ID: 925288873

View in Genome Browser
Species Human (GRCh38)
Location 2:2733525-2733547
Sequence GCCTGCACACGCGTGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925288873_925288879 29 Left 925288873 2:2733525-2733547 CCACCGCACACGCGTGTGCAGGC No data
Right 925288879 2:2733577-2733599 GCTCAGTCTCTTGAGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925288873 Original CRISPR GCCTGCACACGCGTGTGCGG TGG (reversed) Intergenic