ID: 925279953

View in Genome Browser
Species Human (GRCh38)
Location 2:2676875-2676897
Sequence GACAGCACTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925279951_925279953 17 Left 925279951 2:2676835-2676857 CCTGTACTATCTTCTGCAGATAA No data
Right 925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG No data
925279950_925279953 18 Left 925279950 2:2676834-2676856 CCCTGTACTATCTTCTGCAGATA No data
Right 925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925279953 Original CRISPR GACAGCACTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr