAAGTGGAGTTTTGG + Intergenic
1090057032 11:123432201-123432223 GGGAAGGATAGGTAGAGTAAGGG + Intronic
1093008649 12:14080407-14080429 GTGAAGTACAGATGGGGTTTTGG - Intergenic
1093573990 12:20704347-20704369 GTGTGGTATTGGTGGAGTGTAGG + Intronic
1094162455 12:27405582-27405604 GTGACGTACAGATGGAGTTTTGG - Intronic
1095306228 12:40642363-40642385 GTGAAGTACAGATGGGGTTTTGG + Intergenic
1096964664 12:55616547-55616569 GTGAAGTATAGAAGGAACATTGG - Intergenic
1098120447 12:67231254-67231276 GTGATGTACAGGTGGGGTTTTGG + Intergenic
1099103152 12:78468113-78468135 GTGGATTTTATGTGGAGTATTGG + Intergenic
1100248545 12:92790109-92790131 GTGACCTACAGGTGGAGTTTTGG - Intronic
1100916567 12:99430352-99430374 GAGAAGTAGAGGAGGAGTCTAGG + Intronic
1102304457 12:111793955-111793977 GGGAAGAATAGGTGGAGGACGGG - Intronic
1103501246 12:121404342-121404364 GAGAAGTATAGGGGGAGAGTGGG - Intronic
1105072817 12:133245909-133245931 GTGATGTATAGATGGGGTTTTGG - Intergenic
1105305979 13:19169551-19169573 GTGAATTATAGGTAGAGGTTCGG + Intergenic
1108264994 13:48697493-48697515 GTGACGTACAGATGGGGTATTGG - Intronic
1108627774 13:52248245-52248267 GTGACGTATAGATGGGGTTTTGG + Intergenic
1109572928 13:64216179-64216201 GTGATGTATAGATGGGGTTTTGG + Intergenic
1109949513 13:69483020-69483042 GTGACGTACAGATGGAGTTTTGG + Intergenic
1111290023 13:86154690-86154712 GTGAACAATCAGTGGAGTATTGG - Intergenic
1111326179 13:86699298-86699320 GTGAGGTATAGGTGTAAAATAGG + Intergenic
1115954719 14:38764994-38765016 GTGACGTATAGATGGGGTTTTGG - Intergenic
1115968833 14:38922643-38922665 GTGACGTACAGATGGAGTTTTGG - Intergenic
1116337074 14:43670180-43670202 GTTAAATATAAGTGGTGTATTGG + Intergenic
1117172877 14:53118140-53118162 GTGACCTACAGGTGGAGTTTTGG - Intronic
1117698598 14:58391421-58391443 GGGATGTATAGGTGGAGCACAGG + Intergenic
1117945401 14:61014541-61014563 GTGACGTACAGGTGGGGTTTTGG + Intronic
1119636669 14:76278921-76278943 GTGCATTATCGGTGGAGTAGTGG - Intergenic
1121381579 14:93474600-93474622 GTGGAGTATTGGGGGAGAATGGG + Intronic
1127038350 15:54945050-54945072 GTGATGTATAGATGGAGTTTTGG - Intergenic
1135753217 16:25073723-25073745 GTTCAGTATAGGTTCAGTATAGG - Intergenic
1137071618 16:35909159-35909181 TTGAAGTAAGGGTGGAGCATGGG + Intergenic
1138692801 16:58785030-58785052 GTGATGTACAGGTGGGGTTTTGG + Intergenic
1139580239 16:67868896-67868918 GAGAAGTATAGGAGTAGGATGGG + Intronic
1140179013 16:72695540-72695562 GTGACGTACAGTTGGAGTTTTGG + Intergenic
1140539159 16:75739985-75740007 GTGACGTACAGGTGGGGTTTTGG + Intronic
1140583077 16:76254465-76254487 GTGACGTACAGGTGGCGTTTTGG + Intergenic
1141066874 16:80921069-80921091 GTGAAGTTTCAGTGGAGTAGAGG + Intergenic
1145396680 17:22502095-22502117 GTGATGTACAGATGGAGTTTTGG + Intergenic
1147902409 17:43797650-43797672 GTGACGTACAGGTGGGGTTTTGG + Intergenic
1147939272 17:44034427-44034449 GTGGTGTGTAGGTGGAGTGTGGG - Intergenic
1154019585 18:10650924-10650946 GTGACGTATAGATGGGGTTTTGG - Intergenic
1154138833 18:11804851-11804873 GTGAAGTACAGGTGCAGTTTGGG + Intronic
1154138839 18:11804899-11804921 GTGCAGTACAGGTGCAGTTTGGG + Intronic
1154167225 18:12025023-12025045 GGGAAGAATAGGCGGAGCATGGG - Intronic
1156548711 18:37991772-37991794 TTGAAGCATAGCTGGAGTTTAGG - Intergenic
1156734899 18:40244133-40244155 GAGAAGTATTTGTGGAGTTTTGG + Intergenic
1157061865 18:44300836-44300858 GTGACGTACAGATGGAGTTTTGG - Intergenic
1158647219 18:59257614-59257636 GTGACGTACAGGTGGGGTTTTGG - Intergenic
1158995323 18:62912549-62912571 GAGCAGTATAGGAAGAGTATAGG + Intronic
1160293955 18:77620957-77620979 GTGAGGGATGGGTGGAGCATTGG + Intergenic
1165817677 19:38652377-38652399 CTGAAGAAAAGGTGGGGTATGGG + Intronic
1167959943 19:53097425-53097447 ATGAAGTATATGGGGAGTGTGGG - Intronic
1168278577 19:55291088-55291110 GTGAAGTAAGGGTTGAGTAAGGG + Intronic
925239187 2:2307661-2307683 CTGAAGCATAGGTGGAGTATAGG - Intronic
925239210 2:2307956-2307978 CTGAAGCATAGGTGGAGTATAGG - Intronic
925239213 2:2307988-2308010 CTGAAGCGTAGGTGGAGTGTAGG - Intronic
925239222 2:2308089-2308111 CTGAAGTGTAGGTGGAGTATAGG - Intronic
925239226 2:2308153-2308175 GTGAAGAGTAGGTGGAGTATGGG - Intronic
925239230 2:2308185-2308207 CTGAAGTGTAGGTGAAGCATAGG - Intronic
925239232 2:2308217-2308239 CCGAAGCGTAGGTGGAGTATAGG - Intronic
925239241 2:2308313-2308335 GTGAAGTGTAGGTGGAGTATGGG - Intronic
925239245 2:2308345-2308367 CTGAAATGTAGGTGAAGTATAGG - Intronic
925239247 2:2308377-2308399 GTGAAGTATAGGTGGAGTATGGG - Intronic
925239251 2:2308409-2308431 CTGAAGTGTAGGTGAAGTATAGG - Intronic
925239253 2:2308441-2308463 CTAAAGCATAGGTGGAATATAGG - Intronic
925239259 2:2308541-2308563 GTGAAGTGTAGGTGGAGTATGGG - Intronic
925239264 2:2308605-2308627 CGGAAGTATAAGTGGAGTATGGG - Intronic
925239269 2:2308637-2308659 CTGAAGTGTAGGTGAAGTATAGG - Intronic
925239275 2:2308733-2308755 CTGAAGTGTAGGTAGAGTGTAGG - Intronic
925239283 2:2308819-2308841 CTGAAGCATAGCTGGAGTAAAGG - Intronic
925239285 2:2308851-2308873 CTGAAGTGTAGGTGGGATATAGG - Intronic
925239292 2:2308915-2308937 CTGAAGTATAGGTGGGGTGCAGG - Intronic
925239300 2:2308979-2309001 CTGAAGTGTAGGTGAAGTATAGG - Intronic
925239309 2:2309075-2309097 CTGAAGTGTAGATGGAGTACAGG - Intronic
925239320 2:2309201-2309223 CTGAAGTGCAGGTGGAGTATGGG - Intronic
925239327 2:2309291-2309313 CTGAAGTGTAGGTGGAGTATAGG - Intronic
925239340 2:2309547-2309569 CTGAAGTGTGGGTAGAGTATAGG - Intronic
925239347 2:2309641-2309663 CTGAAGTACAGGTGGAGTATGGG - Intronic
925239352 2:2309699-2309721 CTGAAGTGTAGATGGAGTATAGG - Intronic
925239362 2:2309860-2309882 CTAAAGTGTAGGTGGAGTATAGG - Intronic
925239365 2:2309892-2309914 CTGAAGTGTAAGTGGAGTATGGG - Intronic
925239373 2:2309988-2310010 TTGAAGTGTGAGTGGAGTATGGG - Intronic
925239394 2:2310340-2310362 CTGAAGTGTAAGTGGAGTATGGG - Intronic
926373343 2:12202755-12202777 TTGAAGGATAGGAGGAGTTTGGG + Intergenic
930868085 2:56142294-56142316 GTGACGTACAGGTGGGGTTTTGG + Intergenic
931069218 2:58625424-58625446 GTGAAGGATAGGTGGAAAACAGG + Intergenic
932957226 2:76366590-76366612 GATAAAAATAGGTGGAGTATAGG - Intergenic
935277622 2:101488969-101488991 GTGAAGTATAGGGGCATTTTAGG - Intergenic
935868265 2:107416063-107416085 GTGAAGGTTAGGTGGACTTTTGG - Intergenic
937450820 2:122000935-122000957 GTGAAACATGGGTGGAGTTTTGG + Intergenic
937741347 2:125358330-125358352 GTGATGTATAGATGGGGTTTTGG - Intergenic
937755531 2:125533450-125533472 GTATAGAATAGGTGGAGCATAGG + Intergenic
938640765 2:133276630-133276652 CTGAAGTAAATGTGGAGCATTGG - Intronic
938848178 2:135232778-135232800 GTGATGTATAGATGGGGTTTTGG - Intronic
940080486 2:149795763-149795785 GTGACGTACAGATGGAGTTTTGG + Intergenic
946513587 2:220387385-220387407 GTGATGTACAGATGGAGTTTTGG + Intergenic
1168882363 20:1217701-1217723 GTGACGTACAGGTGGGGTTTTGG - Intergenic
1172927952 20:38557490-38557512 GGGATGAATAGGTGGAGTACAGG - Intronic
1173500310 20:43548341-43548363 GTCAGATATAGGTGGAGCATGGG - Intronic
1177743743 21:25185679-25185701 GTGAAATTTAGGTGGAGTGGAGG - Intergenic
950352853 3:12374211-12374233 GGAATGAATAGGTGGAGTATGGG + Intronic
951684575 3:25329490-25329512 GTGATATATAGGTGGGGTTTTGG - Intronic
952515036 3:34095043-34095065 GTGAAGTACAGATGGGGTTTTGG - Intergenic
953465729 3:43117688-43117710 GTGAAGTATTTGATGAGTATAGG - Intergenic
955282515 3:57607226-57607248 GTGATGTACAGGTGGGGTTTTGG - Intergenic
955514494 3:59713368-59713390 GTGAACTAAATGTGGAGTTTAGG + Intergenic
959129279 3:102333041-102333063 GTGAAATATAGGATTAGTATAGG - Intronic
959693009 3:109219556-109219578 GTGACCTACAGGTGGAGTTTTGG - Intergenic
960783900 3:121351116-121351138 GTGACGTACAGATGGAGTTTTGG + Intronic
960906461 3:122606590-122606612 GTCAACTATAGGAGGAATATAGG - Intronic
962657050 3:137557747-137557769 GTGATGTACAGATGGAGTTTTGG - Intergenic
963825247 3:149945901-149945923 GTGAAGTACAGATGGGGTTTTGG - Intronic
964715351 3:159715227-159715249 GTGATGTATAGATGGGGTTTTGG - Intronic
965752769 3:171993753-171993775 GTGAATTATAGGTGCATTTTAGG - Intergenic
966536943 3:181045909-181045931 GTGACCTATAGATGGAGTTTTGG + Intergenic
968631166 4:1652649-1652671 GTGGTGTATATGTGGTGTATTGG - Intronic
972827346 4:42775174-42775196 TTCAAGTATAGGTAGATTATAGG + Intergenic
973730179 4:53815616-53815638 GTGAGGTATAGGAGGAGGAAGGG - Intronic
975522397 4:75314399-75314421 GTGATGTATAGATGGGGTTTTGG - Intergenic
975751941 4:77533191-77533213 GTGAAGTACAGATGGGGTTTTGG + Intronic
975931015 4:79522704-79522726 GAGTAGTATAGTTGGAGTGTAGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976956945 4:90912472-90912494 GTGACGTATAGATGGGGTTTTGG - Intronic
977218743 4:94314296-94314318 GTGACGTACAGATGGAGTTTTGG + Intronic
977909657 4:102518478-102518500 ATGGAGTATATGTGGGGTATGGG - Intronic
978294252 4:107184903-107184925 ATGAAGTAGAAGGGGAGTATTGG - Intronic
978591175 4:110326969-110326991 GTGAAGTACAGATGGAGTTTTGG + Intergenic
978911059 4:114064497-114064519 ATAAAGTATAGGTGGGGTGTTGG + Intergenic
979042217 4:115812643-115812665 GTGACGTACAGATGGAGTTTTGG - Intergenic
979926776 4:126577429-126577451 GGGGTGAATAGGTGGAGTATAGG - Intergenic
980503886 4:133690352-133690374 GTGAAGTACAGATGGGGTTTTGG + Intergenic
981068439 4:140509162-140509184 GTGATGTACAGATGGAGTTTTGG - Intergenic
981885873 4:149672102-149672124 GTGATGTATAGGTGGGGTTTTGG - Intergenic
982084617 4:151821378-151821400 GTGAAGTTTTGGGGGAGTAAGGG + Intergenic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
983175824 4:164586581-164586603 GTGATGTACAGATGGAGTTTTGG - Intergenic
985438997 4:189964709-189964731 GTGATGTACAGATGGAGTTTTGG - Intergenic
986653964 5:9991702-9991724 GTGACGTATAGATGGGGTTTTGG - Intergenic
987783895 5:22473504-22473526 GTAAAGTATATGTGAAGCATGGG + Intronic
988282309 5:29165814-29165836 ATGAAGTATAGATAGAGTTTTGG - Intergenic
989556854 5:42807224-42807246 ATAAAGAATAGGTGCAGTATGGG - Intronic
990038336 5:51349641-51349663 GTGACGTACAGGTGGGGTTTTGG - Intergenic
991577559 5:68121157-68121179 GAGAAGTAAAAGTGAAGTATTGG + Intergenic
992634159 5:78710720-78710742 GTGACGTATAGATGGGGTTTTGG - Intronic
992815051 5:80428440-80428462 GTGACGTATAGATGGGGTTTTGG - Intronic
993008732 5:82456698-82456720 GTGATGTACAGATGGAGTTTTGG + Intergenic
996960960 5:129249125-129249147 GAGAAGTATAACTGGAGTAAGGG - Intergenic
997117168 5:131138075-131138097 GTGAAGTACAGATGGGGTTTTGG + Intergenic
1000595776 5:163212936-163212958 GTGATGTACAGGTGGGGTTTTGG - Intergenic
1002117026 5:176970367-176970389 GAGAACTAGAGGTGGATTATGGG - Intronic
1002657419 5:180761826-180761848 GTGAAGTACAGATGGGGTTTTGG + Intergenic
1005902726 6:30231905-30231927 GTAGAGTATATGTGGATTATTGG + Intergenic
1007021101 6:38522365-38522387 GTGAAGTTTCAGTAGAGTATAGG - Intronic
1008798850 6:55341507-55341529 GTGATGTATAGATGGGGTTTTGG - Intronic
1010466507 6:76173129-76173151 GGAATGTATAGGTGGAGCATGGG + Intergenic
1011838846 6:91470129-91470151 GTGACGTAGAGGTGGGGTTTTGG + Intergenic
1011905410 6:92360905-92360927 GTCAAGTATAGGTGGCGTTTTGG - Intergenic
1013124420 6:107169635-107169657 GTGATGTACAGGTGGGGTTTTGG + Intronic
1014424357 6:121285972-121285994 GTGACGTATAGATGGGGTTTTGG - Intronic
1015050177 6:128830434-128830456 GTGATGTATAGATGGGGTTTTGG - Intergenic
1016333797 6:142982561-142982583 GTGACGTACAGATGGAGTTTTGG + Intergenic
1019097868 6:169600298-169600320 GTGATGTATAGATGGGGTTTTGG - Intronic
1020346670 7:7172947-7172969 ATGATGAATAGGTGGAGCATAGG - Intronic
1020774056 7:12431498-12431520 GTGACGTACAGGTGGAGTTTTGG + Intergenic
1021843965 7:24746063-24746085 AAGAAGTGTAGGTGAAGTATGGG - Intronic
1021938771 7:25658206-25658228 GTGAAGTACAGATGGAGAAAGGG - Intergenic
1022933990 7:35152784-35152806 GTGACGTACAGATGGAGTTTTGG - Intergenic
1023531841 7:41165298-41165320 GTAAAGTATTGGTAGAGTTTTGG - Intergenic
1027493750 7:78861585-78861607 GTGAATGGTAGGTGGAGGATTGG - Intronic
1031527143 7:122835268-122835290 GTGATGTACAGGTGGGGTTTTGG - Intronic
1031718041 7:125133267-125133289 ATGTAGTATGGCTGGAGTATGGG - Intergenic
1031734302 7:125337923-125337945 GTGAAGAATATGTGGATTACAGG - Intergenic
1032984526 7:137322793-137322815 GTGAAGAATAAGTGAAGTTTTGG - Intronic
1034028740 7:147737180-147737202 GTGACGTACAGGTGGGGTTTTGG + Intronic
1034238349 7:149590320-149590342 GTGAAGTGGAGAGGGAGTATGGG - Intergenic
1034388091 7:150757510-150757532 GAGATGGATAGGTGGAATATAGG + Intergenic
1035463302 7:159059862-159059884 GTCATGGTTAGGTGGAGTATGGG - Intronic
1037114231 8:15204448-15204470 CTGAAGTATAGGTGTTTTATTGG - Intronic
1038881113 8:31613123-31613145 TTGAAAAAAAGGTGGAGTATGGG + Intergenic
1039123133 8:34171146-34171168 GTGAAGTATAGCTGAAGGATTGG - Intergenic
1039358947 8:36853757-36853779 GTTAAGTATAGTTGGTTTATAGG + Intronic
1039680676 8:39731773-39731795 GTGAAGTAAAGGTGAAGTAAAGG - Intergenic
1039680677 8:39731784-39731806 GAGAAGTAAAGGTGAAGTAAAGG - Intergenic
1039680678 8:39731795-39731817 GTGAAGTAAAGGAGAAGTAAAGG - Intergenic
1040816106 8:51510127-51510149 ATGAAATGTAGGGGGAGTATTGG + Intronic
1041181254 8:55251071-55251093 GTGTGGTATAGGTATAGTATAGG + Intronic
1041845299 8:62321486-62321508 GTGACGTACAGATGGAGTTTTGG + Intronic
1042645194 8:70979400-70979422 GTGACGTACAGATGGAGTTTTGG + Intergenic
1043294592 8:78647057-78647079 GTCCAGTATGGGTGGAGTAGGGG + Intergenic
1043746631 8:83880781-83880803 GTGATGTACAGGTGGGGTTTTGG + Intergenic
1044272661 8:90265082-90265104 GTGACGTACAGATGGAGTTTTGG - Intergenic
1044546670 8:93467291-93467313 GTGACATACAGGTGGAGTTTTGG - Intergenic
1047137113 8:122091980-122092002 GGGAATAATAGGTGGAGCATAGG - Intergenic
1051790887 9:20801005-20801027 GTGAAGTACAGATGGGGTTTTGG + Intronic
1052724816 9:32216988-32217010 GTGATGTACAGGTGGGGTTTTGG + Intergenic
1055616265 9:78075936-78075958 GTGACGTACAGGTGGGGTTTTGG - Intergenic
1058224048 9:102338192-102338214 GTGACGTACAGGTGGGGTTTTGG - Intergenic
1058243766 9:102600012-102600034 GTGACGTATAGATGGGGTTTTGG + Intergenic
1061604870 9:131701333-131701355 GAGAAGTATGGGTGTAGTTTTGG - Intronic
1061833375 9:133310860-133310882 GTGACGTATAGATGGGGTTTTGG - Intergenic
1187785105 X:22875699-22875721 GGGATGACTAGGTGGAGTATGGG + Intergenic
1189053378 X:37670645-37670667 GAGAATGATAGGTGGAATATGGG - Intronic
1190546267 X:51531089-51531111 GGGGTGAATAGGTGGAGTATAGG - Intergenic
1190903198 X:54698464-54698486 GTGATGTATAGATGGGGTTTTGG - Intergenic
1191702903 X:64062645-64062667 GTGACGTACAGGTGGGGTTTTGG + Intergenic
1191772431 X:64775444-64775466 GTGAATTATAGATGGGGTTTTGG - Intergenic
1191809418 X:65171199-65171221 GTGAAGTACAGGTCGGGTTTCGG + Intergenic
1192362905 X:70450365-70450387 GTGAGGTTTAGGCGGAGTAAGGG - Intronic
1193066848 X:77269017-77269039 GTGACGTACAGATGGAGTTTTGG - Intergenic
1194636464 X:96350521-96350543 GTGATGTATAGATGGGGTTTTGG + Intergenic
1196045980 X:111256886-111256908 GTAAAGTATAACTGGAGAATGGG - Intronic
1196597002 X:117556644-117556666 GTGACGTACAGATGGAGTTTTGG - Intergenic
1197461304 X:126745178-126745200 GGGAAGTATAGGTGAAGCCTAGG - Intergenic
1198161465 X:134012745-134012767 GAAAAGTATGGGTAGAGTATAGG + Intergenic
1198252825 X:134897818-134897840 GAGAAGTAGAGGTGTATTATTGG - Intronic
1198572444 X:137971946-137971968 GTGAACTATGGATGGAGTTTTGG - Intergenic
1199010345 X:142750785-142750807 GTTAACTATAGGTGTAGTGTCGG + Intergenic
1201798826 Y:17931116-17931138 GTGAACTATTGGTGAACTATTGG - Intergenic
1201802727 Y:17974841-17974863 GTGAACTATTGGTGAACTATTGG + Intergenic
1202059066 Y:20867316-20867338 GTGATGTACAGATGGAGTTTTGG + Intergenic
1202085115 Y:21128658-21128680 GTGACGTACAGGTGGGGTTTTGG + Intergenic
1202360129 Y:24099732-24099754 GTGAACTATTGGTGAACTATTGG - Intergenic
1202510648 Y:25570382-25570404 GTGAACTATTGGTGAACTATTGG + Intergenic