ID: 925246737

View in Genome Browser
Species Human (GRCh38)
Location 2:2390212-2390234
Sequence GGCCTCAGGAAACACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925246735_925246737 -4 Left 925246735 2:2390193-2390215 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 925246737 2:2390212-2390234 GGCCTCAGGAAACACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925246737 Original CRISPR GGCCTCAGGAAACACAGTGA TGG Intergenic
No off target data available for this crispr