ID: 925262444

View in Genome Browser
Species Human (GRCh38)
Location 2:2540295-2540317
Sequence CAGGCGTGACCACAGTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925262437_925262444 19 Left 925262437 2:2540253-2540275 CCAGGTGCACGAGAGAAGAAAGA No data
Right 925262444 2:2540295-2540317 CAGGCGTGACCACAGTACTGGGG No data
925262436_925262444 20 Left 925262436 2:2540252-2540274 CCCAGGTGCACGAGAGAAGAAAG No data
Right 925262444 2:2540295-2540317 CAGGCGTGACCACAGTACTGGGG No data
925262435_925262444 21 Left 925262435 2:2540251-2540273 CCCCAGGTGCACGAGAGAAGAAA No data
Right 925262444 2:2540295-2540317 CAGGCGTGACCACAGTACTGGGG No data
925262434_925262444 22 Left 925262434 2:2540250-2540272 CCCCCAGGTGCACGAGAGAAGAA No data
Right 925262444 2:2540295-2540317 CAGGCGTGACCACAGTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925262444 Original CRISPR CAGGCGTGACCACAGTACTG GGG Intergenic
No off target data available for this crispr