ID: 925288578

View in Genome Browser
Species Human (GRCh38)
Location 2:2731357-2731379
Sequence TCCAGCTGGCTCCCAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925288578_925288584 6 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288584 2:2731386-2731408 GTCCTTGGAGTTCTCCAGGCTGG No data
925288578_925288589 15 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288589 2:2731395-2731417 GTTCTCCAGGCTGGGGAAGGAGG No data
925288578_925288588 12 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288588 2:2731392-2731414 GGAGTTCTCCAGGCTGGGGAAGG No data
925288578_925288585 7 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288585 2:2731387-2731409 TCCTTGGAGTTCTCCAGGCTGGG No data
925288578_925288587 8 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288587 2:2731388-2731410 CCTTGGAGTTCTCCAGGCTGGGG No data
925288578_925288582 -9 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288582 2:2731371-2731393 CCAGCTGGAGTCTTGGTCCTTGG No data
925288578_925288593 24 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288593 2:2731404-2731426 GCTGGGGAAGGAGGCAGCAGGGG No data
925288578_925288594 27 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288594 2:2731407-2731429 GGGGAAGGAGGCAGCAGGGGTGG No data
925288578_925288583 2 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288583 2:2731382-2731404 CTTGGTCCTTGGAGTTCTCCAGG No data
925288578_925288592 23 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288592 2:2731403-2731425 GGCTGGGGAAGGAGGCAGCAGGG No data
925288578_925288591 22 Left 925288578 2:2731357-2731379 CCAGGCCTTGGGAGCCAGCTGGA No data
Right 925288591 2:2731402-2731424 AGGCTGGGGAAGGAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925288578 Original CRISPR TCCAGCTGGCTCCCAAGGCC TGG (reversed) Intergenic
No off target data available for this crispr