ID: 925251910

View in Genome Browser
Species Human (GRCh38)
Location 2:2446120-2446142
Sequence TGCTCCCTCGGGTCCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925251910_925251924 18 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251924 2:2446161-2446183 GGAGCTTGGGTCAAGGAAAAAGG No data
925251910_925251926 30 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251910_925251919 -3 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251919 2:2446140-2446162 GCAGGAGGAGAGGATGTCCTTGG No data
925251910_925251925 26 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251925 2:2446169-2446191 GGTCAAGGAAAAAGGCTGCCCGG No data
925251910_925251922 11 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251922 2:2446154-2446176 TGTCCTTGGAGCTTGGGTCAAGG No data
925251910_925251921 5 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251921 2:2446148-2446170 AGAGGATGTCCTTGGAGCTTGGG No data
925251910_925251920 4 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251920 2:2446147-2446169 GAGAGGATGTCCTTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925251910 Original CRISPR TGCTCCCTCGGGTCCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr