ID: 925288864

View in Genome Browser
Species Human (GRCh38)
Location 2:2733479-2733501
Sequence GCCCGCACACGCGTGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925288864_925288872 22 Left 925288864 2:2733479-2733501 CCACCGCACACGCGTGTGCGGGC No data
Right 925288872 2:2733524-2733546 ACCACCGCACACGCGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925288864 Original CRISPR GCCCGCACACGCGTGTGCGG TGG (reversed) Intergenic