ID: 925247904

View in Genome Browser
Species Human (GRCh38)
Location 2:2401053-2401075
Sequence GTACAACCCTGGACCACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925247904_925247906 -8 Left 925247904 2:2401053-2401075 CCTCTTGTGGTCCAGGGTTGTAC No data
Right 925247906 2:2401068-2401090 GGTTGTACTCAGCCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925247904 Original CRISPR GTACAACCCTGGACCACAAG AGG (reversed) Intergenic
No off target data available for this crispr