ID: 925242396 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:2343157-2343179 |
| Sequence | CCTTCCATACATTATCTGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925242391_925242396 | 18 | Left | 925242391 | 2:2343116-2343138 | CCTTTAATCAGTTCTAAGTGACA | No data | ||
| Right | 925242396 | 2:2343157-2343179 | CCTTCCATACATTATCTGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925242396 | Original CRISPR | CCTTCCATACATTATCTGCA TGG | Intergenic | ||