ID: 925242397

View in Genome Browser
Species Human (GRCh38)
Location 2:2343160-2343182
Sequence TCCATACATTATCTGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925242391_925242397 21 Left 925242391 2:2343116-2343138 CCTTTAATCAGTTCTAAGTGACA No data
Right 925242397 2:2343160-2343182 TCCATACATTATCTGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925242397 Original CRISPR TCCATACATTATCTGCATGG TGG Intergenic
No off target data available for this crispr