ID: 925251926

View in Genome Browser
Species Human (GRCh38)
Location 2:2446173-2446195
Sequence AAGGAAAAAGGCTGCCCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925251913_925251926 26 Left 925251913 2:2446124-2446146 CCCTGGACCCGAGGGAGCAGGAG No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251918_925251926 18 Left 925251918 2:2446132-2446154 CCGAGGGAGCAGGAGGAGAGGAT No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251910_925251926 30 Left 925251910 2:2446120-2446142 CCACCCCTGGACCCGAGGGAGCA No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251914_925251926 25 Left 925251914 2:2446125-2446147 CCTGGACCCGAGGGAGCAGGAGG No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251917_925251926 19 Left 925251917 2:2446131-2446153 CCCGAGGGAGCAGGAGGAGAGGA No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251912_925251926 27 Left 925251912 2:2446123-2446145 CCCCTGGACCCGAGGGAGCAGGA No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data
925251923_925251926 -7 Left 925251923 2:2446157-2446179 CCTTGGAGCTTGGGTCAAGGAAA No data
Right 925251926 2:2446173-2446195 AAGGAAAAAGGCTGCCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925251926 Original CRISPR AAGGAAAAAGGCTGCCCGGC AGG Intergenic
No off target data available for this crispr