ID: 925279371

View in Genome Browser
Species Human (GRCh38)
Location 2:2671998-2672020
Sequence GTCCCAGAAGGGCAGCCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925279365_925279371 10 Left 925279365 2:2671965-2671987 CCAGGGACAATGGGCCATGACTA No data
Right 925279371 2:2671998-2672020 GTCCCAGAAGGGCAGCCGCATGG No data
925279364_925279371 18 Left 925279364 2:2671957-2671979 CCTGCTTTCCAGGGACAATGGGC No data
Right 925279371 2:2671998-2672020 GTCCCAGAAGGGCAGCCGCATGG No data
925279368_925279371 -4 Left 925279368 2:2671979-2672001 CCATGACTACGCTGAGGGAGTCC No data
Right 925279371 2:2671998-2672020 GTCCCAGAAGGGCAGCCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925279371 Original CRISPR GTCCCAGAAGGGCAGCCGCA TGG Intergenic
No off target data available for this crispr