ID: 925241997

View in Genome Browser
Species Human (GRCh38)
Location 2:2339453-2339475
Sequence ATGCTCACCTTGTAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925241996_925241997 -9 Left 925241996 2:2339439-2339461 CCAGGAAGATGCTCATGCTCACC No data
Right 925241997 2:2339453-2339475 ATGCTCACCTTGTAGACAAAAGG No data
925241995_925241997 3 Left 925241995 2:2339427-2339449 CCTGGGACAGAGCCAGGAAGATG No data
Right 925241997 2:2339453-2339475 ATGCTCACCTTGTAGACAAAAGG No data
925241991_925241997 21 Left 925241991 2:2339409-2339431 CCGGCTGGATGCAGAGAGCCTGG No data
Right 925241997 2:2339453-2339475 ATGCTCACCTTGTAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925241997 Original CRISPR ATGCTCACCTTGTAGACAAA AGG Intergenic
No off target data available for this crispr