ID: 925262463

View in Genome Browser
Species Human (GRCh38)
Location 2:2540490-2540512
Sequence CTCCGCTGCCTGGCAAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925262457_925262463 -8 Left 925262457 2:2540475-2540497 CCTCCTCAACCCATGCTCCGCTG No data
Right 925262463 2:2540490-2540512 CTCCGCTGCCTGGCAAGAGAGGG No data
925262455_925262463 16 Left 925262455 2:2540451-2540473 CCATCTAATCAGGTTGGATACCT No data
Right 925262463 2:2540490-2540512 CTCCGCTGCCTGGCAAGAGAGGG No data
925262454_925262463 17 Left 925262454 2:2540450-2540472 CCCATCTAATCAGGTTGGATACC No data
Right 925262463 2:2540490-2540512 CTCCGCTGCCTGGCAAGAGAGGG No data
925262456_925262463 -4 Left 925262456 2:2540471-2540493 CCTTCCTCCTCAACCCATGCTCC No data
Right 925262463 2:2540490-2540512 CTCCGCTGCCTGGCAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925262463 Original CRISPR CTCCGCTGCCTGGCAAGAGA GGG Intergenic
No off target data available for this crispr