ID: 925242391

View in Genome Browser
Species Human (GRCh38)
Location 2:2343116-2343138
Sequence TGTCACTTAGAACTGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925242391_925242397 21 Left 925242391 2:2343116-2343138 CCTTTAATCAGTTCTAAGTGACA No data
Right 925242397 2:2343160-2343182 TCCATACATTATCTGCATGGTGG No data
925242391_925242396 18 Left 925242391 2:2343116-2343138 CCTTTAATCAGTTCTAAGTGACA No data
Right 925242396 2:2343157-2343179 CCTTCCATACATTATCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925242391 Original CRISPR TGTCACTTAGAACTGATTAA AGG (reversed) Intergenic