ID: 925244392

View in Genome Browser
Species Human (GRCh38)
Location 2:2367427-2367449
Sequence AGCCAGGCCCGCCCCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925244392_925244394 -7 Left 925244392 2:2367427-2367449 CCATCTGTGGGGCGGGCCTGGCT No data
Right 925244394 2:2367443-2367465 CCTGGCTGTCTCATAACTTTAGG No data
925244392_925244395 -6 Left 925244392 2:2367427-2367449 CCATCTGTGGGGCGGGCCTGGCT No data
Right 925244395 2:2367444-2367466 CTGGCTGTCTCATAACTTTAGGG No data
925244392_925244396 -2 Left 925244392 2:2367427-2367449 CCATCTGTGGGGCGGGCCTGGCT No data
Right 925244396 2:2367448-2367470 CTGTCTCATAACTTTAGGGCAGG No data
925244392_925244397 -1 Left 925244392 2:2367427-2367449 CCATCTGTGGGGCGGGCCTGGCT No data
Right 925244397 2:2367449-2367471 TGTCTCATAACTTTAGGGCAGGG No data
925244392_925244398 3 Left 925244392 2:2367427-2367449 CCATCTGTGGGGCGGGCCTGGCT No data
Right 925244398 2:2367453-2367475 TCATAACTTTAGGGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925244392 Original CRISPR AGCCAGGCCCGCCCCACAGA TGG (reversed) Intergenic
No off target data available for this crispr