ID: 925242391 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:2343116-2343138 |
Sequence | TGTCACTTAGAACTGATTAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925242391_925242397 | 21 | Left | 925242391 | 2:2343116-2343138 | CCTTTAATCAGTTCTAAGTGACA | No data | ||
Right | 925242397 | 2:2343160-2343182 | TCCATACATTATCTGCATGGTGG | No data | ||||
925242391_925242396 | 18 | Left | 925242391 | 2:2343116-2343138 | CCTTTAATCAGTTCTAAGTGACA | No data | ||
Right | 925242396 | 2:2343157-2343179 | CCTTCCATACATTATCTGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925242391 | Original CRISPR | TGTCACTTAGAACTGATTAA AGG (reversed) | Intergenic | ||